[LeetCode Sync] Runtime - 35 ms (19.72%), Memory - 28.8 MB (76.73%)

Author: NinePiece2

Solutions/0187-repeated-dna-sequences/README.md

@@ -0,0 +1,25 @@
+<p>The <strong>DNA sequence</strong> is composed of a series of nucleotides abbreviated as <code>&#39;A&#39;</code>, <code>&#39;C&#39;</code>, <code>&#39;G&#39;</code>, and <code>&#39;T&#39;</code>.</p>
+
+<ul>
+	<li>For example, <code>&quot;ACGAATTCCG&quot;</code> is a <strong>DNA sequence</strong>.</li>
+</ul>
+
+<p>When studying <strong>DNA</strong>, it is useful to identify repeated sequences within the DNA.</p>
+
+<p>Given a string <code>s</code> that represents a <strong>DNA sequence</strong>, return all the <strong><code>10</code>-letter-long</strong> sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in <strong>any order</strong>.</p>
+
+<p>&nbsp;</p>
+<p><strong class="example">Example 1:</strong></p>
+<pre><strong>Input:</strong> s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
+<strong>Output:</strong> ["AAAAACCCCC","CCCCCAAAAA"]
+</pre><p><strong class="example">Example 2:</strong></p>
+<pre><strong>Input:</strong> s = "AAAAAAAAAAAAA"
+<strong>Output:</strong> ["AAAAAAAAAA"]
+</pre>
+<p>&nbsp;</p>
+<p><strong>Constraints:</strong></p>
+
+<ul>
+	<li><code>1 &lt;= s.length &lt;= 10<sup>5</sup></code></li>
+	<li><code>s[i]</code> is either <code>&#39;A&#39;</code>, <code>&#39;C&#39;</code>, <code>&#39;G&#39;</code>, or <code>&#39;T&#39;</code>.</li>
+</ul>

Solutions/0187-repeated-dna-sequences/solution.py

@@ -0,0 +1,12 @@
+class Solution:
+    def findRepeatedDnaSequences(self, s: str) -> List[str]:
+        # This is the promary use case of Rabin-Karp?
+        count = Counter()
+        result = []
+        for i in range(len(s) - 9): # len(s) - 10 + 1
+            tmp = s[i:i + 10]
+            count[tmp] += 1
+            if count[tmp] == 2:
+                result.append(tmp)
+        
+        return result