Number of tpx reported in output and summary does not correspond

[moxgreen]

Dear authors,
I find discrepancies in the number of TPX reported in the output file and in the summary file, e.g. summary report 27 Total TPX while there are 17 rows in the output file. The number of TPX reported in the summary file (used to calculate the triplex potential) is always bigger than the number of rows reported in output.

The command line I used:

$ triplexator -l 10 -L -1 -e 20 -E -1 -fm 1 -of 1 -o -rm 2 -p 10 -ss ssRNA.fa -ds dsDNA.da

dsDNA.da contain

GGAAGGAGCTGTGCATTGAGGGGTGAAAGCCCGTGCAGAGAACCGTGGGAGAAAGAGGCTGTGGACACGGGGCGGAAGAG
AGGGCTGGGGCGCAGTCGTCAGCTGCCGTGACCCCACAGCTGGGAGCAAGCTGATTCCTGCCTCGGAGCTGCCGTCTCCC
CTGCTGGCCGTTCTCTCTCCCGTGGGGAAACGCCCCCCCCCCCCCCCCGCCCTGCACCTGGCTGGCGGCACCTGTGGGCA
CTGACCACTCCACGCCAGCTGTTTTCCTTGGTTGGGGTTGGGGGCACCGAGCGTTTGGGTGGACCGGAAGTCAGCGTCTG
CATTCGAGCCTGTGTGCGGTGCATGGGCCAAGGGCGCCCACACCCACGCCACCCTTTCCGAAGGAACCGAGCCCCAGCCC
CTCATGG

ssRNA.fa contain

>TERC
GGGTTGCGGAGGGTGGGCCTGGGAGGGGTGGTGGCCATTTTTTGTCTAACCCTAACTGAGAAGGGCGTAGGCGCCGTGCT
TTTGCTCCCCGCGCGCTGTTTTTCTCGCTGACTTTCAGCGGGCGGAAAAGCCTCGGCCTGCCGCCTTCCACCGTTCATTC
TAGAGCAAACAAAAAATGTCAGCTGCTGGCCCGTTCGCCCCTCCCGGGGACCTGCGGCGGGTCGCCTGCCCAGCCCCCGA
ACCCCGCCTGGAGGCCGCGGTCGGCCCGGGGCTTCTCCGGAGGCACCCACTGCCACCGCGAAGAGTTGGGCTCTGTCAGC
CGCGGGTCTCTCGGGGGCGAGGGCGAGGTTCAGGCCTTTCAGGCCGCAGGAAGAGGAACGGAGCGAGTCCCCGCGCGCGG
CGCGATTCCCTGAGCTGTGGGACGTGCACCCAGGACTCGGCTCACACATGCAGTTCGCTTTCCTGTTGGTGGGGGGAACG
CCGATCGTGCGCATCCGTCACCCCTCGCCGGCAATGGGGGCTTGTGAACCCCCAAACCTGA

[amatria]

Triplexator reports the maximal set of triplexes by default. Maximal set of triplexes means "the set of triplexes that cannot be extended without violating the search constraints". Therefore, even though Triplexator detected 27 triple helices (as you see in the summary file), it only reported 17 maximal triplexes in the output file. If you want to report all 27 triplexes, add -a to your search parameters.

[starrzy]

I gusse so. But in README.txt, it wrote "- TTSs (abs) : absolute number of maximal TTSs found in the sequence", cofusing me. And is there any way to get TTSs (rel) of maximal triplexes in summary report (not all, default is all triplexes).

[amatria]

"- TTSs (abs) : absolute number of maximal TTSs found in the sequence"

I know right. That is confusing, indeed.

is there any way to get TTSs (rel) of maximal triplexes in summary report (not all, default is all triplexes).

You can change the code as follows to report only the maximal triplex features in the summary file: https://diffy.org/diff/77ee352171e1e.

By the way, if you are using Triplexator as of today, you should consider switching to PATO, a modern and up-to-date version of Triplexator that I am maintaining 😃. PATO allows faster (220 times faster than Triplexator with 64 threads) and more accurate triplex searchs and it works just like Triplexator, as it exports the same command line interface and output formats.

[starrzy]

Thank you very much! I will try PATO😄.