diff --git a/CHANGELOG.md b/CHANGELOG.md index 31352f4..1f7721b 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -2,4 +2,21 @@ ## 10.07.18 -Adapt Makefile to call raxml-ng instead of raxml. \ No newline at end of file +Adapted Makefile to call raxml-ng instead of raxml. + +## 09.08.18 + +Adapted Makefile to call raxml-ng with `-all` to include bootstrap analysis. + +## 10.08.18 + +Added script `minimal_branchlength.py` that calculates minimal branchlength and related bootstrap +values for each leaf and plots these. `minimal_branchlength.sh` is a bash script that calls it the +python script a specified number of times to analyse newick files stored in out$number directories. +`Make minimal_branchlength` calls the bash script. + +## 11.08.18 + +Added script `uptree_branchlength.py` that calculates the branchlength to the uptree neighbour and related bootstrap values for each leaf and plots these. `uptree_branchlength.sh` is a bash script that calls it the +python script a specified number of times to analyse newick files stored in out$number directories. +`Make uptree_branchlength` calls the bash script. \ No newline at end of file diff --git a/Makefile b/Makefile index e7b4d33..382c861 100644 --- a/Makefile +++ b/Makefile @@ -32,13 +32,19 @@ $(OUTDIR)/%-phyml.newick: $(OUTDIR)/%.phy rm -f $(OUTDIR)/*.phy_phyml_*_xxxxx* $(OUTDIR)/%-raxml.newick: $(OUTDIR)/%.phy - raxml-ng --msa $< --model GTR+G --prefix xxxxx --seed $$RANDOM --threads 1 >/dev/null - mv xxxxx.raxml.bestTree $@ + raxml-ng --all --msa $< --model GTR+G --prefix xxxxx --seed $$RANDOM --threads 1 >/dev/null + mv xxxxx.raxml.support $@ rm -f xxxxx.* $(OUTDIR)/%.ascii: $(OUTDIR)/%.newick newick-to-ascii.py --outgroup $(OUTGROUP) < $< > $@ +minimal_distance: + minimal_distance.sh + +branchlength: + branchlength.sh + clean: rm -f $(ASCII) $(NEWICK) $(PHY) $(OUTDIR)/*xxxxx* xxxxx.* diff --git a/README.md b/README.md index 923fef8..ab72217 100644 --- a/README.md +++ b/README.md @@ -13,3 +13,21 @@ Install [RAxML](https://github.com/amkozlov/raxml-ng). If on a mac with Install [phyml](http://www.atgc-montpellier.fr/phyml/). If on a mac with [brew](https://brew.sh/) you can just run `brew install phyml`. + +## Plot recombinant tree data + +One dataset (stored as out$i) contains trees generated from all json specification files, here different sequences are recombined. + +`make` generates newick (with bootstrapvalues) and ascii files. + +`make branchlength` plots bootstrap values against tip branchlengths for all trees in i datasets (i specified in `branchlength.sh`). + +`make minimal_distance` plots bootstrap values against tip minimal distance to another tip for all trees in i datasets (i specified in `minimal_distance.sh`). + +## Recombinantgradients + +One dataset (stored as out$i) contains trees generated from the json specification files, here the recombinant is formed from to set sequences, but to varying percentages. + +`make` generates newick (without bootstrapvalues for raxml-ng) and ascii files. + +`../recombinant_gradient.py *raxml.newick > outtest` plots percentage of recombinant from one parent against the distance to it. diff --git a/branchlength.py b/branchlength.py new file mode 100755 index 0000000..a616803 --- /dev/null +++ b/branchlength.py @@ -0,0 +1,66 @@ +#!/usr/bin/env python + +from ete3 import Tree +from argparse import ArgumentParser +import matplotlib.pyplot as plt +import seaborn + +def branchlength(newickfile): + + def plot_bl_bysupport(allmindistances, allsupportvalues, allleaves): + plt.figure() + plt.scatter(allmindistances, allsupportvalues) + for i, leaf in enumerate(allleaves): + if leaf == "recombinant": + plt.annotate(leaf, (allmindistances[i], allsupportvalues[i])) + plt.scatter(allmindistances[i], allsupportvalues[i], c='r') + else: + pass + #plt.annotate(leaf, (allmindistances[i], allsupportvalues[i])) + plottitle = str(name) + plt.title(plottitle) + plt.xlabel('Minimal branchlength to another leaf', fontsize=14) + #plt.xlim((0, 0.7)) + plt.ylabel('Support value', fontsize=14) + plt.ylim((15, 102)) + plt.tight_layout() + plotpath = 'branchlengthplot/' + str(name) + '.png' + plt.savefig(plotpath, dpi=300) + + # Input the tree data. This is written for newick, as the code assumes only + # one input line. + with open(newickfile) as f: + name = f.name + print('Analysing sample:', name) + treedata = f.read() + treedata = treedata.strip() + t = Tree(treedata) + + # Reroot the tree. + t.set_outgroup("root") + + allleaves = [] + allbranchlengths = [] + allsupportvalues = [] + + for leaf in t: + stringleaf = str(leaf.name) + allleaves.append(stringleaf) + leafup = leaf.up + branchlength = leafup.get_distance(stringleaf) + print('The branchlength of %s is %f.' %(stringleaf, branchlength)) + allbranchlengths.append(branchlength) + supportvalue = leafup.support + print('The support value of %s is %f.' %(stringleaf, supportvalue)) + allsupportvalues.append(supportvalue) + + plot_bl_bysupport(allbranchlengths[1:], allsupportvalues[1:], allleaves[1:]) + +parser = ArgumentParser() +parser.add_argument('fname', nargs='+', action='append', metavar='FILE', help='Newick file to analyse.') +args = parser.parse_args() + +filenames = args.fname +for filename in filenames[0]: + branchlength(filename) + diff --git a/branchlength.sh b/branchlength.sh new file mode 100755 index 0000000..eae56c6 --- /dev/null +++ b/branchlength.sh @@ -0,0 +1,7 @@ +for i in $(seq 5) +do +cd out$i +mkdir branchlengthplot +../branchlength.py *raxml.newick > branchlength_$i +cd .. +done \ No newline at end of file diff --git a/minimal_distance.py b/minimal_distance.py new file mode 100755 index 0000000..a695ee1 --- /dev/null +++ b/minimal_distance.py @@ -0,0 +1,99 @@ +#!/usr/bin/env python + +from ete3 import Tree +from argparse import ArgumentParser +import matplotlib.pyplot as plt +import seaborn + +def maxbranchlength(newickfile): + + def plot_bl_bysupport(allmindistances, allaveragedistances, allleaves): + plt.figure() + plt.scatter(allmindistances, allaveragedistances) + for i, leaf in enumerate(allleaves): + if leaf == "recombinant": + plt.annotate(leaf, (allmindistances[i], allaveragedistances[i])) + plt.scatter(allmindistances[i], allaveragedistances[i], c='r') + else: + pass + #plt.annotate(leaf, (allmindistances[i], allaveragedistances[i])) + plottitle = str(name) + plt.title(plottitle) + plt.xlabel('Minimal branchlength to another leaf', fontsize=14) + plt.xlim((0, 0.7)) + plt.ylabel('Support value', fontsize=14) + plt.ylim((15, 102)) + plt.tight_layout() + plotpath = 'branchlengthplot/' + str(name) + '.png' + plt.savefig(plotpath, dpi=300) + + # Input the tree data. This is written for newick, as the code assumes only + # one input line. + with open(newickfile) as f: + name = f.name + print('Analysing sample:', name) + treedata = f.read() + treedata = treedata.strip() + t = Tree(treedata) + + # Reroot the tree. + t.set_outgroup("root") + + allleaves = [] + allmindistanceleaves = [] + allmindistances = [] + allsupportvalues = [] + + for leaf in t: + stringleaf = str(leaf.name) + allleaves.append(stringleaf) + + # Find the leaf2 with the smallest distance to leaf. + alldistances = [] + allleaves2 = [] + for leaf2 in t: + stringleaf2 = str(leaf2.name) + if stringleaf2 == stringleaf: + pass + else: + distance = leaf2.get_distance(stringleaf) + alldistances.append(distance) + allleaves2.append(stringleaf2) + mindist = min(alldistances) + allmindistances.append(mindist) + leaf2mindist = allleaves2[alldistances.index(mindist)] + allmindistanceleaves.append(leaf2mindist) + + # Find support value for parent internal node of leaf. + leafup = leaf.up + supportvalue = leafup.support + allsupportvalues.append(supportvalue) + + # Textoutput. + if "recombinant" not in allleaves: + print('There is no recombinant in this sample.') + maxmindist = max(allmindistances) + maxminleaf = str(allleaves[allmindistances.index(maxmindist)]) + maxminleaf2 = str(allmindistanceleaves[allmindistances.index(maxmindist)]) + minsupport = min(allsupportvalues[1:]) + minsupportleaf = str(allleaves[allsupportvalues.index(minsupport)]) + print('The leaf with the biggest minimal distance to another leaf is %s, to %s.' %(maxminleaf, maxminleaf2)) + print('The leaf with the parental node with a minimal branch bootstrap value is %s.' %(minsupportleaf)) + #print(allleaves) + #print(allmindistanceleaves) + #print(allmindistances) + #print(allsupportvalues) + if all(element==1.0 for element in allsupportvalues): + print('There are no bootstrapvalues in the newick file.') + + # Plot branchlength against bootstrap value, leave out root (at index 0). + plot_bl_bysupport(allmindistances[1:], allsupportvalues[1:], allleaves[1:]) + +parser = ArgumentParser() +parser.add_argument('fname', nargs='+', action='append', metavar='FILE', help='Newick file to analyse.') +args = parser.parse_args() + +filenames = args.fname +for filename in filenames[0]: + maxbranchlength(filename) + print('\n') \ No newline at end of file diff --git a/minimal_distance.sh b/minimal_distance.sh new file mode 100755 index 0000000..8f0bb18 --- /dev/null +++ b/minimal_distance.sh @@ -0,0 +1,7 @@ +for i in $(seq 5) +do +cd out$i +mkdir minimal_distanceplot +../minimal_distance.py *raxml.newick > minimal_distance_$i +cd .. +done \ No newline at end of file diff --git a/out1/.DS_Store b/out1/.DS_Store new file mode 100644 index 0000000..5008ddf Binary files /dev/null and b/out1/.DS_Store differ diff --git a/out1/branchlength_1 b/out1/branchlength_1 new file mode 100644 index 0000000..95b350d --- /dev/null +++ b/out1/branchlength_1 @@ -0,0 +1,313 @@ +Analysing sample: recombinant-50A1-50B1-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 94.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 99.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 99.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 98.000000. +The branchlength of B-mutant-9 is 0.107974. +The support value of B-mutant-9 is 98.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 100.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 87.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 57.000000. +The branchlength of B is 0.000001. +The support value of B is 57.000000. +The branchlength of recombinant is 0.052289. +The support value of recombinant is 57.000000. +The branchlength of A is 0.000001. +The support value of A is 99.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 90.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 98.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 90.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 100.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 92.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 99.000000. +The branchlength of A-mutant-9 is 0.062289. +The support value of A-mutant-9 is 100.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 90.000000. +Analysing sample: recombinant-50A1-50B9-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of recombinant is 0.127636. +The support value of recombinant is 83.000000. +The branchlength of A is 0.000001. +The support value of A is 97.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 97.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 99.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 100.000000. +The branchlength of A-mutant-9 is 0.030620. +The support value of A-mutant-9 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 77.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 96.000000. +The branchlength of B is 0.000001. +The support value of B is 81.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 86.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 87.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 83.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 95.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 99.000000. +The branchlength of B-mutant-9 is 0.030333. +The support value of B-mutant-9 is 98.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 98.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 98.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 91.000000. +Analysing sample: recombinant-50A5-50random-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 100.000000. +The branchlength of B-mutant-3 is 0.020306. +The support value of B-mutant-3 is 99.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 98.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 97.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 95.000000. +The branchlength of B-mutant-9 is 0.042104. +The support value of B-mutant-9 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 99.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 100.000000. +The branchlength of B is 0.000001. +The support value of B is 100.000000. +The branchlength of A is 0.000001. +The support value of A is 100.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 99.000000. +The branchlength of A-mutant-2 is 0.011346. +The support value of A-mutant-2 is 99.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 97.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 86.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 85.000000. +The branchlength of recombinant is 0.482796. +The support value of recombinant is 75.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 84.000000. +The branchlength of A-mutant-7 is 0.009946. +The support value of A-mutant-7 is 99.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 88.000000. +The branchlength of A-mutant-9 is 0.084142. +The support value of A-mutant-9 is 88.000000. +Analysing sample: recombinant-75A1-25B1-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of recombinant is 0.000001. +The support value of recombinant is 100.000000. +The branchlength of A is 0.031333. +The support value of A is 79.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 66.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 99.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 99.000000. +The branchlength of A-mutant-5 is 0.009554. +The support value of A-mutant-5 is 99.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 98.000000. +The branchlength of A-mutant-9 is 0.000001. +The support value of A-mutant-9 is 96.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 96.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 97.000000. +The branchlength of B is 0.000001. +The support value of B is 100.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 98.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 92.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 98.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 91.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 97.000000. +The branchlength of B-mutant-9 is 0.074440. +The support value of B-mutant-9 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 89.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 93.000000. +Analysing sample: recombinant-75A1-25B9-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of B-mutant-1 is 0.009956. +The support value of B-mutant-1 is 99.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 90.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 99.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 99.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 100.000000. +The branchlength of B-mutant-9 is 0.085408. +The support value of B-mutant-9 is 92.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 92.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 92.000000. +The branchlength of B is 0.009561. +The support value of B is 99.000000. +The branchlength of recombinant is 0.134010. +The support value of recombinant is 87.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 98.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 100.000000. +The branchlength of A-mutant-7 is 0.009762. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-9 is 0.061752. +The support value of A-mutant-9 is 96.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 96.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 84.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 98.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 97.000000. +The branchlength of A is 0.009510. +The support value of A is 100.000000. +Analysing sample: recombinant-75A5-25B5-raxml.newick +The branchlength of root is 0.004246. +The support value of root is 1.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 100.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 96.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 94.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 99.000000. +The branchlength of B-mutant-9 is 0.098483. +The support value of B-mutant-9 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-7 is 0.013401. +The support value of B-mutant-7 is 100.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 91.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 100.000000. +The branchlength of B is 0.000001. +The support value of B is 100.000000. +The branchlength of A is 0.000001. +The support value of A is 100.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 99.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 100.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 98.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 100.000000. +The branchlength of recombinant is 0.132200. +The support value of recombinant is 100.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 72.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 95.000000. +The branchlength of A-mutant-9 is 0.050951. +The support value of A-mutant-9 is 97.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 97.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 98.000000. +Analysing sample: two-ladders-raxml.newick +The branchlength of root is 0.004342. +The support value of root is 1.000000. +The branchlength of A is 0.000001. +The support value of A is 100.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 72.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 98.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 100.000000. +The branchlength of A-mutant-9 is 0.041464. +The support value of A-mutant-9 is 100.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 97.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 64.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 100.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 87.000000. +The branchlength of B is 0.000001. +The support value of B is 100.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 100.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 93.000000. +The branchlength of B-mutant-4 is 0.009930. +The support value of B-mutant-4 is 88.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 98.000000. +The branchlength of B-mutant-9 is 0.019946. +The support value of B-mutant-9 is 98.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 98.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 100.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 97.000000. diff --git a/out1/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png b/out1/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png new file mode 100644 index 0000000..4935715 Binary files /dev/null and b/out1/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png differ diff --git a/out1/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png b/out1/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png new file mode 100644 index 0000000..f70860a Binary files /dev/null and b/out1/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png differ diff --git a/out1/branchlengthplot/recombinant-50A5-50random-raxml.newick.png b/out1/branchlengthplot/recombinant-50A5-50random-raxml.newick.png new file mode 100644 index 0000000..7025b38 Binary files /dev/null and b/out1/branchlengthplot/recombinant-50A5-50random-raxml.newick.png differ diff --git a/out1/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png b/out1/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png new file mode 100644 index 0000000..3239097 Binary files /dev/null and b/out1/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png differ diff --git a/out1/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png b/out1/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png new file mode 100644 index 0000000..3e910b3 Binary files /dev/null and b/out1/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png differ diff --git a/out1/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png b/out1/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png new file mode 100644 index 0000000..cbcd188 Binary files /dev/null and b/out1/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png differ diff --git a/out1/branchlengthplot/two-ladders-raxml.newick.png b/out1/branchlengthplot/two-ladders-raxml.newick.png new file mode 100644 index 0000000..d399b6f Binary files /dev/null and b/out1/branchlengthplot/two-ladders-raxml.newick.png differ diff --git a/out1/minimal_distance_1 b/out1/minimal_distance_1 new file mode 100644 index 0000000..bf88d47 --- /dev/null +++ b/out1/minimal_distance_1 @@ -0,0 +1,36 @@ +Analysing sample: recombinant-50A1-50B1-raxml.newick +The leaf with the biggest minimal distance to another leaf is B-mutant-9, to B-mutant-8. +The leaf with the parental node with a minimal branch bootstrap value is B-mutant-1. + + +Analysing sample: recombinant-50A1-50B9-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to root. +The leaf with the parental node with a minimal branch bootstrap value is A-mutant-7. + + +Analysing sample: recombinant-50A5-50random-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-5. +The leaf with the parental node with a minimal branch bootstrap value is recombinant. + + +Analysing sample: recombinant-75A1-25B1-raxml.newick +The leaf with the biggest minimal distance to another leaf is root, to B. +The leaf with the parental node with a minimal branch bootstrap value is A-mutant-1. + + +Analysing sample: recombinant-75A1-25B9-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-1. +The leaf with the parental node with a minimal branch bootstrap value is A-mutant-4. + + +Analysing sample: recombinant-75A5-25B5-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-5. +The leaf with the parental node with a minimal branch bootstrap value is A-mutant-5. + + +Analysing sample: two-ladders-raxml.newick +There is no recombinant in this sample. +The leaf with the biggest minimal distance to another leaf is root, to B. +The leaf with the parental node with a minimal branch bootstrap value is A-mutant-6. + + diff --git a/out1/recombinant-50A1-50B1-phyml.ascii b/out1/recombinant-50A1-50B1-phyml.ascii new file mode 100644 index 0000000..145b0c2 --- /dev/null +++ b/out1/recombinant-50A1-50B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-root + | + | /-A + | /-| + | | | /-A-mutant-1 + | | \-| +--| | | /-A-mutant-2 + | | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + | | \-| + | | | /-A-mutant-5 + \-| \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-9 + | \-| + | \-A-mutant-8 + | + | /-recombinant + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/out1/recombinant-50A1-50B1-phyml.newick b/out1/recombinant-50A1-50B1-phyml.newick new file mode 100644 index 0000000..aa2ccce --- /dev/null +++ b/out1/recombinant-50A1-50B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000000,B-mutant-9:0.10842401,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000001,(B-mutant-4:0.00000001,(B-mutant-3:0.00000000,(B-mutant-2:0.00000000,(B-mutant-1:0.00000000,(recombinant:0.05241034,(root:0.00000001,(A:0.00000001,(A-mutant-1:0.00000001,(A-mutant-2:0.00000001,(A-mutant-3:0.00000000,(A-mutant-4:0.00000000,(A-mutant-5:0.00000000,(A-mutant-6:0.00000000,(A-mutant-7:0.00000001,(A-mutant-9:0.06237657,A-mutant-8:0.00000001)1.000000:0.06240583)0.998420:0.02022018)1.000000:0.05173384)0.999960:0.03066581)1.000000:0.06289724)0.997834:0.02031353)1.000000:0.05187448)0.999046:0.03080150)1.000000:0.12006857)0.977205:0.06325124)0.000000:0.00000001)0.999388:0.02049739)0.999885:0.03098157)1.000000:0.08612194)1.000000:0.09757583)1.000000:0.06326444)1.000000:0.05224986)0.999871:0.03076099); diff --git a/out1/recombinant-50A1-50B1-raxml.ascii b/out1/recombinant-50A1-50B1-raxml.ascii new file mode 100644 index 0000000..7df5284 --- /dev/null +++ b/out1/recombinant-50A1-50B1-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B-mutant-3 + | | + | /-| /-B-mutant-4 + | | | | + | | | | /-B-mutant-6 + | | \-| /-| + | | | | | /-B-mutant-7 + | | | | \-| + | /-| \-| | /-B-mutant-8 +--| | | | \-| + | | | | \-B-mutant-9 + | | | | + | /-| | \-B-mutant-5 + | | | | + | | | \-B-mutant-2 + | | | + | /-| | /-B-mutant-1 + | | | \-| + | | | \-B + | | | + \-| \-recombinant + | + | /-A + | | + \-| /-A-mutant-1 + | | + \-| /-A-mutant-2 + | | + \-| /-A-mutant-3 + | | + \-| /-A-mutant-4 + | | + \-| /-A-mutant-5 + | | + \-| /-A-mutant-6 + | | + \-| /-A-mutant-9 + | /-| + \-| \-A-mutant-8 + | + \-A-mutant-7 diff --git a/out1/recombinant-50A1-50B1-raxml.newick b/out1/recombinant-50A1-50B1-raxml.newick new file mode 100644 index 0000000..440ba8a --- /dev/null +++ b/out1/recombinant-50A1-50B1-raxml.newick @@ -0,0 +1 @@ +((A-mutant-9:0.062289,A-mutant-8:0.000001)100:0.062298,A-mutant-7:0.000001,(A-mutant-6:0.000001,(A-mutant-5:0.000001,((A-mutant-3:0.000001,(A-mutant-2:0.000001,(((root:0.000001,((((B-mutant-3:0.000001,(B-mutant-4:0.000001,((B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-8:0.000001,B-mutant-9:0.107974)98:0.030661)99:0.052045)100:0.062976,B-mutant-5:0.000001)100:0.097090)99:0.085697)94:0.030881,B-mutant-2:0.000001)87:0.020454,(B-mutant-1:0.000001,B:0.000001)57:0.000001)76:0.000001,recombinant:0.052289)57:0.063030)99:0.119591,A:0.000001)90:0.030749,A-mutant-1:0.000001)98:0.051766)90:0.020289)100:0.062753,A-mutant-4:0.000001)92:0.030618)99:0.051646)90:0.020195):0.0; diff --git a/out1/recombinant-50A1-50B1.fasta b/out1/recombinant-50A1-50B1.fasta new file mode 100644 index 0000000..f062c06 --- /dev/null +++ b/out1/recombinant-50A1-50B1.fasta @@ -0,0 +1,44 @@ +>root +ACCCACATCACCACGACGGCTCTAAACATTTAGACCGCACAATCCTGTTGGTGTTATGACTAAATAAGTTACTCAAGTGTTCGAAAGCTGAGCTGTATTT +>A +CCCCACATCACCACGACGGCTCTAAACATATAGACCGCACACTCCTATTGGTGTTATGACTTAATGCGTTACTCAAGTGTAGGACAGCTCAGCTGTATTT +>A-mutant-1 +CCCCACATCACCACGACGGCTCTAACCATATAGACCGCACACTCCTATTGGTGTAATGACTTAATGCGTTACTCAAGTGTAGGACAGCTCAGCTGTAGTT +>A-mutant-2 +CCCCACATCACGACAACGGCTCTAACCATATAGACCGCACACTCCTATTCGTGTGATGACTTAATGCGTTACACAAGTGTAGGACAGCTCAGCTGTAGTT +>A-mutant-3 +CCCCACATCACGACAACGGCTCTAACCATATAGACCGCACACTCCTATTCGTGTGATGACTTAATACGTTACACAAGTGTAGGACAGATCAGCTGTAGTT +>A-mutant-4 +CCCCCCATCGCGACAACGGCTCTAACCATAGAGACCGCACACTCCTATCCGTGTGATGACTTTATATGTTACACAAGTGTAGGACAGATCAGCTGTAGTT +>A-mutant-5 +CCCCCCATCGCGACAACGGCTCTAACCATAGAGACCGCACACTACTATCCTTGTGATGACTTTATATGTTACACAAGTGTAGGACAGATCAGCTGTGGTT +>A-mutant-6 +CCCGCCATCGCGACAACGGCTCTAACCATAGAGACCGCAGACTACTATCCTTGTGATGTCTTTATATGGTACACAAGTGTAGAACAGATCAGCTGTGGTT +>A-mutant-7 +CCCGCCACCGCGACAACGGCTCTAACCATAGAGACCGCAGACTACTATCCTTGTGATGTCTTTATATAGTACACAAGTGTAGAACAGATCAGCTGTGGTT +>A-mutant-8 +CCCGCCACCGCGACAACGGCTCTAACCATCGAGACCGCAGACCACTATACTGGTGATGTCTTTATATAGTACACAAGTGTAGTACAGATCAGCTGTGGTA +>A-mutant-9 +CCCGCCACCGCGACAACGCTCCTAACCATCGAGACCGCAGACCATTATACTGGTGATGGCTTAATATAGTACACAAGTGTAGTACAGATCAGCTGTGGTA +>B +ACCCACATCACCACGACGGCTCTAATCATTTAGACCGCACAATCCTGTTGGTGTTATGACTAAATAACTTACTGAAGTGTTCGAAAGTTTAGCTGAATTT +>B-mutant-1 +ACCCACATCACCACGACGGCTCTAATCATTTAGACCGCACAATCCTGTTGGTGTTATGACTAAATAACTTACTGAAGTGTTCGAAAGTTTAGCTGAATTT +>B-mutant-2 +ACCCACATCACCACGACGGCTCTAATCATTTAGACCGCAAAATCCTGTTGGTGTTATGACTAAATAACTTACTGAAGTGTTCGAAAGTTTAGCTCAATTT +>B-mutant-3 +ACCGACATCACCTCGACGGCTCTAATCATTTAGACCGCTAAATCCTGTTGGTGTTATGACTAAATAACTTACTGAAGTGTTCGAAAGTTTAGCTCAATTT +>B-mutant-4 +ATCGACATCACCTGGACGGCTCAAATCATTTGGACCGCTAAATCCTGTTGATGTTACGACTAAATAACTTACTGAAGTGTTCGAAATTTTAGCTAAATTT +>B-mutant-5 +CTCGTCATCACCTGGACGGTTCAAATCATTTGGACCGCTGAATCTTGTTGATGTTACGACCATATAACTTACTGCAGTGTTCGAAATTTTAGGTAAATTT +>B-mutant-6 +CTCGTCATCACGTGGACGGTTCAAATCATTTGGACCGCTGAATCTTGTTGATGTTGCGACCATATAACTTACTGCAGTGTACGCAATTTTAGGTTAATTC +>B-mutant-7 +CTCGTCATCACGTGGACGGTTCAAAGCATTTGGACCGCTGAATCTTGCTGATGTTGCAACCATATAACTTACTGCAGTGTACGCAATTTTAGCTTAATAC +>B-mutant-8 +CGCGTCATCACGTGGACGGTTCAAAGCATTTGGACCGCTGAATCTTGCTGATGTTGCAACCATATAACTGACTGCAGAGTACGCAATTTTAGCTTAATAC +>B-mutant-9 +CGCGTCATCACATGGACGGTTCCAGGCATTTTTACCGGTAAATCTTTATGATGTTGCACCCATATAACTGACTGCAGAGTACGCAATTTTAGCTTAATAC +>recombinant +CCCCACATCACCACGACGGCTCTAACCATATAGACCGCACACTCCTATTGGTGTTATGACTAAATAACTTACTGAAGTGTTCGAAAGTTTAGCTGAATTT diff --git a/out1/recombinant-50A1-50B9-phyml.ascii b/out1/recombinant-50A1-50B9-phyml.ascii new file mode 100644 index 0000000..b3cc81e --- /dev/null +++ b/out1/recombinant-50A1-50B9-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| +--| | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + \-| \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-8 + | \-| + | \-B-mutant-9 + | + | /-recombinant + \-| + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/out1/recombinant-50A1-50B9-phyml.newick b/out1/recombinant-50A1-50B9-phyml.newick new file mode 100644 index 0000000..2f38b0c --- /dev/null +++ b/out1/recombinant-50A1-50B9-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.03089275,A-mutant-8:0.00000000,(A-mutant-7:0.00000001,(A-mutant-6:0.00000001,(A-mutant-5:0.00000001,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000001,(A-mutant-1:0.00000001,(A:0.00000000,(recombinant:0.12887604,(root:0.00000001,(B:0.00000001,(B-mutant-1:0.00000001,(B-mutant-2:0.00000001,(B-mutant-3:0.00000001,(B-mutant-4:0.00000001,(B-mutant-5:0.00000001,(B-mutant-6:0.00000000,(B-mutant-7:0.00000001,(B-mutant-8:0.00000001,B-mutant-9:0.03059802)0.999999:0.05195990)0.999999:0.05207067)1.000000:0.06359568)0.999946:0.04137183)1.000000:0.05242577)0.999880:0.03070806)0.999984:0.04112174)1.000000:0.07433703)1.000000:0.06361996)0.985466:0.05826913)0.999788:0.07884664)0.998370:0.03169585)1.000000:0.05468823)1.000000:0.06613930)0.999999:0.04444750)0.999820:0.04362638)1.000000:0.11252061)0.869602:0.02046401)1.000000:0.07522680); diff --git a/out1/recombinant-50A1-50B9-raxml.ascii b/out1/recombinant-50A1-50B9-raxml.ascii new file mode 100644 index 0000000..1abea5c --- /dev/null +++ b/out1/recombinant-50A1-50B9-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-recombinant + | | + | | /-A + | | | + | /-| | /-A-mutant-2 + | | | | | +--| | | | | /-A-mutant-4 + | | | | | | + | | \-| /-| /-| /-A-mutant-5 + | | | | | | | | + | | | | | | \-| /-A-mutant-6 + | | | | | | | | + | | | | | | \-| /-A-mutant-8 + | | | | \-| | /-| + \-| \-| | \-| \-A-mutant-9 + | | | | + | | | \-A-mutant-7 + | | | + | | \-A-mutant-3 + | | + | \-A-mutant-1 + | + | /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + | | /-B-mutant-3 + \-| | + | | /-B-mutant-5 + | | | + \-| /-| /-B-mutant-6 + | | | | + | | \-| /-B-mutant-9 + | | | /-| + \-| \-| \-B-mutant-8 + | | + | \-B-mutant-7 + | + \-B-mutant-4 diff --git a/out1/recombinant-50A1-50B9-raxml.newick b/out1/recombinant-50A1-50B9-raxml.newick new file mode 100644 index 0000000..32dacf7 --- /dev/null +++ b/out1/recombinant-50A1-50B9-raxml.newick @@ -0,0 +1 @@ +((B:0.000001,((recombinant:0.127636,(A:0.000001,((A-mutant-2:0.000001,((A-mutant-4:0.000001,(A-mutant-5:0.000001,(A-mutant-6:0.000001,((A-mutant-8:0.000001,A-mutant-9:0.030620)100:0.075058,A-mutant-7:0.000001)77:0.020343)100:0.111894)99:0.043011)97:0.043802,A-mutant-3:0.000001)100:0.065424)100:0.053826,A-mutant-1:0.000001)96:0.031254)97:0.078067)83:0.057471,root:0.000001)81:0.063167)86:0.073984,B-mutant-1:0.000001,(B-mutant-2:0.000001,(B-mutant-3:0.000001,((B-mutant-5:0.000001,(B-mutant-6:0.000001,((B-mutant-9:0.030333,B-mutant-8:0.000001)98:0.051536,B-mutant-7:0.000001)98:0.051499)99:0.062928)95:0.040948,B-mutant-4:0.000001)91:0.051876)83:0.030477)87:0.040800):0.0; diff --git a/out1/recombinant-50A1-50B9.fasta b/out1/recombinant-50A1-50B9.fasta new file mode 100644 index 0000000..8278c43 --- /dev/null +++ b/out1/recombinant-50A1-50B9.fasta @@ -0,0 +1,44 @@ +>root +ATGCGAAGTCGGAGTACTGAGTCGTTGCACATAAACTTATGAAGAAAGTAGTCGATAATCCCGCAACCGAGCGCTCTCGGAGGCCAGGCAAAACCACTCA +>A +ATGAGAAGTCGGAGTACTGAGTCGGCGCACATAAACTTACGAAGAAAGTAGTCGATAATCCCGCAACCGCGGGATCTCCGGGCCCAGGCAGAACCGCTCA +>A-mutant-1 +ATGAGAAGTCGAAGTACTGAGTCGGCGCACATAAACTTACGAAGAAAGTAGTCGATAATCCCGCAACCGCGGGATCTCCGGGCCCAGGAAGAACCGATCA +>A-mutant-2 +ATGAGAAGTCGAAGTACTGAGTCGGCGCGCAGAAACTTACGAAGCAAGTAGTAGATAATCCCGCAACCGCGGGATCTCCGGGCCCAGGAAGAGCCGATCA +>A-mutant-3 +ATGAGAAGTCGAAGTACTGAGACGGCGCGCAGAAAATTACGAAGCAAGGATTAGATAATCCCGCAACCGCGGGACCTCCGGGCCCAGGAAGAGCTGATCA +>A-mutant-4 +AGAAGAAGTCGAAGTACTGAGACGGCGCGCAGAAAATTACGAAGCAAGGATTAGATAATCCCACAACCGCGGGACCTCAGGGCCCAGGAAGAGCTGATCA +>A-mutant-5 +AGAAGAAGTCGAAGTACTGAGACGGCGCGCAGAAAATTACGCAGCATGGATTAGATAATCCCACCACCGCGGTACCTCAGGGCCCAGGAAGAGCTGATCA +>A-mutant-6 +TGAAGTAGTCGAATTACTGAGACGGCGTGCAGAAAATTACGGACCATGGATTAGATAATCCCACCACCTCGGTAGCTCACGGCCCAGGAAGAGCTGGTCA +>A-mutant-7 +CGAAGTAGTCGAATTATTGAGACGGCGTGCAGAAAATTACGGACCATGGATTAGATAATCCCACCACCTCGGTAGCTCACGGCCCAGGAAGAGCTGGTCA +>A-mutant-8 +CGAGGTAGTCGAATTATTGAGACGTCGTGCAGAAAATTACGGACCATGGATGAGATATTCCCCCCACCTCGGTAGGTCACGGCCCAGGAAGAGCAGGTCA +>A-mutant-9 +CGAGGTAGTCGAATTATTGAGACGTCGAGCAGAAAATTTCGGACCATGGATGAGATATTCCCCCCACCTCGGTAGGTCACGGCCCAGGAAGAGCAGGTCC +>B +ATGCGAAGTCGGAGTACTGAGCCGTTGCACATAAAATTATGAAGTAACTAGTCGATAATCCCGCAACCGAGCGCCCTCGGAGGCCAGGCAAAACGACTCA +>B-mutant-1 +ATCGGAAGTCGGAGTACTGAGCCGTTGCACATAAAATTATGTAGTAACTAGTCGTTAATCCCGCAACCGCGCGCCCTCGGAGGACAGGCAAAATGACTCA +>B-mutant-2 +ACCGGAAGACGGAGTACTGAGCCGTTGCACATAAAATTATGTAGTAACTAGTCGTTCATCCCGCAACCGCGCGTCCTCGGAGGACAGGCAAAATGACTCA +>B-mutant-3 +ACCGGAAGACGGAGTACTGAGCCGTTGCCCATAAAATTAAGTAGTAACTAGTCGTTCATCCCGCAACCGCGCGTACTCGGAGGACAGGCAAAATGACTCA +>B-mutant-4 +ACCGGAAGACGGATTACTGAGCCGTTGCCAATAAAATTAAGTAGTAACTAGTCGTTCATCCGGCAACCGCGCGTACTCGGAGGAAAGGCAAAATTACTCA +>B-mutant-5 +ATCGGCAGACGGATTACTGAGCCGTTGCCAATAAAATTAAGTAGTAACTAGTGGTTCTTCCGGCAACCGCGCGTACTCGGAGGAAAGGCAAAATTACTCA +>B-mutant-6 +ATCGGGAGACGGATTACTGAGCCGTAGCGAATAAAATTAAGTATTAACCGGTGGTTCTTCCGGCAACCGCGCGTACTCGGAGGAAAGGCAAAATTACTCA +>B-mutant-7 +ATCGGGAGACGGTTTATTGAGCTGTAGCGAATAAAATTAAGTATTAACCGGTGGTTCTTCCGGCAACCGCGCCTACTCGGATGAAAGGCAAAATTACTCA +>B-mutant-8 +ATCGGGATACGGTTTATTGAGCTGTAGCGAGTAAAATTAAGTATTAACCGGTGGTTCATCCGGCAACCGCGCCTACTCGGAAGAAAGGCAAAATCACTCA +>B-mutant-9 +ATCGGGATACGGTTTATCGAGCTGTAGCGAGTAAAATTAAGTATTAACCGGTGGTTAATCCGGCAACCGCGCCTACTCGGACGAAAGGCAAAATCACTCA +>recombinant +ATGAGAAGTCGAAGTACTGAGTCGGCGCACATAAACTTACGAAGAAAGTAGTGGTTAATCCGGCAACCGCGCCTACTCGGACGAAAGGCAAAATCACTCA diff --git a/out1/recombinant-50A5-50random-phyml.ascii b/out1/recombinant-50A5-50random-phyml.ascii new file mode 100644 index 0000000..b92e1c8 --- /dev/null +++ b/out1/recombinant-50A5-50random-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | /-| + | | | /-A-mutant-1 + | | \-| + | | | /-A-mutant-2 +--| | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + | | \-| + | | | /-A-mutant-5 + | | \-| + \-| | /-recombinant + | \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-9 + | \-| + | \-A-mutant-8 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/out1/recombinant-50A5-50random-phyml.newick b/out1/recombinant-50A5-50random-phyml.newick new file mode 100644 index 0000000..509b50c --- /dev/null +++ b/out1/recombinant-50A5-50random-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000000,B-mutant-9:0.04209787,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000001,(B-mutant-4:0.00000000,(B-mutant-3:0.02030531,(B-mutant-2:0.00000001,(B-mutant-1:0.00000001,(B:0.00000000,(root:0.00000000,(A:0.00000001,(A-mutant-1:0.00000000,(A-mutant-2:0.01133989,(A-mutant-3:0.00000000,(A-mutant-4:0.00000001,(A-mutant-5:0.00000000,(recombinant:0.48147625,(A-mutant-6:0.00000000,(A-mutant-7:0.00994973,(A-mutant-9:0.08411679,A-mutant-8:0.00000001)0.943302:0.02031766)1.000000:0.05221584)0.792507:0.03109170)0.394109:0.01041535)1.000000:0.05229899)0.999999:0.04160314)0.999105:0.04104424)1.000000:0.08608774)0.999840:0.04120799)1.000000:0.11888168)1.000000:0.13120180)1.000000:0.06280433)1.000000:0.07398432)1.000000:0.05357694)0.999970:0.04254282)0.999999:0.04161250)0.999946:0.03112808)1.000000:0.06364196)1.000000:0.06361745); diff --git a/out1/recombinant-50A5-50random-raxml.ascii b/out1/recombinant-50A5-50random-raxml.ascii new file mode 100644 index 0000000..4544d17 --- /dev/null +++ b/out1/recombinant-50A5-50random-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B-mutant-2 + | | + | /-| /-B-mutant-3 + | | | | + | | \-| /-B-mutant-4 + | | | | + | | \-| /-B-mutant-5 +--| | | | + | | \-| /-B-mutant-6 + | /-| | | + | | | \-| /-B-mutant-9 + | | | | /-| + | | | \-| \-B-mutant-8 + | /-| | | + | | | | \-B-mutant-7 + | | | | + | | | \-B-mutant-1 + \-| | + | \-B + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-recombinant + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + \-A-mutant-9 diff --git a/out1/recombinant-50A5-50random-raxml.newick b/out1/recombinant-50A5-50random-raxml.newick new file mode 100644 index 0000000..8ac9ef7 --- /dev/null +++ b/out1/recombinant-50A5-50random-raxml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.000001,(A-mutant-7:0.009946,(((((A-mutant-3:0.000001,(A-mutant-2:0.011346,(A-mutant-1:0.000001,(A:0.000001,((((B-mutant-2:0.000001,(B-mutant-3:0.020306,(B-mutant-4:0.000001,(B-mutant-5:0.000001,(B-mutant-6:0.000001,((B-mutant-9:0.042104,B-mutant-8:0.000001)100:0.063633,B-mutant-7:0.000001)99:0.063664)95:0.031137)97:0.041619)98:0.042570)99:0.053616)100:0.074026,B-mutant-1:0.000001)100:0.062822,B:0.000001)100:0.131283,root:0.000001)100:0.118951)99:0.041215)99:0.086131)97:0.041047)86:0.041615,A-mutant-4:0.000001)85:0.052309,A-mutant-5:0.000001)75:0.010261,recombinant:0.482796)84:0.031256,A-mutant-6:0.000001)99:0.052228)88:0.020323,A-mutant-9:0.084142):0.0; diff --git a/out1/recombinant-50A5-50random.fasta b/out1/recombinant-50A5-50random.fasta new file mode 100644 index 0000000..9df71ea --- /dev/null +++ b/out1/recombinant-50A5-50random.fasta @@ -0,0 +1,44 @@ +>root +CGGACGGCTAATATTCGAATGACAGGGCGTTTACCTTCGAAGATGGACAACTTGCACCGCGGTCGCTGGCTTATCGACGAGCGGCTACCATCGGCATTCA +>A +CGGTCGGCTAGTAATCGAATGTCAGGGCGTTTACCTTAGAAGATGAACAACTTGGACCCCGGTCGCTCACTTATCGACGAGCGGCTACCATCGGCATCCA +>A-mutant-1 +CGGCCGGCTAGTAATCGAATGTCAGGGCGTGTACCTTAGAAGATGAACAACTTGGACCCCGGTCGCTCACCTATCGACGAGCGGCTACCATCGTCATCCA +>A-mutant-2 +CGGCCAGCAAGTAATCGAATGGTAGGGCGTGTACCTTAGTAGATGTACAACTTGGACCCCCGTCGCGCACCTATCAACGAGCGGCTACCATCGTCATCCA +>A-mutant-3 +CGGCCAGCAAGTAAACGAATGTAAGGGCGTGTACCTTAGTAGATTTACAACTTGTACCCCCGTCGCGCACCTATCAACGAGCGGCTACCATCGTCATCCA +>A-mutant-4 +CGGCCAGCAAGTAAACGAATGTAAGGGCGTGAACCTTAGTAGATTTACAACTGGTACCGCAGTCGCGCACCTATCAACGAGCGGCTACCATCGTCATCCA +>A-mutant-5 +CGGCCTTGAAGTAAACGAATGTACGGGCGTGAACCTTAGTAGATTTACAACTGGTACCGCAGTCGCGCACCGATCAACGAGCGGCTACCATCGTCATCCA +>A-mutant-6 +CGGCCTTGAAGTAAACGAATGTACTGGCGTGAACCTTAGTAGATTTACAACTGGTACCGCAGTCGAGCACCGATCAACGAGTGGCTACCCTCGTCATCCA +>A-mutant-7 +CGGCCTTGTCGTAAACGAATGTACTGGGGTGAACCTTGGTAGATTTACAACTGGTACCGCAATCGAGCACCGATCAACGAGTGGGTACCCTCGTCATCCA +>A-mutant-8 +CGGCCTTGTCGGAAACGAATGTACTGGGGTGAACCTTAGTAGATTTACTACTGGTACCGCAATCGAGCACCGATCAACGAGTGGGTACCCTCGTCATCCA +>A-mutant-9 +CGGCCTTGTCGGCAACGAATGTACTGGGGTGAACCTTTGTGGATTTACCACTAGTACCGCAATCGAGCACCGATCAACGAGTGGGTACCGTCTTCGTCCA +>B +GGGACGGCCAATATTCGAATGACAGAGCGGGTACCTTCTAAGCTGGACAACTTGTACCGCGGTCGCCGGCTTATCGACGAGCGGCCACGAACGGCATTCA +>B-mutant-1 +GGGATGGCCAATATTCGATTGACAGAGCGGGTACCGTCTTAGCTGGCCAACTTTTACCGCGGTCGCCGGCTTATCGACGAGCGGCCACGAACGGCATTCA +>B-mutant-2 +GGGATGGCCAATATTCGATTGACGGAGCGCGCACCGTCTTAGCTGGCCAACTTTGACCGCGGTAGCCGGCTAAACGACGAGCGGCCACGAACGGCATTCA +>B-mutant-3 +GGTATGGCCAATATTCGATTGACGGAGCACACACCGTCTTAGCTGGACAACTTAGACCGCGGTAGCCGGCTAAACGATGAGCGGCCACGAACAGCATTCA +>B-mutant-4 +GGTCTGGCCAATATTCGACTGACGGAGCACACACCGTCTTAGCTGGACAACTTAGACCGCTGTAGCCGGCTAAACGACGAGTGGCCACGAACGGCATTCA +>B-mutant-5 +GGTCTGGCCAATATTCGTCTGACGGAGCACACACCGCCTTAGCTGGACAACTTAGACCGCTGTAGCCGGCTAAAGGACGAGTGGCCACGAACGCCATTCA +>B-mutant-6 +GGTCTGGCCAATATTCGTCTGACGGGGCACACACCGCCTTAGCTGGACAACTTAGACCGCTGTAGCCGGCTAAAGGACGAGCCGCCACGAACGCCATTCA +>B-mutant-7 +GTTCTGGCCAATATTCGTCCCACGGGGCATACACCGCCTTAGCTGGACAACTTAGACCGCTGTAGCCGGCTGAAGGACGAGCCGCCACGAACTCCATTCA +>B-mutant-8 +GTTTTGGCCAATATTCGTCCCACGGGGCATACACCGCCTTAGCTCGACAACTTAGACCGCTGTACCCGGCTGAAGGACCACCCGCCACGAAGTCCATTCA +>B-mutant-9 +GTTTTGGCCAATATCCGTCCCACGGGGGATACACCGCCTTAGCTCGACAACTTAGACCGCTGTACCCGGCTGAAGGCCCACCCGCCACGAAGTCCATGCA +>recombinant +CGGCCTTGAAGTAAACGAATGTACGGGCGTGAACCTTAGTAGATTTACAACGTGGTTCCCCACAACTAGTAGGACTTTATATCACCTCCGGCCTGATGGG diff --git a/out1/recombinant-75A1-25B1-phyml.ascii b/out1/recombinant-75A1-25B1-phyml.ascii new file mode 100644 index 0000000..3a5e0e5 --- /dev/null +++ b/out1/recombinant-75A1-25B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| +--| | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + \-| \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-9 + | \-| + | \-B-mutant-8 + | + | /-recombinant + \-| + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-7 diff --git a/out1/recombinant-75A1-25B1-phyml.newick b/out1/recombinant-75A1-25B1-phyml.newick new file mode 100644 index 0000000..0f5d548 --- /dev/null +++ b/out1/recombinant-75A1-25B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.03052734,A-mutant-7:0.00000001,(A-mutant-6:0.00000000,(A-mutant-5:0.00957353,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000001,(A-mutant-1:0.00000000,(A:0.03134860,(recombinant:0.00000001,(root:0.00000001,(B:0.00000000,(B-mutant-1:0.00000000,(B-mutant-2:0.00000000,(B-mutant-3:0.00000001,(B-mutant-4:0.00000000,(B-mutant-5:0.00000001,(B-mutant-6:0.00000001,(B-mutant-7:0.00000001,(B-mutant-9:0.07444013,B-mutant-8:0.00000001)1.000000:0.09606407)0.999993:0.04102510)0.999999:0.04101861)0.999987:0.03064338)0.999992:0.03071267)0.999991:0.03070281)0.999993:0.03065170)0.999839:0.03069164)1.000000:0.09687902)1.000000:0.13269160)0.999605:0.06398540)0.644179:0.00942586)0.999999:0.05171890)0.999999:0.05150308)0.999999:0.04070952)1.000000:0.05210406)0.999993:0.04174802)0.999999:0.04100505); diff --git a/out1/recombinant-75A1-25B1-raxml.ascii b/out1/recombinant-75A1-25B1-raxml.ascii new file mode 100644 index 0000000..802219c --- /dev/null +++ b/out1/recombinant-75A1-25B1-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-recombinant + | | + | /-| /-A + | | | | + | | \-| /-A-mutant-1 +--| | | | + | | \-| /-A-mutant-2 + | | | | + | | \-| /-A-mutant-3 + | | | | + | | \-| /-A-mutant-4 + | | | | + | | \-| /-A-mutant-5 + \-| | | + | \-| /-A-mutant-6 + | | | + | \-| /-A-mutant-9 + | | /-| + | \-| \-A-mutant-8 + | | + | \-A-mutant-7 + | + | /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + | | /-B-mutant-3 + \-| | + | | /-B-mutant-6 + | | /-| + \-| | | /-B-mutant-7 + | | \-| + | /-| | /-B-mutant-9 + | | | \-| + | | | \-B-mutant-8 + \-| | + | \-B-mutant-5 + | + \-B-mutant-4 diff --git a/out1/recombinant-75A1-25B1-raxml.newick b/out1/recombinant-75A1-25B1-raxml.newick new file mode 100644 index 0000000..1fb91f2 --- /dev/null +++ b/out1/recombinant-75A1-25B1-raxml.newick @@ -0,0 +1 @@ +(((B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-9:0.074440,B-mutant-8:0.000001)100:0.096062)97:0.041007)91:0.041004,B-mutant-5:0.000001)89:0.030631,(B-mutant-3:0.000001,((B-mutant-1:0.000001,((root:0.000001,(recombinant:0.000001,(A:0.031333,(A-mutant-1:0.000001,(A-mutant-2:0.000001,(A-mutant-3:0.000001,(A-mutant-4:0.000001,(A-mutant-5:0.009554,(A-mutant-6:0.000001,((A-mutant-9:0.000001,A-mutant-8:0.000001)96:0.030513,A-mutant-7:0.000001)97:0.040984)98:0.041740)99:0.052088)99:0.040688)100:0.051487)99:0.051702)66:0.009424)79:0.063976)100:0.132740)100:0.096887,B:0.000001)98:0.030681)92:0.030641,B-mutant-2:0.000001)98:0.030693)93:0.030701,B-mutant-4:0.000001):0.0; diff --git a/out1/recombinant-75A1-25B1.fasta b/out1/recombinant-75A1-25B1.fasta new file mode 100644 index 0000000..4705bae --- /dev/null +++ b/out1/recombinant-75A1-25B1.fasta @@ -0,0 +1,44 @@ +>root +CTCCGCCCCAATGTGAGCGTGCGGTCCTAGTCAAGTATTTGTGCTGACCGAGCTACATTGCTAGCATTCTTCGTTTCCCTTCTCGGATTGTTCAGTGCCT +>A +CTCCGCCTCAATGTGAGAGTACGGTCCTAGTCAAGTATTTGTGCTGACCAAGCCACTTTGCTAGCATTCGTCGTAACCCTTGAAGGATGGAGCAGTGCCT +>A-mutant-1 +CTCCGCCTCAATGTGAGAGTACGGTCCTAGTCAAGTATTGGTGCTGACCAAGCCTCTTTGCTCGCATTCGTCGTAACCCTTGAAGGATGGAGCAGTGCCA +>A-mutant-2 +CTCCGCCTCAATGTGAGAGTACGGTCCTAGTCAGGTATTGGTGCTGACCAAGTCTCTGTGCTCGCATTCGTCGTAACCCTTGCAGGATGGAGCAGTGCAA +>A-mutant-3 +CTCCGCCTGAATGTGAGAGTACGGTCCTAGTCAGGTATTGGTGCTGACCAAGTCTCTGTGCTCGAATTCGTCGTAACCCTTGGACGAGGGAGCAGTGCAA +>A-mutant-4 +CTCCGCCTGAATGTGAGAGTAGGGTCCTACTCAGGTAGTGGTGCTGACCAAGTCTCTGTGCTCGAATTCGTCATAACCCTTGGACGAGGGAGCAGTGCAA +>A-mutant-5 +CTCTGCCTGATTGTGAGAGTAGGGTCCTGCTCAGGTAGTGGTGCTGACCAAGTCTCTGTCCTCGAATTCGTCATAACGCTTGGACGAGGCAGCAGTGCAA +>A-mutant-6 +CTCTGCCTGATTGTGAGAGTGGCGTCCTGCTTAGGTAGTGGTGCTGACTAAGTCTCTGTCCTCGAATTCGTCATAACCCTTGGACGAGGCAGCAGTGCAA +>A-mutant-7 +CTCTGCCTGATTGTGAGAGTGCCGTCCTGCGTTGGTAGTGGTGCTGACTAAGTCTCTGTCCTCGAATTCGTCATAACCCTTGGACAAGGCAGCAGTGCAA +>A-mutant-8 +CTCTGCCTGATTGTGAGAATGCCGTCCTGCGTTGGTAGTGGTGCTGACTAAGTCTCTGTCCTGGAATTCCTCATAACCCTTGGACAAGGCAGCAGTGCAA +>A-mutant-9 +CTCTGCCTGATTGTGAGAATGCCGTCCTGCGTTGGTAGTGGTGCTGACTAAGTCTCTGTCCTGGAATTCCTCATAACCCTTGGACAAGGCAGCAGTGCAA +>B +CTCCGCCCCAAAGAGGGCGTGCGGTCCTAGTCAAGTATTTGTGCTGACCGAGCAACATTGCTATCATGCCTAATTTCCCTTCTCGGATTGTTCAGTGCCT +>B-mutant-1 +CTCCGCCCCAAAGAGGGCGTGCGGTCCTACTCAAGTATTTGTGCTGACCGAGCAACATTGCTATAATGCCTAATTTCCCTTCTCGGATTGATCAGTGCCT +>B-mutant-2 +CTCCGCCCCAAAGAGGGCGTGCGGTCCTACTCAACTATTTGTGCTGACCGAGCAACATTGCTATAATGCCTACATTCCCTTCTCGGATTGATCAGTGCCT +>B-mutant-3 +CTCCGCCCCTAAGAGGGCGTGCGGTCCTACTCAACTATTTGTGCCGACCGAGCAACATTGCTATAATGCCTACATTCTCTTCTCGGATTGATCAGTGCCT +>B-mutant-4 +CTCCGCCCTTAAGAGGGCGTGCGGTCCTACTCAACTATTTGTGCCGACCGAGCAACATGGCTATAATGCCTACATTCTCTTCTCGGATTGATCAATGCCT +>B-mutant-5 +CTCCGCCCTGAAGAGGGCGTGCGGTCCTACTCAACTATTTGTGCCGACCGAGCAACATGGCTATAATGGCTACATTCTCCTCTCGGATTGATCAATGCCT +>B-mutant-6 +CTCCGCCCTGAAGAGGGCGTGCGGTCCTACTCAACTATTTGTACCGACCGAGCAACATGGCTATAATGGCTGCAATCTCCTCTCGGATTGAGCAATGCCT +>B-mutant-7 +CTCCGCCCTGAAGATGGCGTGCGGTCCTACTCAACTATTTGTACCGACCGAGCAATATGGCTATAATGGCTGCAATCTCTTCTCGGATTGAGCAGTGCCT +>B-mutant-8 +CTCCTCCCTGAGGATGGCGTGCGGTCCTACTCAACTGTTTGTACCGACCCAGCAATATGGCTATAATGGCTGCTATCCCTTCGGGGACTGAGCAGTGCCT +>B-mutant-9 +CTCCTCCCTGAGGATGGCGTGCGGTCCTACTCAATTGTCTGTCCCGACCAAGCAATATGGCTATCATGGCTTCTATTCCTTCGGGGACTGAGCAGTGCCT +>recombinant +CTCCGCCTCAATGTGAGAGTACGGTCCTAGTCAAGTATTGGTGCTGACCAAGCCTCTTTGCTCGCATTCGTCGTATCCCTTCTCGGATTGATCAGTGCCT diff --git a/out1/recombinant-75A1-25B9-phyml.ascii b/out1/recombinant-75A1-25B9-phyml.ascii new file mode 100644 index 0000000..ce6bb16 --- /dev/null +++ b/out1/recombinant-75A1-25B9-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | /-| + | | | /-recombinant + | | \-| + | | | /-A-mutant-1 +--| | \-| + | | | /-A-mutant-2 + | | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + | | \-| + \-| | /-A-mutant-5 + | \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-9 + | \-| + | \-A-mutant-8 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/out1/recombinant-75A1-25B9-phyml.newick b/out1/recombinant-75A1-25B9-phyml.newick new file mode 100644 index 0000000..7ea446f --- /dev/null +++ b/out1/recombinant-75A1-25B9-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.08538632,B-mutant-8:0.00000000,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00000001,(B-mutant-2:0.00000001,(B-mutant-1:0.00996659,(B:0.00957146,(root:0.00000000,(A:0.00950495,(recombinant:0.13387503,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000000,(A-mutant-4:0.00000000,(A-mutant-5:0.00000001,(A-mutant-6:0.00000000,(A-mutant-7:0.00975752,(A-mutant-9:0.06172679,A-mutant-8:0.00000001)0.999325:0.03068312)1.000000:0.07268856)0.999999:0.05071963)1.000000:0.11813658)0.989731:0.02011192)0.999999:0.04108445)1.000000:0.05151459)0.903605:0.02062291)0.984441:0.03206683)1.000000:0.07510554)1.000000:0.08597651)0.999997:0.05464484)0.999958:0.04269956)0.999968:0.04146344)1.000000:0.05183317)0.999997:0.04097423)1.000000:0.06259283)1.000000:0.05178546)0.998402:0.02035355); diff --git a/out1/recombinant-75A1-25B9-raxml.ascii b/out1/recombinant-75A1-25B9-raxml.ascii new file mode 100644 index 0000000..b7d3ad5 --- /dev/null +++ b/out1/recombinant-75A1-25B9-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B-mutant-1 + | | + | | /-B-mutant-3 + | | /-| + | /-| | | /-B-mutant-4 + | | | | \-| + | | | | | /-B-mutant-5 + | | | | \-| + | | | | | /-B-mutant-6 + | | \-| \-| +--| | | | /-B-mutant-7 + | /-| | \-| + | | | | | /-B-mutant-9 + | | | | \-| + | | | | \-B-mutant-8 + | | | | + | | | \-B-mutant-2 + | | | + | | \-B + | | + | | /-recombinant + | | | + \-| | /-A-mutant-3 + | | | + | | | /-A-mutant-5 + | | | | + | | /-| /-| /-A-mutant-7 + | /-| | | | | /-| + | | | | | | | | | /-A-mutant-9 + | | | | | | \-| \-| + | | | | \-| | \-A-mutant-8 + | | | /-| | | + | | | | | | \-A-mutant-6 + \-| | | | | + | \-| | \-A-mutant-4 + | | | + | | \-A-mutant-2 + | | + | \-A-mutant-1 + | + \-A diff --git a/out1/recombinant-75A1-25B9-raxml.newick b/out1/recombinant-75A1-25B9-raxml.newick new file mode 100644 index 0000000..fc16231 --- /dev/null +++ b/out1/recombinant-75A1-25B9-raxml.newick @@ -0,0 +1 @@ +((root:0.000001,((B-mutant-1:0.009956,((B-mutant-3:0.000001,(B-mutant-4:0.000001,(B-mutant-5:0.000001,(B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-9:0.085408,B-mutant-8:0.000001)92:0.020355)100:0.051801)100:0.062607)99:0.040981)99:0.051841)90:0.041473,B-mutant-2:0.000001)92:0.042731)99:0.054698,B:0.009561)99:0.086034)100:0.075150,(recombinant:0.134010,(((A-mutant-3:0.000001,((A-mutant-5:0.000001,((A-mutant-7:0.009762,(A-mutant-9:0.061752,A-mutant-8:0.000001)96:0.030687)100:0.072718,A-mutant-6:0.000001)100:0.050736)100:0.118208,A-mutant-4:0.000001)84:0.020116)98:0.041099,A-mutant-2:0.000001)98:0.051534,A-mutant-1:0.000001)97:0.020640)87:0.032067,A:0.009510):0.0; diff --git a/out1/recombinant-75A1-25B9.fasta b/out1/recombinant-75A1-25B9.fasta new file mode 100644 index 0000000..111767f --- /dev/null +++ b/out1/recombinant-75A1-25B9.fasta @@ -0,0 +1,44 @@ +>root +CTGGATGACCGGGCGGATAGTCGCTCACCGCAAATAATTGATTAGTTAATACAAGCATTCAACGATTTCTTAGTTATTGTAAGTCTCGATTCGATATATA +>A +CTGGATGACCGGGCGGATTGTCGCTCACACCACATAAATGATTGGTTAATACAAGCATTCAACGACTTCTTAGTTATTGTAAGTCTCGATACGATATATA +>A-mutant-1 +CTGGATGACCGGTCGGATTGTCGCTCACACCACATAAATGATTGGTTAGTATAAGCATTCAACGATTTCTTAGTTATGGTAAGTCTCGATACGATAAATA +>A-mutant-2 +CTAGATGACCGGTCGAAATGTCGCTCACACCACATAAATGATCGTTTAGTATAAGCATTCAACGATTTCTTAGTTATGGTAAGTCTCGATACGATAAATA +>A-mutant-3 +GTAGATGACCGGTCGAAATGTCGCTCACACCACATAAATGATCGTTTCATATAAGCCTTCAACGATTTCTTAGTTATGGTAAGTCTCGATACGATAAATA +>A-mutant-4 +GTAGATGACCGGTCGAAATGTCGCTCACACCACATAGATGATCGTTTCATATAAGCCTTCAGCGATTTCTTAGTTATGGTAAGTCTCGATACGATAAATA +>A-mutant-5 +GTAGATGACCGGTCGAAACATCGCTCACACCACATAGATTGTCGTTGCATACAAGCCGTCAGCCATTTCTTAGTTATGGTAACTCCCGAGACGATAAATA +>A-mutant-6 +GTAGATGACCGGTCGAATCATCGCTCACACCACATAGATTGTCGTTGCAAACAAGCTGTCAGCCATTTCTTAGTCATGGTAACTCCCGAGAGGATAAATA +>A-mutant-7 +GTAGATGACCGGTCGATTCATCGCTTTCACCACATAGATTACCGTTGCAAACAAACTGTCAACCATTTCTTAGTCATGGTAACTCCCGAGAGGCTAAATA +>A-mutant-8 +GTGGATGACCGCTCGAATCATCGCTTTCACCACATAGATTACCGTTGCAAACAAACTGTCAACCATTTCTTAGTCATGGTTACTCCCGAGAGGCTAAATA +>A-mutant-9 +GTGGATGACCGCTTGAACGATCGCTTTGACCACATAGATTACCGTTGCAGACAAACTGTCAACCATTTCTTAGTCATCGTTACTCCCGAGAGGCTAAATA +>B +CTGGATGAGCAGGCGGATAGTCGCTCATCGCAAATAATTGATTAGTTAATAAGAGTATTTAACGATTTCTTAGTTATTGTAAATGTCGATTCGATATATA +>B-mutant-1 +CTGTATGAGCAGGCGGATCGTCGCTCATCTCAAATAATTGGTTGGTTAATACGTGTATTTAACGATTTCTTAGTTATTGTAAATGTCGATTCGATATATA +>B-mutant-2 +CTGTATGAGCAGGCGGATAATCGCTCATCTCAAATAATTGGATGGTTAATACGTGTATTTAACGCTTTCTTAGTTATTGGAAATGTCGATTCGATATATA +>B-mutant-3 +CTGTATGAGCAGGCGGATAATCGCTCATCGCAAATAATAGGATGGTTAATACGTGTATTTAACGCTTTCTTAGTTGTTGGAAATGTCGGTTCGATATATA +>B-mutant-4 +CTGTATGAGCAGACGGATAATCGCACATCGCAAATAATAGGATGGTTAATACGTGTATTGAACGATTTCTTAGTTGTTGGAAACGTCGGTTCGATATATA +>B-mutant-5 +CTGTATGAGCAGACGGATAATCGCACATTGAAAATAATAGGATGGTTATTACGTGTATTGAACAATTTCTTAGTTGTTGGAAACGTCGGTTCGATATATA +>B-mutant-6 +CTGTATGAGCAAACGGATAATCGCACACTGAAACTAATAGGATGGGTATTACGTGTATTGAACAATTACTTTGTTGTTGGAAACGTCGGTTCGATATATA +>B-mutant-7 +CTGTGTGAGCAAACGGATAATCGCACACTGAAACTAATAGGATGGGTATTACGTGTATTGCACAATTACTTTGTTGTTGGAATCGTCCGTTCGCTATATA +>B-mutant-8 +CTGTGTGAGCAAACGGATAATCGCACACTGAAACTTATCGGATGGGTATTACGTGTATTGCACAATTACTTTGTTGTTGGAATCGTCCGTTCGCTATATA +>B-mutant-9 +CTGTGTGAGCAAACGGATATTCTCACATTGATACTTATCGGATGGGTATTACGTGTATTGCACAATTAGTTTGTTGTTGGAGTCGTCCGTTCGCTATGTG +>recombinant +CTGGATGACCGGTCGGATTGTCGCTCACACCACATAAATGATTGGTTAGTATAAGCATTCAACGATTTCTTAGTTGTTGGAGTCGTCCGTTCGCTATGTG diff --git a/out1/recombinant-75A5-25B5-phyml.ascii b/out1/recombinant-75A5-25B5-phyml.ascii new file mode 100644 index 0000000..528e932 --- /dev/null +++ b/out1/recombinant-75A5-25B5-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| +--| | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + \-| \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-8 + | \-| + | \-B-mutant-9 + | + | /-A + | | + \-| /-A-mutant-1 + | | + \-| /-A-mutant-2 + | | + \-| /-A-mutant-3 + | | + \-| /-A-mutant-4 + | | + \-| /-recombinant + | /-| + | | \-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/out1/recombinant-75A5-25B5-phyml.newick b/out1/recombinant-75A5-25B5-phyml.newick new file mode 100644 index 0000000..7f06106 --- /dev/null +++ b/out1/recombinant-75A5-25B5-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.05088352,A-mutant-8:0.00000000,(A-mutant-7:0.00000000,(A-mutant-6:0.00000001,((A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000001,(A:0.00000001,(root:0.00810069,(B:0.00000001,(B-mutant-1:0.00000001,(B-mutant-2:0.00000001,(B-mutant-3:0.00000000,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000001,(B-mutant-7:0.01347979,(B-mutant-8:0.00000001,B-mutant-9:0.09857334)0.999996:0.07447553)0.999939:0.05121879)0.999005:0.03098882)1.000000:0.04206330)0.999961:0.03123816)1.000000:0.06409251)0.999982:0.05316141)1.000000:0.11074674)1.000000:0.10074152)1.000000:0.07675350)1.000000:0.06295064)1.000000:0.07383930)1.000000:0.05174074)1.000000:0.05162549)1.000000:0.08412776,(recombinant:0.13150627,A-mutant-5:0.00000000)0.000000:0.00000000)0.999559:0.03028711)0.999393:0.03019818)0.999998:0.04059575); diff --git a/out1/recombinant-75A5-25B5-raxml.ascii b/out1/recombinant-75A5-25B5-raxml.ascii new file mode 100644 index 0000000..f7b0b51 --- /dev/null +++ b/out1/recombinant-75A5-25B5-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B-mutant-1 + | | + | | /-B-mutant-2 + | /-| | + | | | | /-B-mutant-4 + | | | | | + | | \-| /-| /-B-mutant-5 +--| | | | | | + | | | | | | /-B-mutant-9 + | | | | \-| /-| + | /-| | | | /-| \-B-mutant-8 + | | | \-| | | | + | | | | \-| \-B-mutant-7 + | | | | | + | | | | \-B-mutant-6 + | | | | + \-| | \-B-mutant-3 + | | + | \-B + | + | /-A + | | + \-| /-A-mutant-1 + | | + \-| /-A-mutant-2 + | | + \-| /-A-mutant-3 + | | + \-| /-A-mutant-4 + | | + \-| /-recombinant + | | + \-| /-A-mutant-5 + | | + \-| /-A-mutant-7 + | /-| + | | | /-A-mutant-9 + \-| \-| + | \-A-mutant-8 + | + \-A-mutant-6 diff --git a/out1/recombinant-75A5-25B5-raxml.newick b/out1/recombinant-75A5-25B5-raxml.newick new file mode 100644 index 0000000..4921d55 --- /dev/null +++ b/out1/recombinant-75A5-25B5-raxml.newick @@ -0,0 +1 @@ +(A-mutant-5:0.000001,(((A-mutant-3:0.000001,(((A:0.000001,(((B-mutant-1:0.000001,(B-mutant-2:0.000001,((B-mutant-4:0.000001,(B-mutant-5:0.000001,(((B-mutant-9:0.098483,B-mutant-8:0.000001)100:0.074246,B-mutant-7:0.013401)100:0.051028,B-mutant-6:0.000001)91:0.030927)99:0.041908)94:0.031126,B-mutant-3:0.000001)100:0.063922)96:0.053160)100:0.111041,B:0.000001)100:0.100232,root:0.008492)100:0.076072)99:0.062806,A-mutant-1:0.000001)100:0.073968,A-mutant-2:0.000001)98:0.051785)100:0.051677,A-mutant-4:0.000001)100:0.084249,recombinant:0.132200)72:0.000001,((A-mutant-7:0.000001,(A-mutant-9:0.050951,A-mutant-8:0.000001)97:0.040646)95:0.030273,A-mutant-6:0.000001)98:0.030415):0.0; diff --git a/out1/recombinant-75A5-25B5.fasta b/out1/recombinant-75A5-25B5.fasta new file mode 100644 index 0000000..a65decd --- /dev/null +++ b/out1/recombinant-75A5-25B5.fasta @@ -0,0 +1,44 @@ +>root +TTTGGGGGAGTCGCCGTCTGGAAGTACCTCCCGCAGGACCGAGTGGACCCTAATTTTTTCAATGCGACTACCAGGAGGGCATACACGAACTCATTCAGCC +>A +TTTGGCGGAGTCGCAGTCTGGAAGTACCTCCCGCAGGACCGAGTGGACCCTATTTTATTCCATGCGACTACCAGGTGGGCATACACGAACTTATTCGGCC +>A-mutant-1 +TTTGGCGGAGTCGCAGTCTGGAAGTACCTCACGCAGGACCGAGTGGACTCTATTTTATGCCATGCTACTACCAGTTGGGCATACACGAACTTATCCGGCC +>A-mutant-2 +TTTGGAGGAGTCGCAGTTTGGAAGTACCTCACGCCGGACCGAGTGGACTCTATTTTATGCCATGCTACTACCAGTTGGACACACACGAACTCATCCGGCG +>A-mutant-3 +TTTGGAGGAGTAGCAGTTCGGAAGTACCTCACGCCGGACCGAGTGGACTCTGTTTTATGCCAACCTACTACCAGTTGGACACACACGAACTCATCCGGCG +>A-mutant-4 +TTTGGACGAGCAGCAGTTCGGAAGTACCTCACGCCAGACCGAGTAGACTCTGTTTTATGCAAACCTACTACCAGTTGGACACACACGAACTCATCCGGCG +>A-mutant-5 +TTTGCACGAGCAGCAGTCCGGAAGTACCGCACGCCAGACCCAGTAGAGTCTGTTTTATGCAACCTTTCTACCAGTTGGACACACACGAACTCATCCGGCG +>A-mutant-6 +TTTGCACGAGCAGCAGTCCGGAAGTACCGCACGCCAGATCCAGTAGAGTGTTTTTTATGCAACCTTTCTACCAGTTGGACACACACGAACTCATCCGGCG +>A-mutant-7 +TTTGCACGTGCAGCAGTCCGGAAGTACCGAACGCCAGATCCAGTAGAGTGTATTTTATGCAACCTTTCTACCAGTTGGACACACACGAACTCATCCGGCG +>A-mutant-8 +TTTGCACGTGCAGCAGTCCGGAAGTACCGAACGCCAGATCCTGTCGAGTGTATTTTATGCAACCTTTCTACCAGTTGATCACACACGAACTCATCCGGCG +>A-mutant-9 +TTCCCACGTGCAGCAGTCCGGAAGTACCGATCGCCAGATCCTGTCGTGTGTATTTTATGCAACCTTTCTACCAGTTGATCACACACGAACTCATCCGGTG +>B +TTTGGGGGAGTCGCCGTGTGGAAGTACCTCCCGCTGGACAGAGAGGACCCTCATTCTTTGAATGCGACTACCAGGAGGGCATACACGGATTCATTCGGCC +>B-mutant-1 +TTTGGGGGCGTCGCCGTGTGGAACTACCTCGGGCTGGACAGAGAGGAGCCTCATTCTTTGAATGCGAATGCCAGGAGGGCATACACGGAATCAGTCGGCA +>B-mutant-2 +TTTGGGGTCGTCGCCGTGTGAAACTACGTCGGGCTGGACCGAGAGGAGCCTCATTCTTTGAATGCGATTGCCAGGAGGGCATACACGGAATCAGTCGGCA +>B-mutant-3 +TTTGGGGTCGTCGCCGTGTGAAACTACGTCGGGCTGGATCTAGAGGAGCCTCATTCTTTGAATGCGATTGCCTGGAGGGCATTCACTGAATCAGTCGGCC +>B-mutant-4 +TTTGGGGTCGTCGCCGTGCGAAACTACGTCGGGCTGGATCTAGAGGAGCCTCATTCTTTGAATGCGATTGCGTGGAGGGCATTCGCTGAATCAGTCGGCC +>B-mutant-5 +TTTGGGGTCGTCGCCGTGCGAAACTACGTCGGTCTGGATCTAGAGGAGCCTCATTCTTTGAATGCGATTACGTGGAGGGGATTCGCTTAATCAGTCGGCC +>B-mutant-6 +TTTGGGGTCGTCGCCGTGCGTAACTACGTCGGTCTGGATCTAGAGGACCCTCATTCTTTGAATGCGATTACGTGGAGGGGATTCGCTTAATCAATCGGCC +>B-mutant-7 +TTTGGGGTCGTCGCCGTGCGGAACTACTTCGATCTGGATCTAGAGGACCCTCAGTCTTTGAATGCGATTACGTGGAGGGGATTCGCATAATCAATCGGGC +>B-mutant-8 +ATTGGGGTCGTCGCCGTGCGGAACTACGTCGATCCGGATCTAGAGGAACATCAGCCTTCGAATGCGATTACGTGGAGGGGATTCGCATAATCAATCGGTC +>B-mutant-9 +ATTGGGGTCGTCGCCGTGCGGAATTACGTGGATCGGGAGCTAGGGGATCATCAGCCTTCGAATGCGACTACGTGTAGGGGATTCGCATAATCAAGCGGTC +>recombinant +TTTGCACGAGCAGCAGTCCGGAAGTACCGCACGCCAGACCCAGTAGAGTCTGTTTTATGCAACCTTTCTACCAGTAGGGGATTCGCTTAATCAGTCGGCC diff --git a/out1/two-ladders-phyml.ascii b/out1/two-ladders-phyml.ascii new file mode 100644 index 0000000..8b73527 --- /dev/null +++ b/out1/two-ladders-phyml.ascii @@ -0,0 +1,42 @@ + + /-root + | + | /-A + | /-| + | | | /-A-mutant-1 + | | \-| +--| | | /-A-mutant-2 + | | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + | | \-| + | | | /-A-mutant-5 + \-| \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-8 + | \-| + | \-A-mutant-9 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/out1/two-ladders-phyml.newick b/out1/two-ladders-phyml.newick new file mode 100644 index 0000000..b5fa8ee --- /dev/null +++ b/out1/two-ladders-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000001,B-mutant-9:0.01994931,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000000,(B-mutant-4:0.00993212,(B-mutant-3:0.00000000,(B-mutant-2:0.00000001,(B-mutant-1:0.00000000,(B:0.00000000,(root:0.00868425,(A:0.00000001,(A-mutant-1:0.00000001,(A-mutant-2:0.00000001,(A-mutant-3:0.00000000,(A-mutant-4:0.00000000,(A-mutant-5:0.00000000,(A-mutant-6:0.00000000,(A-mutant-7:0.00000000,(A-mutant-8:0.00000000,A-mutant-9:0.04146230)0.999999:0.04131779)0.999976:0.03078150)0.926257:0.01013850)1.000000:0.07422572)1.000000:0.09657553)0.999994:0.04141738)1.000000:0.05210239)0.989187:0.03075569)1.000000:0.17512049)0.999903:0.06573884)1.000000:0.07379338)0.999994:0.04103391)0.999999:0.04107600)0.995950:0.02041122)0.999997:0.04127044)1.000000:0.08389898)1.000000:0.06163056)1.000000:0.05104054); diff --git a/out1/two-ladders-raxml.ascii b/out1/two-ladders-raxml.ascii new file mode 100644 index 0000000..84d8d60 --- /dev/null +++ b/out1/two-ladders-raxml.ascii @@ -0,0 +1,42 @@ + + /-root + | + | /-A + | | + | | /-A-mutant-1 + | /-| | + | | | | /-A-mutant-3 +--| | | | | + | | | | | /-A-mutant-4 + | | \-| /-| | + | | | | | | /-A-mutant-9 + | | | | | | /-| + | | | | \-| /-| \-A-mutant-8 + | | | | | | | + \-| \-| | /-| \-A-mutant-7 + | | | | | + | | \-| \-A-mutant-6 + | | | + | | \-A-mutant-5 + | | + | \-A-mutant-2 + | + | /-B + | | + \-| /-B-mutant-1 + | | + | | /-B-mutant-2 + \-| | + | | /-B-mutant-4 + | | | + \-| | /-B-mutant-6 + | /-| /-| + | | | | | /-B-mutant-7 + | | | | \-| + | | \-| | /-B-mutant-9 + \-| | \-| + | | \-B-mutant-8 + | | + | \-B-mutant-5 + | + \-B-mutant-3 diff --git a/out1/two-ladders-raxml.newick b/out1/two-ladders-raxml.newick new file mode 100644 index 0000000..49fc1ee --- /dev/null +++ b/out1/two-ladders-raxml.newick @@ -0,0 +1 @@ +(((B-mutant-1:0.000001,((root:0.008684,(A:0.000001,(A-mutant-1:0.000001,((A-mutant-3:0.000001,(A-mutant-4:0.000001,((((A-mutant-9:0.041464,A-mutant-8:0.000001)100:0.041321,A-mutant-7:0.000001)97:0.030782,A-mutant-6:0.000001)64:0.010137,A-mutant-5:0.000001)100:0.074233)100:0.096598)98:0.041419,A-mutant-2:0.000001)87:0.052113)72:0.030755)100:0.175266)100:0.065752,B:0.000001)100:0.073815)93:0.041034,B-mutant-2:0.000001)97:0.041081,(B-mutant-4:0.009930,((B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-9:0.019946,B-mutant-8:0.000001)98:0.051035)98:0.061637)100:0.083922,B-mutant-5:0.000001)100:0.041274)88:0.020412,B-mutant-3:0.000001):0.0; diff --git a/out1/two-ladders.fasta b/out1/two-ladders.fasta new file mode 100644 index 0000000..08d31e0 --- /dev/null +++ b/out1/two-ladders.fasta @@ -0,0 +1,42 @@ +>root +AGTTACGGAACGGAAAAATACCAGCTGAGGGCTTTCCAGGCTACCCTGAAGTAACTCTAACTAAATCTTGCAAAAATACGAGCAGATAAGAGGGACTGTA +>A +AGTTACGGAACTGATAAAGACCAGCGAAGGGCTTTCCATGCTACCATGAAGAAACTCTAACTCAATCTTGCTAAAATTGGCGCAGATAACACGGACTGCA +>A-mutant-1 +AGTTACGGAACTGATAAAGTCCAGCGAAGGGCTTTCCATGCTACAATGAAGAAACTCTAACTCAATCTTGCTAAAATTGGCGCCGATAACACGGACTGCA +>A-mutant-2 +AGTTACGGAACTGATAAAGTCCAGCTAAGGGCTTTCCATGCTACAATGAAAAAACTCTAACTCAATCTTGCTCAAATAGGGGCCGATAACACGGACTGCA +>A-mutant-3 +AGTTATGCAACTGATAAAGTCCAGCTAAGGGCTTTCCATGCTACAATGAAAAAACTCTAGCTCAATCTTGCACAAATAGGGGCCGATAACACGGACTGCA +>A-mutant-4 +AGTTATGCAACTGATGAAGTCCAGCTTAGGGCTTCCCATGCTGGAATGAAAAAACTATAGCTCAATCTTGTACAAATAGCGGCCGATAACACGGAATGCA +>A-mutant-5 +AGTTATGCAACTGATGAAGTCCAGCTTAGGGCATCTAATGCTGGGATCAAAATACTATAGCTCAATCTTGTACAAATAGCCGCCGATAACACGGAATGCA +>A-mutant-6 +AGTTATGCAACTGATGAAGTCCAGCTTGGGGCATCTAATGCTGGGATCAAAATACTATAGCTCAATCTTGTACAAATAGCCGCCGATAACACGGAATGCA +>A-mutant-7 +AGTTATGCAACTGATGAAGTCCAGCTTGGGGCATCTAATGCTCGGATCAAAATACTATAGCTCAATCTTGTACAGATAGCCGCCGATAACACGGAATACA +>A-mutant-8 +AGTTATGCAACTGATGACGTCCAGCTTGGGGCATCTGATGCTCGGATCAAAATACTATAGCTCAATCTTGTAAAGATAGCCGCCGATAACACGGAAAACA +>A-mutant-9 +AGTTATGCAACTGATGACGTCCAGCTTGAGGCATCTGATGTTCGGATCAAAATACTATAGCTCAATCTTGTAAAGATAGCCGCCAATAACATGGAAAACA +>B +AGTTACGGAACGGAAAACAACCAGATGAGGGCTTCCCAGGCTACCATGAAGTAACTCTAACTAAATATTGCAAAAATACGAGCAGATAAGAGGGGCTGTA +>B-mutant-1 +AGTTACGGAACGAAAAACAACCAGATGAGGGCTCCCCCGGCTACCATGAAGTAACTCTAACTGTATGTTGCAAAAATACGAGCAGATAAGAGGGGCTCTA +>B-mutant-2 +AGTTACGGAGCGAAAAACAACCAGATGAGGGCTCCCCCGGCTACCACGAAGTAACTCTAAATGTATGTTGCAAAAATACGAGCACATAAGAGGGGCTCTA +>B-mutant-3 +AGTTAAGGAGCGAAAAACAACCAGATGAGGGCTCCCCCGGCTACCACGAAGTAACTCTCAATGTATGTTGCAAAAATACGAGCACATAAGAGGGTCTGTA +>B-mutant-4 +AGTTCAGGAGCGAAAAACAACCAGATGAGGGCTCCCCCAGCTACCACGAAGTAACTCTCAATGTATGTTGCAAAGATACGAGCACATAAGAGGGTCTGTA +>B-mutant-5 +AGTGCAGGAGCAAAAAACAACCAGATGAGGGCTCCCCCGGCTACCACGAAGTAACCCTCAATGTATGTGGCAAAGATACGAGCACATAAGAGGGTCTGTA +>B-mutant-6 +AGTGCAGGTGTAATAAACAACCAGGTGAGGGCTGCCCCGGCTACCACGAAGTAACCCTCAATGTATGTGGCAAAGATCCGAGGACATAAGAGGGTATGTA +>B-mutant-7 +AGTGCAGGTGTAGTAGACAACCAGGTGACGGCTGCCCCGGCTACCACGAAGTAACCCTCAATGTATGTGGCACAGATCCGAAGACATAAGAGGGTATCTA +>B-mutant-8 +AGTGCAGGTGTAGCAGACAACCCGGTGACGGCTGCCCCGGCTACCACGAAGTAACCCTCAATGTATGTGTCACAGATCCGAAGACATAAGAGGTTAGCTA +>B-mutant-9 +AGTGCAGGTGTAGCAGACAACCCGGTGACGGCTTCCCCGGCTACCACGAAGTAACCCTCAATGTATGTGTCACAGATCCGAAGACATAACAGGTTAGCTA diff --git a/out2/branchlength_2 b/out2/branchlength_2 new file mode 100644 index 0000000..16f8b47 --- /dev/null +++ b/out2/branchlength_2 @@ -0,0 +1,313 @@ +Analysing sample: recombinant-50A1-50B1-raxml.newick +The branchlength of root is 0.003832. +The support value of root is 1.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 99.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 90.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 99.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 61.000000. +The branchlength of A-mutant-9 is 0.063738. +The support value of A-mutant-9 is 61.000000. +The branchlength of A-mutant-7 is 0.010273. +The support value of A-mutant-7 is 88.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 53.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 99.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 99.000000. +The branchlength of recombinant is 0.087542. +The support value of recombinant is 74.000000. +The branchlength of A is 0.000001. +The support value of A is 87.000000. +The branchlength of B is 0.000001. +The support value of B is 91.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 100.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 100.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 100.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 99.000000. +The branchlength of B-mutant-9 is 0.051430. +The support value of B-mutant-9 is 99.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 100.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 99.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 97.000000. +Analysing sample: recombinant-50A1-50B9-raxml.newick +The branchlength of root is 0.004033. +The support value of root is 1.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 48.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 47.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 45.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 39.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 41.000000. +The branchlength of recombinant is 0.261979. +The support value of recombinant is 42.000000. +The branchlength of B-mutant-9 is 0.000001. +The support value of B-mutant-9 is 42.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 40.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 45.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 36.000000. +The branchlength of B is 0.009139. +The support value of B is 52.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 82.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 95.000000. +The branchlength of A-mutant-5 is 0.009042. +The support value of A-mutant-5 is 98.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-9 is 0.031135. +The support value of A-mutant-9 is 95.000000. +The branchlength of A-mutant-8 is 0.009905. +The support value of A-mutant-8 is 95.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 94.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 97.000000. +The branchlength of A is 0.000001. +The support value of A is 64.000000. +Analysing sample: recombinant-50A5-50random-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 60.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 99.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 70.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 97.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 98.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-9 is 0.040587. +The support value of B-mutant-9 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 98.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 98.000000. +The branchlength of B is 0.000001. +The support value of B is 100.000000. +The branchlength of A is 0.000001. +The support value of A is 100.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 100.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 99.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 99.000000. +The branchlength of recombinant is 0.404247. +The support value of recombinant is 98.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 100.000000. +The branchlength of A-mutant-9 is 0.052443. +The support value of A-mutant-9 is 100.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 77.000000. +Analysing sample: recombinant-75A1-25B1-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of A is 0.022811. +The support value of A is 100.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 89.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 98.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 99.000000. +The branchlength of A-mutant-9 is 0.041346. +The support value of A-mutant-9 is 98.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 98.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 99.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 100.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of recombinant is 0.031231. +The support value of recombinant is 100.000000. +The branchlength of B is 0.000001. +The support value of B is 100.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 97.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 99.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 100.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 100.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 99.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 100.000000. +The branchlength of B-mutant-8 is 0.010020. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-9 is 0.020662. +The support value of B-mutant-9 is 100.000000. +Analysing sample: recombinant-75A1-25B9-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of B is 0.000001. +The support value of B is 99.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 99.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 98.000000. +The branchlength of B-mutant-9 is 0.030681. +The support value of B-mutant-9 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 100.000000. +The branchlength of B-mutant-5 is 0.010052. +The support value of B-mutant-5 is 87.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 93.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 99.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 98.000000. +The branchlength of A is 0.000001. +The support value of A is 99.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 98.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 89.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 93.000000. +The branchlength of A-mutant-9 is 0.030942. +The support value of A-mutant-9 is 100.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 100.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 61.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 100.000000. +The branchlength of recombinant is 0.157984. +The support value of recombinant is 35.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 35.000000. +Analysing sample: recombinant-75A5-25B5-raxml.newick +The branchlength of root is 0.003004. +The support value of root is 1.000000. +The branchlength of B is 0.000001. +The support value of B is 99.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 99.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 98.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 99.000000. +The branchlength of B-mutant-6 is 0.012227. +The support value of B-mutant-6 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 98.000000. +The branchlength of B-mutant-9 is 0.051673. +The support value of B-mutant-9 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 93.000000. +The branchlength of B-mutant-4 is 0.009719. +The support value of B-mutant-4 is 99.000000. +The branchlength of A is 0.000001. +The support value of A is 100.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 94.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 99.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 95.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 89.000000. +The branchlength of recombinant is 0.123699. +The support value of recombinant is 87.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 74.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-9 is 0.109804. +The support value of A-mutant-9 is 57.000000. +The branchlength of A-mutant-8 is 0.010269. +The support value of A-mutant-8 is 57.000000. +Analysing sample: two-ladders-raxml.newick +The branchlength of root is 0.004245. +The support value of root is 1.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 94.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 100.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 88.000000. +The branchlength of A-mutant-9 is 0.052151. +The support value of A-mutant-9 is 88.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 86.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 100.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 97.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 98.000000. +The branchlength of A is 0.009442. +The support value of A is 99.000000. +The branchlength of B is 0.000001. +The support value of B is 100.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 65.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 100.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 98.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 100.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 93.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 95.000000. +The branchlength of B-mutant-9 is 0.000001. +The support value of B-mutant-9 is 95.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 100.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 99.000000. diff --git a/out2/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png b/out2/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png new file mode 100644 index 0000000..6b5fac8 Binary files /dev/null and b/out2/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png differ diff --git a/out2/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png b/out2/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png new file mode 100644 index 0000000..642f3d0 Binary files /dev/null and b/out2/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png differ diff --git a/out2/branchlengthplot/recombinant-50A5-50random-raxml.newick.png b/out2/branchlengthplot/recombinant-50A5-50random-raxml.newick.png new file mode 100644 index 0000000..564314b Binary files /dev/null and b/out2/branchlengthplot/recombinant-50A5-50random-raxml.newick.png differ diff --git a/out2/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png b/out2/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png new file mode 100644 index 0000000..9044a7f Binary files /dev/null and b/out2/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png differ diff --git a/out2/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png b/out2/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png new file mode 100644 index 0000000..cce83c8 Binary files /dev/null and b/out2/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png differ diff --git a/out2/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png b/out2/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png new file mode 100644 index 0000000..dbd82b3 Binary files /dev/null and b/out2/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png differ diff --git a/out2/branchlengthplot/two-ladders-raxml.newick.png b/out2/branchlengthplot/two-ladders-raxml.newick.png new file mode 100644 index 0000000..ed4888f Binary files /dev/null and b/out2/branchlengthplot/two-ladders-raxml.newick.png differ diff --git a/out2/minimal_distance_2 b/out2/minimal_distance_2 new file mode 100644 index 0000000..036cb7b --- /dev/null +++ b/out2/minimal_distance_2 @@ -0,0 +1,36 @@ +Analysing sample: recombinant-50A1-50B1-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-1. +The leaf with the parental node with a minimal branch bootstrap value is A-mutant-5. + + +Analysing sample: recombinant-50A1-50B9-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to B-mutant-9. +The leaf with the parental node with a minimal branch bootstrap value is B-mutant-4. + + +Analysing sample: recombinant-50A5-50random-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-5. +The leaf with the parental node with a minimal branch bootstrap value is B-mutant-2. + + +Analysing sample: recombinant-75A1-25B1-raxml.newick +The leaf with the biggest minimal distance to another leaf is root, to A. +The leaf with the parental node with a minimal branch bootstrap value is A-mutant-1. + + +Analysing sample: recombinant-75A1-25B9-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-1. +The leaf with the parental node with a minimal branch bootstrap value is recombinant. + + +Analysing sample: recombinant-75A5-25B5-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-5. +The leaf with the parental node with a minimal branch bootstrap value is A-mutant-9. + + +Analysing sample: two-ladders-raxml.newick +There is no recombinant in this sample. +The leaf with the biggest minimal distance to another leaf is root, to A. +The leaf with the parental node with a minimal branch bootstrap value is B-mutant-1. + + diff --git a/out2/recombinant-50A1-50B1-phyml.ascii b/out2/recombinant-50A1-50B1-phyml.ascii new file mode 100644 index 0000000..1ef294a --- /dev/null +++ b/out2/recombinant-50A1-50B1-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | /-| + | | | /-recombinant + | | \-| + | | | /-A-mutant-1 +--| | \-| + | | | /-A-mutant-2 + | | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + | | \-| + \-| | /-A-mutant-5 + | \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-8 + | \-| + | \-A-mutant-9 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/out2/recombinant-50A1-50B1-phyml.newick b/out2/recombinant-50A1-50B1-phyml.newick new file mode 100644 index 0000000..f2c7ffb --- /dev/null +++ b/out2/recombinant-50A1-50B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000001,B-mutant-9:0.05149338,(B-mutant-7:0.00000001,(B-mutant-6:0.00000001,(B-mutant-5:0.00000000,(B-mutant-4:0.00000001,(B-mutant-3:0.00000000,(B-mutant-2:0.00000000,(B-mutant-1:0.00000000,(B:0.00000001,(root:0.00769586,(A:0.00000001,(recombinant:0.08732532,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000001,(A-mutant-4:0.00000000,(A-mutant-5:0.00000000,(A-mutant-6:0.00000001,(A-mutant-7:0.01027782,(A-mutant-8:0.00000000,A-mutant-9:0.06363331)0.908347:0.01027780)0.998619:0.02084414)1.000000:0.05301619)0.959439:0.01022096)0.999998:0.04176144)1.000000:0.06361791)0.997781:0.02042366)0.886278:0.02010897)0.999989:0.06492267)1.000000:0.08915794)1.000000:0.08909749)1.000000:0.07489482)1.000000:0.06350237)0.999998:0.04169632)1.000000:0.05206589)1.000000:0.06261826)1.000000:0.06233304)1.000000:0.08424560)1.000000:0.05170039); diff --git a/out2/recombinant-50A1-50B1-raxml.ascii b/out2/recombinant-50A1-50B1-raxml.ascii new file mode 100644 index 0000000..a499346 --- /dev/null +++ b/out2/recombinant-50A1-50B1-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A-mutant-1 + | | + | | /-A-mutant-2 + | /-| | + | | | | /-A-mutant-6 + | | | | | + | | | | /-| /-A-mutant-8 + | | \-| | | /-| +--| | | | \-| \-A-mutant-9 + | | | /-| | + | /-| | | | \-A-mutant-7 + | | | | /-| | + | | | | | | \-A-mutant-5 + | | | \-| | + | | | | \-A-mutant-4 + | /-| | | + | | | | \-A-mutant-3 + | | | | + | | | \-recombinant + \-| | + | \-A + | + | /-B + | | + \-| /-B-mutant-1 + | | + | | /-B-mutant-2 + \-| | + | | /-B-mutant-4 + | | | + \-| | /-B-mutant-6 + | /-| | + | | | /-| /-B-mutant-8 + | | | | | /-| + | | | | \-| \-B-mutant-9 + \-| \-| | + | | \-B-mutant-7 + | | + | \-B-mutant-5 + | + \-B-mutant-3 diff --git a/out2/recombinant-50A1-50B1-raxml.newick b/out2/recombinant-50A1-50B1-raxml.newick new file mode 100644 index 0000000..20600da --- /dev/null +++ b/out2/recombinant-50A1-50B1-raxml.newick @@ -0,0 +1 @@ +(((B-mutant-1:0.000001,(((((A-mutant-1:0.000001,(A-mutant-2:0.000001,((((A-mutant-6:0.000001,((A-mutant-8:0.000001,A-mutant-9:0.063738)61:0.010273,A-mutant-7:0.010273)88:0.020822)99:0.053000,A-mutant-5:0.000001)53:0.010216,A-mutant-4:0.000001)99:0.041669,A-mutant-3:0.000001)99:0.063625)90:0.020376)99:0.020088,recombinant:0.087542)74:0.064987,A:0.000001)87:0.089211,root:0.007664)91:0.089269,B:0.000001)100:0.074953)100:0.063405,B-mutant-2:0.000001)97:0.041638,(B-mutant-4:0.000001,((B-mutant-6:0.000001,((B-mutant-8:0.000001,B-mutant-9:0.051430)99:0.051645,B-mutant-7:0.000001)100:0.084171)100:0.062263,B-mutant-5:0.000001)99:0.062576)100:0.052023,B-mutant-3:0.000001):0.0; diff --git a/out2/recombinant-50A1-50B1.fasta b/out2/recombinant-50A1-50B1.fasta new file mode 100644 index 0000000..0ca69c8 --- /dev/null +++ b/out2/recombinant-50A1-50B1.fasta @@ -0,0 +1,44 @@ +>root +GACAACTATGCATGTGCAGTATATGGACCCTAGTCAGGTCCGCGAATCAGGTACGACGCTCCAAGATATACAGATAACAAGTCTACTCCATCGGGACTAG +>A +TACAACTATGCATGTGCAGTAAATGGATCCTAGTCAGGTCTGCGAATCAGGGACGATCCTCCAAGATATACAGAGAACAAGTCTACTCTATCGGGACTAG +>A-mutant-1 +TACAACTATGGATGGGCAGTAAATGGATCCAATTCAGGTCTGCGAATCCGGGACGAGCCTCCAAGATCTACAGAGAACAAGTCTACTCTCTCGGGACTAG +>A-mutant-2 +TACAACTATGGATGGGCAGTAAATGGATCCAATTCAGGTCTGCGAATCCGGGACGAGCCACCAAGATCTACATAGAACAAGTCTACTCTCTCGGGACTAG +>A-mutant-3 +TACAACTCTGGATGGGCGATAAATGGACCCAATTCAGGTCTGCGAATCCGGGACGAGCCACCAAGATCTACATAGAACAAGTCTACCCTCTGGGGACTAG +>A-mutant-4 +TACAACCCTGGATGGGCGATAAATGGACCCACTTCAGGTCTGCGAATCCGGGACGAGCCACGAAGATCTACATAGAACAAGTCTACCCTCTGGGGACCAG +>A-mutant-5 +TACAACCCTGGATGGGCGATAAATGGACCCACTTCAGGTCTGCGAATCCGGGACGAGCCACGAAGATCTACATAGAACAAGTCTACCCTCTAGGGACCAG +>A-mutant-6 +TACAACCCTGGATGGGCGACAAATGGACGCACTTCAGGTCTGCGAATCCGGGACGAGCCACGACGATCTACATAGAACAAGTCTAACCTCTAGGAACCAG +>A-mutant-7 +TACATCCCTGGATGGGCGACAAGTGGACGCACATCAGGTCTGCGAATCCGGGACGAGCCACGACGATCTACATAGAACAAGTCTAACCTCTAGGAACCAG +>A-mutant-8 +TACTACCCTGGATGGGCGACAAGTGGACGCACATCAGGTCTGCGAATCCGGGACGAGCCACGACGATCTACATAGAACAAGTCTAACCTCTAGGAACCAG +>A-mutant-9 +TACTACCCTGCATGGGCGACAAGTGGACGCACATCAGGGCTGCGAATCCGGGACGAGCCACGACGATCTACATAGAAGAAGTCTAGACTCTTGGAACCAG +>B +GACAAATATGCATGTGCAATATATGGACCCTAGTCAGGTCCGGGAATCACGGACGGCGCTCCTAGATATACTGATAACAAGTCTACACCATCGGGACTAG +>B-mutant-1 +GACAAATATGCATGTGCAATATATGAACGCCAGTCAGGACCGGGAATCACGGACGGGGCTCCTAGATATACTGATAACAAGTCTACACAATCGGAACTAG +>B-mutant-2 +GACAAATATGCAAGTGCAATATATCAACGCCAGTCAGGACCGGGAATCACCGACGGGGCTCCTAGTTATTCTGATGACAAGTCTACACAATCGGAACTAG +>B-mutant-3 +GACAAATATGCAAGTGCAATATGTCAACGCCAGTCAGGACCGGGAATCACCGACGGGGTTGCTAGTTATTCTGATGACAAGTCTACACAATCGGAACTAC +>B-mutant-4 +GACAAATATGCAAGTGCAATATGTCAACGCCAGTCAGGACCGTGAATCACCTACGGGGTTGCTAGTTGTTCTGTTGACAAGTCTACACAATCGGATCTAC +>B-mutant-5 +GACAAATATGCAAGTGCAATATGTCAACGCCATTCAGGAGCGTGAGTCACCTACGGGGTTGCTAGTTGTTCTGTTAACAAGTCTACACAATTGGATTTAC +>B-mutant-6 +GACAAATATGCAAGTGCAATATGTCAACGCCATTCAGGAGCGTGAGTCATCTACCCGTTTGCTAGTTGATCTGTTAACAAGTCTCCACAATTGGATTTAC +>B-mutant-7 +GATAATTATGCGAGTGTAATAAGTCAACGCCATTCAGGAGCGTGAGTCATCTACCCGTTTTCAAGTGGATCTGTTAACAAGTCTCCACAATTGGATTTAC +>B-mutant-8 +GCTAATTATGCGAGTGTACTAAGTCAACCCCATTCAGGAGCGTGAGTCATCTACCCGTTTTCAAGTGTATCTGTTAACAAGTATCCACAATTGGATTTAC +>B-mutant-9 +GCTAACTATGCTAGTGTACTAAGTCAACCCCATTAAGGAGCGTGAGTCATCTACCCGTTTGCAAGTGTTTCTGTTAACAAGTATCCACAATTGGATTTAC +>recombinant +TACAACTATGGATGGGCAGTAAATGGATCCAATTCAGGTCTGCGAATCCGGGACGGGGCTCCTAGATATACTGATAACAAGTCTACACAATCGGAACTAG diff --git a/out2/recombinant-50A1-50B9-phyml.ascii b/out2/recombinant-50A1-50B9-phyml.ascii new file mode 100644 index 0000000..5d0fd1c --- /dev/null +++ b/out2/recombinant-50A1-50B9-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| + | | | /-B-mutant-2 +--| | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + | | \-| + \-| | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-8 + | \-| + | | /-recombinant + | \-| + | \-B-mutant-9 + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/out2/recombinant-50A1-50B9-phyml.newick b/out2/recombinant-50A1-50B9-phyml.newick new file mode 100644 index 0000000..9648612 --- /dev/null +++ b/out2/recombinant-50A1-50B9-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.03119877,A-mutant-8:0.00987980,(A-mutant-7:0.00000001,(A-mutant-6:0.00000000,(A-mutant-5:0.00862621,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000001,(A-mutant-1:0.00000001,(A:0.00000001,(root:0.00813049,(B:0.00944689,(B-mutant-1:0.00000001,(B-mutant-2:0.00000000,(B-mutant-3:0.00000001,(B-mutant-4:0.00000001,(B-mutant-5:0.00000000,(B-mutant-6:0.00000000,(B-mutant-7:0.00000000,(B-mutant-8:0.00000000,(recombinant:0.26306714,B-mutant-9:0.00000001)0.994236:0.03082014)0.999258:0.02028001)0.999711:0.02025179)0.997064:0.02026713)1.000000:0.06297251)0.993279:0.02031167)1.000000:0.09717710)1.000000:0.07372430)0.999922:0.04216898)1.000000:0.06660938)1.000000:0.07639903)1.000000:0.05245347)0.999998:0.04160758)0.999402:0.03064625)0.999347:0.03068998)1.000000:0.06561073)1.000000:0.06610388)0.999999:0.05227577)0.999821:0.03115652); diff --git a/out2/recombinant-50A1-50B9-raxml.ascii b/out2/recombinant-50A1-50B9-raxml.ascii new file mode 100644 index 0000000..c15e0b1 --- /dev/null +++ b/out2/recombinant-50A1-50B9-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B-mutant-1 + | | + | /-| /-B-mutant-2 + | | | | + | | | | /-B-mutant-3 + | | \-| | + | | | | /-B-mutant-6 + | | | | | + | | | | /-| /-B-mutant-8 + | | \-| | | /-| +--| | | | | | | /-recombinant + | /-| | | \-| \-| + | | | | /-| | \-B-mutant-9 + | | | | | | | + | | | | | | \-B-mutant-7 + | | | \-| | + | | | | \-B-mutant-5 + | | | | + | | | \-B-mutant-4 + | | | + | | \-B + | | + \-| /-A-mutant-1 + | | + | | /-A-mutant-3 + | | | + | | | /-A-mutant-5 + | /-| /-| /-| + | | | | | | | /-A-mutant-6 + | | | | | | \-| + | | | | | | | /-A-mutant-7 + | | | | \-| \-| + | | \-| | | /-A-mutant-9 + \-| | | \-| + | | | \-A-mutant-8 + | | | + | | \-A-mutant-4 + | | + | \-A-mutant-2 + | + \-A diff --git a/out2/recombinant-50A1-50B9-raxml.newick b/out2/recombinant-50A1-50B9-raxml.newick new file mode 100644 index 0000000..15cebe9 --- /dev/null +++ b/out2/recombinant-50A1-50B9-raxml.newick @@ -0,0 +1 @@ +(((B-mutant-1:0.000001,(B-mutant-2:0.000001,(B-mutant-3:0.000001,(((B-mutant-6:0.000001,((B-mutant-8:0.000001,(recombinant:0.261979,B-mutant-9:0.000001)42:0.030539)41:0.020118,B-mutant-7:0.000001)40:0.020125)39:0.020126,B-mutant-5:0.000001)45:0.062422,B-mutant-4:0.000001)36:0.020171)45:0.096563)47:0.073014)48:0.041930,B:0.009139)52:0.066163,root:0.008066,((A-mutant-1:0.000001,((A-mutant-3:0.000001,((A-mutant-5:0.009042,(A-mutant-6:0.000001,(A-mutant-7:0.000001,(A-mutant-9:0.031135,A-mutant-8:0.009905)95:0.031085)100:0.051989)100:0.065463)98:0.064871,A-mutant-4:0.000001)94:0.030487)95:0.030520,A-mutant-2:0.000001)97:0.041340)82:0.052119,A:0.000001)64:0.075543):0.0; diff --git a/out2/recombinant-50A1-50B9.fasta b/out2/recombinant-50A1-50B9.fasta new file mode 100644 index 0000000..a06839d --- /dev/null +++ b/out2/recombinant-50A1-50B9.fasta @@ -0,0 +1,44 @@ +>root +CTCTGGACAACGCGAACGAGGCTAGGATAATAAAGCTTTTTCCTTAGGCGCGGCTAGTGCTGCTACGCACGGTACTAAACTTGCAGAGTGACGGTGGGGG +>A +CTCTGGACAACGCGAACGAGGATAGGATAATAAAGCTTTTTCCTTAGGCGCGTCTATTGCTGGTACGCACGGTACTAAACCTGCAAAGTGACTGTTGGGG +>A-mutant-1 +ATCTGGACAACGCGAACGAGGATAGGAAAATAAAGCTTTTTCCTAAGGCACGTCTTTTGCTGGTACGCACGGTACTAAACCTGCAAAGTGACTGTTGGGG +>A-mutant-2 +ATCTGGACAACGCGAACGAGCATAGGAAAATAAAGCTTTTTCCTAAGGCACGTCTTTTGCTGGCACGCGCGGTACTGAACCTGCAAAGTGACTGTTGGGG +>A-mutant-3 +ATCTGGACAACGCGAACGAGCATACGAAAATAAAGCTTTTTCCTAAGGCCCGTATTTTGCTGGCACGCGCGGTACTGAACCTGCAAAGTGACTGTTGGGG +>A-mutant-4 +ATCTGGACAACGCGAACGAGCATATGAAAATAAAGCTTTTTCCTAAGGCCCGTATTTTGCTAGCACGCGCGTTACTGAACCTGCAAAGTGACTGTTGGGG +>A-mutant-5 +ATATGGACAACGCGAACGACCACATGAAAATAAAGCTTATTCCTAAGGCCCGTATTTTGCAAGGACGCGCGTTACTGAACCTGCAAAGTGCCTGTTGGGG +>A-mutant-6 +ATATAGACAACGCGAACGACCACACGAAAATTAAGCTTATGCCTGAGGCCCGTATTTTGCAAGGATGCGCGTTACTGAACCTGCAAAGTGACTGTTGGGG +>A-mutant-7 +ATATAGACAACGCGAACGACCACACAAAAATTAAGCTTATGCCTGAGGCCCGTATTTTGCAATGATGCGCGTTACTGCACCTGCAAAGTGACTTTTGCGG +>A-mutant-8 +ATATAGACAACGCGAACGACCACACAAAAATTAAGCTTATGCCTGAGGCCCGTATTTTGCCATCATGCGCGTTACTGCAACTGCAAAGTGACTTTTGCGT +>A-mutant-9 +ATATATTCAACGCGAACGACCAAACAAAAATTAAGCTTATGCCTGAGGCCCGTATTTTGCAATCATGCGCGTTACTGCAACTGCAAAGTGACTTTTGCGT +>B +CTCTGAACAACGCGAACGAGCCTAGGATATTAAAGCGTTTTCCTTAGGCGCGGATATTGCTGCTATGCACGGTACTAAACTTGCAGAGTGACGGTGGTGG +>B-mutant-1 +CTCTGAACAACGCGAACGAGCCTGGGATAATAAACCGTTTTCCTTAGGCGCGGATATTGCTGCTATGCACGGTACTAAACTTGCAGAGTGATGGTGGTTG +>B-mutant-2 +CTCTAAACAACGCGAACGAGCCTGGGATAATAAACCGTTTTCCTTAGGCGCGGATATTTCTGCTATGCACGGGACTAAAATTGCTGAGTCATGGTGGGTG +>B-mutant-3 +GTCCAAAGAACGCGAACGAGCCTGGGATATCAAACAGTATTCCTTAGGCGCGCAGATTTCTGCTATGCACGGGACTAAAATTGCTGAGTCATGGTGGGTG +>B-mutant-4 +GTCCAAAGAACGCTAACGAGCCTGGGATATCAAACAGTATTCCTTAGGCGCGCAGATTTCTGCCATGCACGGGACTAAAATTGCTGAGTCATGGTGGGTG +>B-mutant-5 +GTCCAAAGAACGCTAACGAGCCTGGGATATCAAACAGTATTCCTCAGTCGCGCAGAGTTGTGCCATGCACGGGCCTAAAATTGCTGAGACATGGTGGGTG +>B-mutant-6 +GTCCAAAGAACGCTAACGAGCCTGGGATATCAAACAGTATTCCTCACTCGCGCAGAGTCGTGCCATGCACGGGCCTAAAATTGCTGAGACATGGTGGGTG +>B-mutant-7 +GTCCAAAGAACGCTAACGAGCCTGGGATATCAAACAGTATTCTTCACTCGCGCAGAGTCGTGCCATGCACGGGCCTAAAGTTGCTGAGACATGGTGGGTG +>B-mutant-8 +GTCCAAAGAACGCTAACGAGCCTGGGATATCAAACAGTATTCTTCACTCGCGCAGAGTCGTGCCAAGCACGGGCGTAAAGTTGCTGAGACATGGTGGGTG +>B-mutant-9 +GTCCAAAGAACGCTAACGAGCCTGGGATATCAAACAGTATTCTTCACTCGCGCAGAGTCGTGGCAAACACGGGCGTAAAGTTGCTTAGACATGGTGGGTG +>recombinant +ATCTGGACAACGCGAACGAGGATAGGAAAATAAAGCTTTTTCCTAAGGCACGCAGAGTCGTGGCAAACACGGGCGTAAAGTTGCTTAGACATGGTGGGTG diff --git a/out2/recombinant-50A5-50random-phyml.ascii b/out2/recombinant-50A5-50random-phyml.ascii new file mode 100644 index 0000000..c55d341 --- /dev/null +++ b/out2/recombinant-50A5-50random-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| +--| | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + \-| \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-8 + | \-| + | \-B-mutant-9 + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-recombinant + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + \-A-mutant-9 diff --git a/out2/recombinant-50A5-50random-phyml.newick b/out2/recombinant-50A5-50random-phyml.newick new file mode 100644 index 0000000..4c02b97 --- /dev/null +++ b/out2/recombinant-50A5-50random-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000001,A-mutant-9:0.05242871,(A-mutant-7:0.00000001,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(recombinant:0.40324056,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,(A:0.00000000,(root:0.00000000,(B:0.00000000,(B-mutant-1:0.00000000,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000000,(B-mutant-7:0.00000001,(B-mutant-8:0.00000000,B-mutant-9:0.04058812)1.000000:0.05105744)0.999999:0.04070162)1.000000:0.04069341)0.999999:0.04069057)0.970640:0.00996358)1.000000:0.04076632)0.961855:0.00999200)0.999962:0.04069874)1.000000:0.15401667)1.000000:0.19425718)0.999995:0.05233682)1.000000:0.04177847)1.000000:0.05246638)0.999999:0.04177974)0.907836:0.03344120)0.603829:0.01925562)1.000000:0.08619894)1.000000:0.05266440)1.000000:0.07460084); diff --git a/out2/recombinant-50A5-50random-raxml.ascii b/out2/recombinant-50A5-50random-raxml.ascii new file mode 100644 index 0000000..410cec6 --- /dev/null +++ b/out2/recombinant-50A5-50random-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B-mutant-2 + | | + | /-| /-B-mutant-3 + | | | | + | | \-| /-B-mutant-4 + | | | | + | | \-| /-B-mutant-5 +--| | | | + | | \-| /-B-mutant-6 + | /-| | | + | | | \-| /-B-mutant-8 + | | | | /-| + | | | \-| \-B-mutant-9 + | /-| | | + | | | | \-B-mutant-7 + | | | | + | | | \-B-mutant-1 + \-| | + | \-B + | + | /-A + | | + \-| /-A-mutant-1 + | | + \-| /-A-mutant-2 + | | + \-| /-A-mutant-3 + | | + \-| /-A-mutant-4 + | | + \-| /-recombinant + | | + | | /-A-mutant-6 + \-| /-| + | | | /-A-mutant-7 + | | \-| + \-| | /-A-mutant-8 + | \-| + | \-A-mutant-9 + | + \-A-mutant-5 diff --git a/out2/recombinant-50A5-50random-raxml.newick b/out2/recombinant-50A5-50random-raxml.newick new file mode 100644 index 0000000..d923d1f --- /dev/null +++ b/out2/recombinant-50A5-50random-raxml.newick @@ -0,0 +1 @@ +((A-mutant-6:0.000001,(A-mutant-7:0.000001,(A-mutant-8:0.000001,A-mutant-9:0.052443)100:0.074649)100:0.052698)100:0.086264,((A-mutant-4:0.000001,((A-mutant-2:0.000001,((A:0.000001,((((B-mutant-2:0.000001,(B-mutant-3:0.000001,(B-mutant-4:0.000001,(B-mutant-5:0.000001,(B-mutant-6:0.000001,((B-mutant-8:0.000001,B-mutant-9:0.040587)100:0.051061,B-mutant-7:0.000001)98:0.040703)98:0.040697)97:0.040697)70:0.009963)99:0.040771)60:0.009992,B-mutant-1:0.000001)98:0.040706,B:0.000001)100:0.154130,root:0.000001)100:0.194454)100:0.052361,A-mutant-1:0.000001)99:0.041794)100:0.052497,A-mutant-3:0.000001)99:0.041800)98:0.033437,recombinant:0.404247)77:0.019291,A-mutant-5:0.000001):0.0; diff --git a/out2/recombinant-50A5-50random.fasta b/out2/recombinant-50A5-50random.fasta new file mode 100644 index 0000000..55077ee --- /dev/null +++ b/out2/recombinant-50A5-50random.fasta @@ -0,0 +1,44 @@ +>root +TCGGTCAAGGCGGCCATTGTCATAGCGTCCTCGGGGATAATGAGCGATTCGTCCAGGTTCGCATTGTATCGAACACTCCAACGTCTCTTTTCTGAACCCG +>A +TCGGGCAAGGCGGCAATTGTGTTAGCGTTCTTGGGGATCAGTAGCGATTGGGCCAGGTTCGAACTCTATTGTCCACTCCAACGTCTCTTTTCTGAACCCG +>A-mutant-1 +TCAGGCAAGGCGGCAATTGTGTTAGCGTTCTTGGGGATCAGTAGCGATTGGGCCAGGTGCGAACTCTACTGTCCAGTCCAACGTGTCTTTTCTGAACCCG +>A-mutant-2 +TAAGGCAAGGCGGCAATTGTGTTAGCGTTCTTGTGGATCAGTAGCGATTGGGCCAGGTGCGGACTCTACTGTCCAGTCCGACGTGTCTTTTCTGAACCCG +>A-mutant-3 +TAACGCAAGGCGGCAATTGTGTTCGCGTTCCTGTGGATCAGTAGCGATTGGGCCAGGTGCGGATTCTTCTGTCCAGTCCGACGTGTCTTTTCTGAACCCG +>A-mutant-4 +TAACGCAAGGCGGCAATTGTGTTCGCGTTCCTGTGGATCAGTGGCGATCGGGCCAGGTGCGGATTCTTCTGTCCAGTACGACGTGTCTTTTCCGAACCCG +>A-mutant-5 +TAACGCAAGGCGGCAATTGTGTTCGCGTTCCTGTGGGGCAGTGGCGATCGGGCCAAGTGCGGATTCTTCTGTCCCGTACGACGTGTGTTTTCCGAACCCG +>A-mutant-6 +TAACCCAAGGCCGCAATTGTGTTCGCGTACCCGTGGGGCGGTGGCGATCGGGCCAACTGCGGATTCTTCTGTCCCGTACGACGTGAGTCTTCCGAACCCG +>A-mutant-7 +TAACCCAAGGCCGTAATTGTGTTCGCGTAACCGTGGGGCGGTGGCGATCGGGCCAACTGCGGAGTCTTCTGTCCCGTACGATGTGAGTCTTCCGAACCTG +>A-mutant-8 +TAACCCAAGGCCGTAATTGTGTTCGCGTAAACGTGGAGCGGCGGCGATCGGGCCAACTGCGGAGTGTTCTGTCCCGAACGATTTGAGACTTCCGAACCTG +>A-mutant-9 +TAACCCAAGGCCGTAATTGTGTTCTCTTCAACGTGGAGCGGCGGCGATCGGGCCGACTGCGGAGTGTTCTGTCCCGAACGATATGAGACTTCCGAACCTG +>B +TCGGTCAAGGCGGCCATTCTCATAGCGTCCTCCGGCATAATGACCCATTCGTCCAGGTTCGCAGTGTATCGAACTCTTTAACACCTCTTTTATGGATCCG +>B-mutant-1 +TCGGTCAAGGCGGCCATTCTCATAGCGTCCTCCGGCATAATGACCCATACGTCCAGGTTCGCAGTGTATCGAGCTCATTAACACGTCTTTTATGGATCCG +>B-mutant-2 +TCGGTCAAGGCGGCCATTCTCATAGCGTCCTCCGGCCTAATGACCCATACGTCCAGGTTCGCAGTGTATCGAGCTCATTAACACGTCTTTTATGGATCCG +>B-mutant-3 +TCGGTCAAGGCGTCCATTCTCATAGCGTCTTACGGCCAAATGACCCATACGTCCAGGTTCGCAGTGTATCGAGCTCATTAACACGTCTTTTATGGATCCG +>B-mutant-4 +TCGGTCAAGGCGTCCATTCTCATAGCGTCTTACGGCCAAATGACCCATACGTCCAGGTTCGCAGTGTATCGAGCTCATTAACACGTCTTTTATGGATGCG +>B-mutant-5 +TCGGTCAAGGCGTCCCTTCTCATAGCGTCTTACGGCCAAATGAACCATACGTCCAGGTTCGCAGTGTATCGAGCTCATTAACTCCTCTTTTATGGATGCG +>B-mutant-6 +TCGGTCAAGGCGTCCCTTCTCATAGCGTCTTACGGCCAAAGGAACCATACGTCCAGGTTCGCAGTGAATCGAGCTCATTAACTCCTCTTCTATGGAAGCG +>B-mutant-7 +TCGGTCAAGGCATCCCTACTCATAGCGTCTTACGGCCAAAGGAACCATACGTCCAGGTGCGCAGTGAATCGAGCTCATTCACTCCTCTTCTATGGAAGCG +>B-mutant-8 +TCGGTCAAGGCATCCCTACTCATAGCGTCTTACGGCCAAAGGAACCATACGTCCATGTGCGCAGTGTTACGAGCTCATTCACTCATCTTCTATGGAAGCG +>B-mutant-9 +TCGGTCAAGGCATCCCTACTCATCGCGTATTACGGCCAAAGGAAACATACGTCCATGTGCGCAGTGTTACGGGCTCATTCACTCATCTTCTATGGAAGCG +>recombinant +TAACGCAAGGCGGCAATTGTGTTCGCGTTCCTGTGGGGCAGTGGCGATCGCCAGAGCATTGGGACCTTTTCATTCCCACAGAACGTCTAGGCCGATTTGG diff --git a/out2/recombinant-75A1-25B1-phyml.ascii b/out2/recombinant-75A1-25B1-phyml.ascii new file mode 100644 index 0000000..eabce0a --- /dev/null +++ b/out2/recombinant-75A1-25B1-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| +--| | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + \-| \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-8 + | \-| + | \-B-mutant-9 + | + | /-A + \-| + | /-recombinant + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + \-A-mutant-9 diff --git a/out2/recombinant-75A1-25B1-phyml.newick b/out2/recombinant-75A1-25B1-phyml.newick new file mode 100644 index 0000000..1a8a218 --- /dev/null +++ b/out2/recombinant-75A1-25B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000000,A-mutant-9:0.04133479,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000001,(recombinant:0.03122550,(A:0.02280812,(root:0.00000001,(B:0.00000001,(B-mutant-1:0.00000000,(B-mutant-2:0.00000001,(B-mutant-3:0.00000001,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000000,(B-mutant-7:0.00000000,(B-mutant-8:0.01001457,B-mutant-9:0.02066559)1.000000:0.06367645)1.000000:0.06292538)1.000000:0.06258290)1.000000:0.05127724)1.000000:0.05138447)0.999999:0.05138823)0.999958:0.04075488)0.999982:0.05131734)1.000000:0.13013404)1.000000:0.09673568)0.999993:0.06340741)0.702197:0.00985062)0.999971:0.03073381)1.000000:0.05160848)1.000000:0.07350767)1.000000:0.07420555)0.999948:0.04180344)1.000000:0.08552216)1.000000:0.05247784); diff --git a/out2/recombinant-75A1-25B1-raxml.ascii b/out2/recombinant-75A1-25B1-raxml.ascii new file mode 100644 index 0000000..f390a73 --- /dev/null +++ b/out2/recombinant-75A1-25B1-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | | /-A-mutant-1 + | | | + | | | /-A-mutant-2 + | | /-| | +--| /-| | | | /-A-mutant-4 + | | | | | | | + | | | | \-| | /-A-mutant-7 + | | | | | /-| /-| + | | | | | | | | | /-A-mutant-9 + | | | | | | | /-| \-| + | | \-| | | | | | \-A-mutant-8 + | | | \-| \-| | + \-| | | | \-A-mutant-6 + | | | | + | | | \-A-mutant-5 + | | | + | | \-A-mutant-3 + | | + | \-recombinant + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/out2/recombinant-75A1-25B1-raxml.newick b/out2/recombinant-75A1-25B1-raxml.newick new file mode 100644 index 0000000..a5d736a --- /dev/null +++ b/out2/recombinant-75A1-25B1-raxml.newick @@ -0,0 +1 @@ +(((B-mutant-5:0.000001,(((B-mutant-2:0.000001,(B-mutant-1:0.000001,((root:0.000001,(A:0.022811,((A-mutant-1:0.000001,(A-mutant-2:0.000001,((A-mutant-4:0.000001,(((A-mutant-7:0.000001,(A-mutant-9:0.041346,A-mutant-8:0.000001)98:0.052496)99:0.085558,A-mutant-6:0.000001)99:0.041818,A-mutant-5:0.000001)100:0.074233)100:0.073527,A-mutant-3:0.000001)100:0.051617)98:0.030737)89:0.009852,recombinant:0.031231)100:0.063441)100:0.096783)100:0.130188,B:0.000001)97:0.051320)99:0.040752)100:0.051392,B-mutant-3:0.000001)100:0.051382,B-mutant-4:0.000001)99:0.051278)100:0.062596,B-mutant-6:0.000001)100:0.062938,B-mutant-7:0.000001,(B-mutant-8:0.010020,B-mutant-9:0.020662)100:0.063692):0.0; diff --git a/out2/recombinant-75A1-25B1.fasta b/out2/recombinant-75A1-25B1.fasta new file mode 100644 index 0000000..9554ed4 --- /dev/null +++ b/out2/recombinant-75A1-25B1.fasta @@ -0,0 +1,44 @@ +>root +ACGCTGGACGGTCTCTGGCTTGGTTATGTCTTCGATATGTAATTAAATGGCCTGACGATAGTCAAGTGAGAACGATCGAGCTTTTGCGATCGGTGACTTA +>A +ACGCTGGACGGTCGCTGGCTAGGTTATGTCATCTCTGTGAAATTAAATGGACTGACGATAGACAAGTGAGAACGATCGAGCTTTTGAGAGCGGTGACTTA +>A-mutant-1 +AGGCAGGACGGTCGCTGGCTAGGTTATGTCATCGCTGTGAAATTAAATGGGCTTACGATAGACAAGGGAGAATGATCGAGCTTTTGCTAGCGGTGACTTA +>A-mutant-2 +AGGCAGGACGGTTGCTGGCTAGGTTATGTCATCGCTGTGGAATTAAATGGGCTTACGATAGACAAGGGAGAATGATCGAGCTTTTGCTAGCCGTGACTTA +>A-mutant-3 +AGGCAGGACGGTTGCTGGCTAAGTGATGTCATCGCTGTGGAATTAAATAGGCTTACGATAGACAAGGGAGAATGATCGAGCTTTTGCTAACCGTGACCTA +>A-mutant-4 +AGGCAGGACGGTTGTTGGCTAAGTGATGTCATCGCTGTGGGATTAAATAGGCTTAGGATAGACAAGGGAGTAAGATCGAGCCTTTGCTAACCGTGGCCTA +>A-mutant-5 +AGGCGGGACGGTTGTTGGCTAAGTGCTGTGATCGCTGAGGGATTAAGTAGGCTTGGGATAGGCAAGGGAGTAAGATCGAGCCTTTGCTAACCGTGGCCTA +>A-mutant-6 +AGGCGGGCCGGTTGATGGCTAAGTGCTGTGATCGCTGAGGGATTAAGTAGGCTTGGGATAGGCAAGGGAGTAAGAGCGAGCCTTTTCTAACCGTGGCCTA +>A-mutant-7 +AGGCGGGTCGGTTGATGGCTAAGTGCTGTAATCGCCGAGGGATTAAGTAGGCTTGGGATAGTTAAGGGAGTTAGAGCGGGCCTTTTCTAACCGCGGCCTA +>A-mutant-8 +AGGCGGGTCCGTTATTGGCTAAGTGCTGTAATCGCCGAGGGACTAAGTAGGCTTGGGATAGTTAAGGGAGTTAGAGCGGGCCTTTTGTAACCGCGGCCTA +>A-mutant-9 +AGGCGGGTCCGTTATAGGCTAAGTGCTGTAATCGCCGAGAGACTAATTAGGCTTGGAATAGTTAAGGGAGTTAGAGCGGGCCTTTTGTAACCGCGGCCTA +>B +GCGATCGGAGGACTCTGGCTCGATTATGTCTTCGATATGGAATTACATGGCCTGAAGATAGTCAAGTGAGAACGATCGAGCTTTTGCGACCGGTGACTTA +>B-mutant-1 +GCGATCGGAGGACTCTGGCTCGCTTATGACTTCGCTATGGAATTACATGGCCTGAAGATAGTCAAGTGAGAACGATCGAGCTTTTGCGACCGGTAACGTA +>B-mutant-2 +GCGATCGGAGGACTCGGGCTCGCTTATGACTTGGCTATGGAATTACATGGCCCGAAGATAGTCAAGTGAGAACGATCGAGCTTTTGCGACCGGTAAAGTA +>B-mutant-3 +GCGATCGGAGGACTCGGGCTCGCTTATGACTTTGCTATGGCATTACATGGCCCGAAGATAGTCAAGTGAGAGCGATCTAGCTTTTGCGACCGGTTAAGTA +>B-mutant-4 +GCGATCGGAGGACTCGGGGACGCCTATGTCTTTGCTATGGCATTACATGGCCCGAAGATAGTCAAATGAGAGCGATCTAGCTTTTGCGACCGGTTAAGTA +>B-mutant-5 +CTGATCGGAGGACTCGGGGACGCCTATGTCTTTGCTATGGCATTACATGGTCCGAAGATAGTCAAATGATCGCGATCTAGCTTTTGCGACCGGTTAAGTA +>B-mutant-6 +CTGATCGGAGGACTCGGGGACGCCTATGTCTTTGCTATGGCATTACATGGTCGGGACATAGTCAAATGATCGCGATCTAGGTTTGGCGAGCGGTTAAGTA +>B-mutant-7 +CTGATCGGAGGTCTCGGGGACGCCTATTTCTTAGCTATGGCATTAGATGGTCGGGACATAGTCCAATGGTCGCGATCTAGGTTTGGCGAGCGGTTAAGTA +>B-mutant-8 +CTGATCGGAGGTTTAGGGGACGCCTATTTCTTAGCTATGGCCTGAGATGGTTGGGACATAATCCAATGGTCGCGATCTAGGTTTGGCTAGCGGTTAAGTA +>B-mutant-9 +CTGATCGGAGGTTTAGGGGACGCCTATTCCTTAGCTATGGCATGAGATGGTTGGGACATAATCCAATGGTCGCGATCCAGGTTTGGCTAGCGGTTAAGTA +>recombinant +AGGCAGGACGGTCGCTGGCTAGGTTATGTCATCGCTGTGAAATTAAATGGGCTTACGATAGACAAGGGAGAATGATCGAGCTTTTGCGACCGGTAACGTA diff --git a/out2/recombinant-75A1-25B9-phyml.ascii b/out2/recombinant-75A1-25B9-phyml.ascii new file mode 100644 index 0000000..8326c69 --- /dev/null +++ b/out2/recombinant-75A1-25B9-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | /-| /-recombinant + | | | /-| + | | | | \-A-mutant-1 +--| | \-| + | | | /-A-mutant-2 + | | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + | | \-| + \-| | /-A-mutant-5 + | \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-9 + | \-| + | \-A-mutant-8 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/out2/recombinant-75A1-25B9-phyml.newick b/out2/recombinant-75A1-25B9-phyml.newick new file mode 100644 index 0000000..4b3ce07 --- /dev/null +++ b/out2/recombinant-75A1-25B9-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.03062804,B-mutant-8:0.00000001,(B-mutant-7:0.00000001,(B-mutant-6:0.00000000,(B-mutant-5:0.00996340,(B-mutant-4:0.00000000,(B-mutant-3:0.00000001,(B-mutant-2:0.00000000,(B-mutant-1:0.00000000,(B:0.00000000,(root:0.00000000,(A:0.00000001,((recombinant:0.15791779,A-mutant-1:0.00000000)0.000000:0.00000000,(A-mutant-2:0.00000001,(A-mutant-3:0.00000001,(A-mutant-4:0.00000001,(A-mutant-5:0.00000000,(A-mutant-6:0.00000000,(A-mutant-7:0.00000001,(A-mutant-9:0.03078776,A-mutant-8:0.00000001)1.000000:0.12053449)0.994210:0.02058885)0.926241:0.01013759)1.000000:0.10868600)0.999629:0.04124325)1.000000:0.07433097)0.999998:0.05212096)0.997631:0.03104646)1.000000:0.12213407)1.000000:0.09803252)0.999992:0.04149411)1.000000:0.06338430)1.000000:0.08604093)0.999741:0.03061955)0.989770:0.02055037)1.000000:0.06348896)1.000000:0.06280522)1.000000:0.06263138); diff --git a/out2/recombinant-75A1-25B9-raxml.ascii b/out2/recombinant-75A1-25B9-raxml.ascii new file mode 100644 index 0000000..20c1a88 --- /dev/null +++ b/out2/recombinant-75A1-25B9-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | | + | | /-B-mutant-2 + | | | + | | | /-B-mutant-6 + | | | | +--| /-| | /-| /-B-mutant-9 + | | | /-| | | /-| + | | | | | | \-| \-B-mutant-8 + | | | | | /-| | + | | | | | | | \-B-mutant-7 + | | | | | /-| | + | | \-| | | | \-B-mutant-5 + | | | \-| | + | | | | \-B-mutant-4 + \-| | | + | | \-B-mutant-3 + | | + | \-B-mutant-1 + | + | /-A + | | + | | /-A-mutant-2 + | | | + | | /-| /-A-mutant-3 + \-| | | | + | | \-| /-A-mutant-4 + | | | | + | | | | /-A-mutant-7 + | | \-| /-| + | | | | | /-A-mutant-9 + \-| | /-| \-| + | | | | \-A-mutant-8 + | \-| | + | | \-A-mutant-6 + | | + | \-A-mutant-5 + | + | /-recombinant + \-| + \-A-mutant-1 diff --git a/out2/recombinant-75A1-25B9-raxml.newick b/out2/recombinant-75A1-25B9-raxml.newick new file mode 100644 index 0000000..2ecbe3a --- /dev/null +++ b/out2/recombinant-75A1-25B9-raxml.newick @@ -0,0 +1 @@ +(recombinant:0.157984,A-mutant-1:0.000001,(((root:0.000001,(B:0.000001,((B-mutant-2:0.000001,((((B-mutant-6:0.000001,((B-mutant-9:0.030681,B-mutant-8:0.000001)100:0.062642,B-mutant-7:0.000001)100:0.062889)98:0.063525,B-mutant-5:0.010052)87:0.020512,B-mutant-4:0.000001)93:0.030659,B-mutant-3:0.000001)99:0.086130)99:0.063596,B-mutant-1:0.000001)98:0.041594)99:0.098006)99:0.122083,A:0.000001)55:0.031062,(A-mutant-2:0.000001,(A-mutant-3:0.000001,(A-mutant-4:0.000001,(((A-mutant-7:0.000001,(A-mutant-9:0.030942,A-mutant-8:0.000001)100:0.120807)93:0.020598,A-mutant-6:0.000001)61:0.010150,A-mutant-5:0.000001)100:0.108636)89:0.041264)100:0.074393)98:0.052110)35:0.000001):0.0; diff --git a/out2/recombinant-75A1-25B9.fasta b/out2/recombinant-75A1-25B9.fasta new file mode 100644 index 0000000..673d949 --- /dev/null +++ b/out2/recombinant-75A1-25B9.fasta @@ -0,0 +1,44 @@ +>root +GATGCATACATAGGGTTTTGTTCTCTAGCTAATACGCAATTATGTCTGACCCCTTATAGACCACTTACGTTTATTTACACTGAAATATACGTACATTCGC +>A +AATGCATACGGTGGGTTTTGTTCGCTAGATAATACGCAATTCTGTCTGACCCCTTATAGACCACTTACGTTTATTTAAACTGAACTATACGTATATTCTC +>A-mutant-1 +AATGCATACGGTGGGGTTTGTTCGCTAGATAATACGCAATTCTGTCTTACCCCTTATAGACCACTTACGTTTATTTAAACTGGACTATACGTATATTCTC +>A-mutant-2 +AATGCATACGGTGGGGTTTGTTCGCTAGATAATACGCAATTCTGTCTTACCGCGTATAGACCACTTACGTTTATGTAAACTGCACTATACGTATATCCTC +>A-mutant-3 +ATTGCATACCGTGGGGTATGTTCGCTAGATAATACGCATTTCTGTCTTACCGCGTATAGACCACTTACGTTTATGGAAACTACACTATACGTATATCCTT +>A-mutant-4 +ATTGCATACCGTGGGGTATGTTCGCGAGTTAATACGCATTTATGTCTTACCGCGTATAGACCACTTACGTTTATGGAATCTACACTATACGTATATCCTT +>A-mutant-5 +CTTGCATACCGTGGGGTAAGTTCGCCAGTTAAAACGAATTTATGCCTTACCTCGTATAGACCACTTACGTTTTTCGAATCTACACTATACGTATATCCTC +>A-mutant-6 +CTTGCATACCCTGGGGTAAGTTCGCCAGTTAAAACGAATTTATGCCTTACCTCGTATAGACCACTTACGTTTTTCGAATCTACACTATACGTATATCCTC +>A-mutant-7 +CTTGCATACCCTGGGCTAAATTCGCCAGTTAAAACGAATTTATGCCTTACCTCGTATAGACCACTTACGTTTTTCGAATCTACACTATACGTATATCCTC +>A-mutant-8 +CTTGCATACCTTGGGCTAAATTCGCAAGTGAAAACGAATGTATGCTTTCCCCCGTATAGACCACTTACGTTTTACGAATCTACACTAGACGGATTTCCTC +>A-mutant-9 +CTTGCATACCTTGGGCTAAATTCGCAAGTGAAAACGAATGTATGCTTTCCCCCGTATAGACCCCTTACGTTTTGCGAATCTGCACTAGACGGATTTCCTC +>B +GATGCATACATAGGGTTTTGTTCTCTAGCTTATACGCAATTATGTCTGACCCCCAATAGATCACTCAGGTTGACTTACACTCAAATATACGTACATTCGC +>B-mutant-1 +GATGCATACATAGGGTTTTGTTCTCTAGCTTATAAGCAATTATGTCTGACCCCCATTAGATCTCTCAGGTTGACTTACACTCTAATATACGTACATTCGC +>B-mutant-2 +GATGCATACATAGGGTTTTGTTCTCCAGCTTATTAGCAACTATGGCTGACCCCCATTAGATCTCTCAGGTTGACTTACACTCTAATATAGGTACGTTCGC +>B-mutant-3 +GATGCATACATAGGGTTTTTTTCTCCAGCTTATTAGCTACTATGGCTGACCCCCACTAGATCTTTCGAGTTGACTTACAGTTTAATATAGGTACGTTCGC +>B-mutant-4 +GATGCATACATAGGGTTTTTTTCTCCAGCTTATAAGCTACTATGGCTGACCCCCACGAGATCTTTCGAGTTGACTTACAGTTTAATATAGTTACGTTCGC +>B-mutant-5 +GATCCATACATAGGGTTATTTTCTCCAGCTTATAAGCTACTATGGCTGACCCCCACGAGATCTTTCGAGTTGACTTACAGTTTAATATAGTTCCGTTCGC +>B-mutant-6 +GATGCATACATAGTGTTATTTTTTCCAGGTTATAAGCTACTATGGCTGACCCCCAGGAGATCTTTCGAGTTGACTTACAGTTTAACATAGTTCCGTTAGC +>B-mutant-7 +GATGCATAAACAGTGATATTTTTTCCAGGTTATAAGCTACTATGGCTGACCCCCAGGATATCATACGAGTTGACTTACAGTTTAACATAGTTCCGTTAGC +>B-mutant-8 +GATGCATTAACAGAGATATTTTTTCCAGGTTATACGCTAATATGGCTGCCCCCCAGGATATCATACGAGTTGACTTACAGTTTAACATCGTTCCGTTAGC +>B-mutant-9 +GATGCATTAATAGAGATATTGTTTCCAGGTTATACGCTAATATGGCTGCCCCCCAGGATATCATACGAGTTGTCTTACAGTTTAACATCGTTCCGTTAGC +>recombinant +AATGCATACGGTGGGGTTTGTTCGCTAGATAATACGCAATTCTGTCTTACCCCTTATAGACCACTTACGTTTATTTACAGTTTAACATCGTTCCGTTAGC diff --git a/out2/recombinant-75A5-25B5-phyml.ascii b/out2/recombinant-75A5-25B5-phyml.ascii new file mode 100644 index 0000000..de53f9c --- /dev/null +++ b/out2/recombinant-75A5-25B5-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | /-| + | | | /-A-mutant-1 + | | \-| + | | | /-A-mutant-2 +--| | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + | | \-| + | | | /-recombinant + | | \-| + \-| | /-A-mutant-5 + | \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-9 + | \-| + | \-A-mutant-8 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/out2/recombinant-75A5-25B5-phyml.newick b/out2/recombinant-75A5-25B5-phyml.newick new file mode 100644 index 0000000..a37062d --- /dev/null +++ b/out2/recombinant-75A5-25B5-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000000,B-mutant-9:0.05195604,(B-mutant-7:0.00000000,(B-mutant-6:0.01217254,(B-mutant-5:0.00000000,(B-mutant-4:0.00969783,(B-mutant-3:0.00000001,(B-mutant-2:0.00000001,(B-mutant-1:0.00000001,(B:0.00000000,(root:0.00744418,(A:0.00000001,(A-mutant-1:0.00000001,(A-mutant-2:0.00000001,(A-mutant-3:0.00000001,(A-mutant-4:0.00000000,(recombinant:0.12497835,(A-mutant-5:0.00000000,(A-mutant-6:0.00000001,(A-mutant-7:0.00000000,(A-mutant-9:0.11051525,A-mutant-8:0.01018536)0.735836:0.01024653)1.000000:0.08639171)1.000000:0.08669748)0.576464:0.00961630)0.953655:0.02142098)0.998896:0.02059217)0.999846:0.04192365)1.000000:0.06404830)0.966845:0.03118277)1.000000:0.18052092)0.999996:0.09109207)0.999998:0.05228026)1.000000:0.07479994)1.000000:0.07432116)1.000000:0.05302349)0.999279:0.03130515)1.000000:0.07444440)0.999950:0.05178115)1.000000:0.07414565); diff --git a/out2/recombinant-75A5-25B5-raxml.ascii b/out2/recombinant-75A5-25B5-raxml.ascii new file mode 100644 index 0000000..2ac192b --- /dev/null +++ b/out2/recombinant-75A5-25B5-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | | + | /-| /-B-mutant-1 + | | | | +--| | \-| /-B-mutant-2 + | | | | + | | | | /-B-mutant-3 + | | \-| | + | | | | /-B-mutant-6 + | | | | /-| + | | \-| | | /-B-mutant-7 + \-| | | \-| + | | /-| | /-B-mutant-9 + | | | | \-| + | | | | \-B-mutant-8 + | \-| | + | | \-B-mutant-5 + | | + | \-B-mutant-4 + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-recombinant + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/out2/recombinant-75A5-25B5-raxml.newick b/out2/recombinant-75A5-25B5-raxml.newick new file mode 100644 index 0000000..789bb04 --- /dev/null +++ b/out2/recombinant-75A5-25B5-raxml.newick @@ -0,0 +1 @@ +(((A-mutant-6:0.000001,((((A-mutant-3:0.000001,(A-mutant-2:0.000001,(A-mutant-1:0.000001,(A:0.000001,(root:0.006007,(B:0.000001,(B-mutant-1:0.000001,(B-mutant-2:0.000001,(B-mutant-3:0.000001,(((B-mutant-6:0.012227,(B-mutant-7:0.000001,(B-mutant-9:0.051673,B-mutant-8:0.000001)100:0.073620)98:0.051365)100:0.073916,B-mutant-5:0.000001)93:0.031088,B-mutant-4:0.009719)99:0.052609)99:0.073916)98:0.074240)99:0.051941)99:0.091659)100:0.180442)94:0.030878)99:0.063578)95:0.041490)89:0.020355,A-mutant-4:0.000001)87:0.020840,recombinant:0.123699)74:0.009872,A-mutant-5:0.000001)100:0.085856)100:0.085802,A-mutant-7:0.000001)57:0.010003,A-mutant-9:0.109804,A-mutant-8:0.010269):0.0; diff --git a/out2/recombinant-75A5-25B5.fasta b/out2/recombinant-75A5-25B5.fasta new file mode 100644 index 0000000..01dda63 --- /dev/null +++ b/out2/recombinant-75A5-25B5.fasta @@ -0,0 +1,44 @@ +>root +AGGCACCATTATACTTCCACCGGGATGCCTGGGAAAGCCTCGGGGTTATCTCTATTGGTGGGTCCCGGGTAGGGACCTCAGGCTTTCGGACCTTGAACCA +>A +AGTCACCATTATACTTCCACCGGGATGCCAGCGAATCCCACCGGGTAATCTCTGTTCGTGGGCCCCGTGTAGGGACCTCACGCTGTCGGACATTGAGCCA +>A-mutant-1 +AGTCACCATTATACTTCCACCGGGATGCCAGCGAATCCTACCGGGTAATCTCTGTTCGTGGGCCCCGAGTAGGGACCGCACGCTGTCGGACATTGAGCCA +>A-mutant-2 +AGCCACCATTATACTTCCGCCGGGCTGCCAGCGAATCCTACCGGGTAATCTCTGTTCGTGGGCCCCGAGTACGGACCACACGCGGTCGGACATTGAGCCA +>A-mutant-3 +AGGCACCATTATACTTCCGCCGGGCTGCCAGCGAATCCTACCGAGTAATCTCTGTTCGTGGGCCCCGAGTACAGACCACACGCGGTCGGCCATTGAGCCA +>A-mutant-4 +AGGCACCATTATACTTGCGCCGCGCTGCCAGCGAATCCTACCGAGTAATCTCTGTTCGTGGGCCCCGAGTACAGACCACACGCGGTCGGCCATTGAGCCA +>A-mutant-5 +AGGCACCATTATACTTGCGCCGCGCTGCCAGCGAATCCTACCGAGTAAGCTCTGTTCGTGGGCCCCGAGTACCGACCACACGCGGTCGGCAATTGAGCCA +>A-mutant-6 +AGGCACCATTATACTTGCGCCGCGCTGCCAGCGAATCCTACCGAGTAAGTTCGGATGGTGTGCCCCTAGTACCGACCACACGAGGTCGGCAAGTGAGCCA +>A-mutant-7 +AGGCACCATTATACTTGCACGGCACTGCCAGCGAATCCTCCCGAGTAACTTCGGATGGTGTGCCCCTGCTATCGACCACACGAGGTCGGCAAGTGAGCCA +>A-mutant-8 +AGGCACCATTATACTTGCACGGCACTGCCAGCGAATCCTCCCGAGTAACTTCGGATGGTGTGCCCTTGCTATCGACCACATGAGGTCGGCAAGTGAGCCA +>A-mutant-9 +AGGCACCATTATACTTGCACGGCACTGACAGCGAATACTCCCTAGTATCTTCAGCTGGTGTGCGCCTACTATCTACCACATGAGGTGGGCAAGTGAGCCA +>B +AGGCAACATTATACGTCCACCGGGATGCCTGGGAAAGTCTCGGGGTTATCTCTATTGGTGAGCTCCGGGTAGGGACATCAGGCTTTCGGACTTTGAAGCA +>B-mutant-1 +AGGCAACATTATACGTCCACCGGGATGCCTGGGAAAGTCTCGAGGTTTTCTCTATTGGTGAGCTCCCTGTAGGGGCATCAGGCTTTCGGACTTTGAAGCA +>B-mutant-2 +AGGCATCATTATACCTCCACCGGGATGAGTGGGAAAGTCTCGAGGTTTTCCCTATTGGTGAGATCCCTGTAGGGGCACCAGGCTTTCGGACTTTGAAGCA +>B-mutant-3 +AGGCAGCATTATACCTCCACCGGGATGAGTGGGAACGTCACGAGGTGTTCCCTATTGGTGAGATACCTGTACGGGCACCAGGCTATCGGACTTTGAAGCA +>B-mutant-4 +AGGCAGCATTAGACCTTCACCGGGATGAGTGGGAACGTCACGAGGTGTTCCCTGTTGGTGAGATACCTGTACGGGCTCCAGGCTATAGGACTTTGAAGCT +>B-mutant-5 +AGGCAGCATTAGACCTTCACCGGAATGGGTGGGAACGTCACGAGGTGTTCCCTATTGGTGAGATACCTGTACGGACTCCAGGCTATAGGACTTTGAAGCT +>B-mutant-6 +AGTCACCATTAGACCTTCACCGGAATGGGTGGGAACGTCATAAGGTGTTCCCTATTGGTGAGATACCTGCACGGACTCCAGCCTATAGGACTATGCAGCT +>B-mutant-7 +AGTCACCATTAGACCTTCACCGGAATGGGTGGGAACGTCACAAGGTGTTCCCTATTTGTGAGATACCTGCACGGACTCCAGCCGATAGGACTGCGCCGCT +>B-mutant-8 +AGACACCATTAGACCATCACCGGAATGGTTGGAAACGTCAGAAGGAGTTCCCTATTTGTGAGATACCTGAACGGACTCCAGCCGATAGGACTGCGCCGCT +>B-mutant-9 +AGACACTACTAGACCATCACCGGATTGGTTGGAAACGTCAGAAGGAGTTCCCTATTTGTGAGTTACGTGAACGGACTCCAGCCGATAGGACTGCGCCGCT +>recombinant +AGGCACCATTATACTTGCGCCGCGCTGCCAGCGAATCCTACCGAGTAAGCTCTGTTCGTGGGCCCCGAGTACCGACTCCAGGCTATAGGACTTTGAAGCT diff --git a/out2/two-ladders-phyml.ascii b/out2/two-ladders-phyml.ascii new file mode 100644 index 0000000..d16ff03 --- /dev/null +++ b/out2/two-ladders-phyml.ascii @@ -0,0 +1,40 @@ + + /-root + | + | /-A + | /-| + | | | /-A-mutant-1 + | | \-| +--| | | /-A-mutant-2 + | | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + | | \-| + | | | /-A-mutant-5 + \-| \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-9 + | \-| + | \-A-mutant-8 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + \-B-mutant-9 diff --git a/out2/two-ladders-phyml.newick b/out2/two-ladders-phyml.newick new file mode 100644 index 0000000..a60a8fd --- /dev/null +++ b/out2/two-ladders-phyml.newick @@ -0,0 +1 @@ +(B-mutant-7:0.00000000,B-mutant-9:0.03067000,(B-mutant-6:0.00000001,(B-mutant-5:0.00000001,(B-mutant-4:0.00000000,(B-mutant-3:0.00000001,(B-mutant-2:0.00000000,(B-mutant-1:0.00000001,(B:0.00000000,(root:0.00829066,(A:0.00945603,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000000,(A-mutant-4:0.00000000,(A-mutant-5:0.00000000,(A-mutant-6:0.00000000,(A-mutant-7:0.00000000,(A-mutant-9:0.05225059,A-mutant-8:0.00000001)0.934492:0.02035489)0.998641:0.02028362)0.999990:0.05170996)1.000000:0.08524870)1.000000:0.07377450)0.999917:0.04115403)0.999999:0.04111312)0.999563:0.03171859)1.000000:0.07821528)1.000000:0.13507040)0.901085:0.01004671)1.000000:0.13107297)0.999979:0.04100177)1.000000:0.05177682)0.999908:0.03066558)1.000000:0.05194828)1.000000:0.05215443); diff --git a/out2/two-ladders-raxml.ascii b/out2/two-ladders-raxml.ascii new file mode 100644 index 0000000..0fb3632 --- /dev/null +++ b/out2/two-ladders-raxml.ascii @@ -0,0 +1,42 @@ + + /-root + | + | /-A-mutant-1 + | | + | | /-A-mutant-5 + | | | + | | | /-A-mutant-8 + | | /-| /-| + | /-| | | /-| \-A-mutant-9 +--| | | | | | | + | | | /-| \-| \-A-mutant-7 + | | | | | | + | | | | | \-A-mutant-6 + | | | /-| | + | /-| | | | \-A-mutant-4 + | | | \-| | + | | | | \-A-mutant-3 + | | | | + | | | \-A-mutant-2 + \-| | + | \-A + | + | /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-4 + | | + \-| /-B-mutant-5 + | | + | | /-B-mutant-8 + \-| /-| + | /-| \-B-mutant-9 + | | | + \-| \-B-mutant-7 + | + \-B-mutant-6 diff --git a/out2/two-ladders-raxml.newick b/out2/two-ladders-raxml.newick new file mode 100644 index 0000000..c354a8e --- /dev/null +++ b/out2/two-ladders-raxml.newick @@ -0,0 +1 @@ +(((B-mutant-8:0.000001,B-mutant-9:0.000001)95:0.030652,B-mutant-7:0.000001)100:0.052151,(B-mutant-5:0.000001,(B-mutant-4:0.000001,(B-mutant-3:0.000001,(B-mutant-2:0.000001,(B-mutant-1:0.000001,((((A-mutant-1:0.000001,((((A-mutant-5:0.000001,(((A-mutant-8:0.000001,A-mutant-9:0.052151)88:0.020321,A-mutant-7:0.000001)86:0.020244,A-mutant-6:0.000001)100:0.051614)100:0.085214,A-mutant-4:0.000001)100:0.073753,A-mutant-3:0.000001)97:0.041127,A-mutant-2:0.000001)98:0.041077)94:0.031707,A:0.009442)99:0.077948,root:0.008490)100:0.134860,B:0.000001)65:0.010035)100:0.130953)98:0.040948)100:0.051775)93:0.030653)99:0.051940,B-mutant-6:0.000001):0.0; diff --git a/out2/two-ladders.fasta b/out2/two-ladders.fasta new file mode 100644 index 0000000..0947b3e --- /dev/null +++ b/out2/two-ladders.fasta @@ -0,0 +1,42 @@ +>root +ATTTAGCTATATAACACATGACGAAGCACACTTTAACCTGCTGACGTGCTACGCTACGGCGAGTAAGCTCCATTCGAGGCATTAGACCGCACTTCTGACT +>A +ATTTAGGTATATAACACATGACGAGGCACACTTTAACCTTCAGACGTGCTACACAACGGCGAGTAAGCTGTAATCGAGGCATTAGACCGCACTTCTGACT +>A-mutant-1 +ATTTAGGTATATAACACATGACGAAGCGCACTTTAACCTTCAGACGTGCTACACAACGGCGAGTAAGCTGTAATCGAAGCATTAGACCGCACTTCGGACT +>A-mutant-2 +ATTTAGGTATATACCAGATGACGAAGCGCCCTTTAACCTTCAGACGTGCTACACAACGGCGAGTAAGCTGTACTCGAAGCATTAGACCGCACTTCGGACT +>A-mutant-3 +ATTTAGGTATATACCAGATGACGAAGCGCCCTTAAAGCTTCAGACGTGCTACACAACGGCGAGTAAGCTGTACTCGAAGCATTAGACCGCACTCAGGACT +>A-mutant-4 +ATTTCGGTATATACCAGATGATGAAGCGTCCTTGAAGCTTCAGACGTGCCACACAACGGCGAGTAAGCTGTACTCGAAGCATTAGACCGCAGTCAGAACT +>A-mutant-5 +ATTTCGGGATAAACCAGATGATCAAGCATCCTTGAGGCTTCAGACGTGCCACACAACGGCGAGTAAGTTGAACTCGAAGCCTTAGACCGCAGTCAGAACT +>A-mutant-6 +ATTTCGGGACAAACCAGATGATCAAGCCTCCTTGAGGCTTTAGATGTGCCACACAACGGCGAGTAAGTTGAACTCGAAGCCTTCGACCGCAGTCAGAACT +>A-mutant-7 +ATTTCGGGACAAACTAGATGATCAAGCCTCCTTGAGGCTTTAGATGTGCCACACAACGGCGAGTAAGTTGAACTCGAAGCCTTCGACCGAAGTCAGAACT +>A-mutant-8 +ATTTCGGGACAAACTAGATGATCAAGCCTCATTGAGGCTTTAGATGTGCCACACAACGGCGAGTAAGTTGAACTCGAAGCCTTCGACCGAGGTCAGAACT +>A-mutant-9 +ATTTCGGGACAAACTAGATTATCAAGCCTGATTGAGGCTTTAGATGTGGCACACAACGGCGAGTAAGTTCAACTCGAAGCCTTCGACCGACGTCAGAACT +>B +ATTTAGCTATCAAACACAGGAAAAAGCACATTTTACCCTGCAGACGTGCTACGCTGCGGCGAGTAAGCTCACTTCGAGGCATTAGACCGCACGTCTTACT +>B-mutant-1 +ATTTAGCTATCAAACACAGGAAAAAGCACATTTTACCCTGCAGACGTGCTACGCTGCGGCGAGTAAGCTCACTACGAGGCATTAGACCGCACGTCTTACT +>B-mutant-2 +ATTTAGCTGTAAAACACACGAAAACGCACATTTTACACTGCAGACCTGCCACGCTGCGTCGAGTAAGCTCACTACGAGGCTTTAGGCCTCAAGTCTTACT +>B-mutant-3 +ATTTAGCTGTAAAACACACGAAAACGCAAATTTTACAGTGCAGACCTGCCACGCTGCGTCCAGTAAGCTCACTACAAGGCTTTAGGCCTCAAGTCTTACT +>B-mutant-4 +ATTTAGCTGTAAGACACAAGAAAACGCAAATTTAACAGTGCAGACCTGCCACGCTGCGTCCAGAAAGCTCAATACAAGGCTTTAGGCCTCAAGTCTTACT +>B-mutant-5 +ATTTAGCCGTTAGACACAAGAAAACGCAAATTTAACAGTGCAGACCTGCCACGCTGCGTCCAGAAAGCTCAATAAAAGGCTTTAGGCCTCAAGTCTTACT +>B-mutant-6 +ATTTAGCCGTTAGTCACAAGAAAACGCAAATTTTACAGTGCAGACCTGCAACGCTGTGTCCAGAAAGCTCAATAAAAGGCTCTAGGCCTCAAGTCTTACT +>B-mutant-7 +ATTTAGCCGTTATTCACAAGAAGACGCAAATTTTTCAGTGCAGACCTGCAACGCTGTGTCCAGAAAGCTGAATAAAAGGCTCTAGGCCTCAAGCCTTACT +>B-mutant-8 +ATTTAGCCGTTATTCCCAAGAAGACGCAAATTTTTCAGTGCAGACCAGCAACGCTGTGTCCAGAAAGCTGAATAAAAGGCTCTAGGCCTCAAGCCTCACT +>B-mutant-9 +ATTTAGCCGTTATTCCCAAGAAGACGCAAATTTTTCAGTGCAGACCAGCAACGCTGTGTCCAGAAAGCTGAATAAAAGGCTCTAGGCCTCAAGCCTCACT diff --git a/out3/branchlength_3 b/out3/branchlength_3 new file mode 100644 index 0000000..1ec36c7 --- /dev/null +++ b/out3/branchlength_3 @@ -0,0 +1,313 @@ +Analysing sample: recombinant-50A1-50B1-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of A is 0.000001. +The support value of A is 67.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 96.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 100.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-9 is 0.052806. +The support value of A-mutant-9 is 99.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 99.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 96.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 99.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 87.000000. +The branchlength of recombinant is 0.089032. +The support value of recombinant is 55.000000. +The branchlength of B is 0.000001. +The support value of B is 90.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 87.000000. +The branchlength of B-mutant-5 is 0.010011. +The support value of B-mutant-5 is 69.000000. +The branchlength of B-mutant-6 is 0.010151. +The support value of B-mutant-6 is 69.000000. +The branchlength of B-mutant-7 is 0.010021. +The support value of B-mutant-7 is 95.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 99.000000. +The branchlength of B-mutant-9 is 0.050933. +The support value of B-mutant-9 is 99.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 99.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 97.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 95.000000. +Analysing sample: recombinant-50A1-50B9-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of recombinant is 0.224763. +The support value of recombinant is 48.000000. +The branchlength of A-mutant-2 is 0.009912. +The support value of A-mutant-2 is 59.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 96.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 96.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 98.000000. +The branchlength of A-mutant-9 is 0.111441. +The support value of A-mutant-9 is 98.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 100.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 93.000000. +The branchlength of A is 0.009284. +The support value of A is 47.000000. +The branchlength of B is 0.000001. +The support value of B is 60.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 76.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 75.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 76.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 74.000000. +The branchlength of B-mutant-9 is 0.064314. +The support value of B-mutant-9 is 75.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 75.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 73.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 74.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 67.000000. +Analysing sample: recombinant-50A5-50random-raxml.newick +The branchlength of root is 0.006014. +The support value of root is 1.000000. +The branchlength of A is 0.000001. +The support value of A is 100.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 100.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-9 is 0.052224. +The support value of A-mutant-9 is 99.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 99.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 97.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 87.000000. +The branchlength of recombinant is 0.419110. +The support value of recombinant is 99.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 99.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 98.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 96.000000. +The branchlength of B is 0.000001. +The support value of B is 99.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 100.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 100.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 100.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 92.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 100.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 97.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-9 is 0.041052. +The support value of B-mutant-9 is 100.000000. +Analysing sample: recombinant-75A1-25B1-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 98.000000. +The branchlength of B-mutant-4 is 0.009405. +The support value of B-mutant-4 is 88.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 100.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-9 is 0.075062. +The support value of B-mutant-9 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 93.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 98.000000. +The branchlength of B-mutant-1 is 0.009658. +The support value of B-mutant-1 is 91.000000. +The branchlength of B is 0.000001. +The support value of B is 100.000000. +The branchlength of A is 0.000001. +The support value of A is 100.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 51.000000. +The branchlength of recombinant is 0.074254. +The support value of recombinant is 37.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 100.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 100.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 100.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 96.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-9 is 0.030866. +The support value of A-mutant-9 is 100.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 100.000000. +Analysing sample: recombinant-75A1-25B9-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of A is 0.000001. +The support value of A is 82.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 57.000000. +The branchlength of recombinant is 0.184831. +The support value of recombinant is 57.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 94.000000. +The branchlength of A-mutant-5 is 0.016382. +The support value of A-mutant-5 is 88.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 98.000000. +The branchlength of A-mutant-9 is 0.050953. +The support value of A-mutant-9 is 98.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 97.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 94.000000. +The branchlength of B is 0.000001. +The support value of B is 94.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 61.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 69.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 94.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 97.000000. +The branchlength of B-mutant-6 is 0.009825. +The support value of B-mutant-6 is 86.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 98.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 99.000000. +The branchlength of B-mutant-9 is 0.075366. +The support value of B-mutant-9 is 99.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 97.000000. +Analysing sample: recombinant-75A5-25B5-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 97.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 93.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 100.000000. +The branchlength of B-mutant-9 is 0.063994. +The support value of B-mutant-9 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 98.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 96.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 55.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 82.000000. +The branchlength of B is 0.008120. +The support value of B is 99.000000. +The branchlength of A is 0.000001. +The support value of A is 97.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 92.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 92.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 93.000000. +The branchlength of recombinant is 0.104696. +The support value of recombinant is 65.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 65.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 93.000000. +The branchlength of A-mutant-9 is 0.040647. +The support value of A-mutant-9 is 100.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 57.000000. +Analysing sample: two-ladders-raxml.newick +The branchlength of root is 0.001644. +The support value of root is 1.000000. +The branchlength of A is 0.000001. +The support value of A is 100.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 100.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 98.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 97.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 89.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 86.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 95.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 99.000000. +The branchlength of A-mutant-9 is 0.052117. +The support value of A-mutant-9 is 99.000000. +The branchlength of A-mutant-3 is 0.009398. +The support value of A-mutant-3 is 100.000000. +The branchlength of B is 0.009902. +The support value of B is 100.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 54.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 95.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 98.000000. +The branchlength of B-mutant-4 is 0.010464. +The support value of B-mutant-4 is 98.000000. +The branchlength of B-mutant-5 is 0.009990. +The support value of B-mutant-5 is 90.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 100.000000. +The branchlength of B-mutant-7 is 0.010094. +The support value of B-mutant-7 is 97.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 70.000000. +The branchlength of B-mutant-9 is 0.040900. +The support value of B-mutant-9 is 70.000000. diff --git a/out3/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png b/out3/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png new file mode 100644 index 0000000..8df1fba Binary files /dev/null and b/out3/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png differ diff --git a/out3/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png b/out3/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png new file mode 100644 index 0000000..18afe7b Binary files /dev/null and b/out3/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png differ diff --git a/out3/branchlengthplot/recombinant-50A5-50random-raxml.newick.png b/out3/branchlengthplot/recombinant-50A5-50random-raxml.newick.png new file mode 100644 index 0000000..59ed138 Binary files /dev/null and b/out3/branchlengthplot/recombinant-50A5-50random-raxml.newick.png differ diff --git a/out3/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png b/out3/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png new file mode 100644 index 0000000..275df3a Binary files /dev/null and b/out3/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png differ diff --git a/out3/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png b/out3/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png new file mode 100644 index 0000000..699e283 Binary files /dev/null and b/out3/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png differ diff --git a/out3/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png b/out3/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png new file mode 100644 index 0000000..f2856b5 Binary files /dev/null and b/out3/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png differ diff --git a/out3/branchlengthplot/two-ladders-raxml.newick.png b/out3/branchlengthplot/two-ladders-raxml.newick.png new file mode 100644 index 0000000..42aebd3 Binary files /dev/null and b/out3/branchlengthplot/two-ladders-raxml.newick.png differ diff --git a/out3/minimal_distance_3 b/out3/minimal_distance_3 new file mode 100644 index 0000000..7311b51 --- /dev/null +++ b/out3/minimal_distance_3 @@ -0,0 +1,36 @@ +Analysing sample: recombinant-50A1-50B1-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to root. +The leaf with the parental node with a minimal branch bootstrap value is recombinant. + + +Analysing sample: recombinant-50A1-50B9-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-1. +The leaf with the parental node with a minimal branch bootstrap value is A. + + +Analysing sample: recombinant-50A5-50random-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-5. +The leaf with the parental node with a minimal branch bootstrap value is A-mutant-6. + + +Analysing sample: recombinant-75A1-25B1-raxml.newick +The leaf with the biggest minimal distance to another leaf is root, to B. +The leaf with the parental node with a minimal branch bootstrap value is recombinant. + + +Analysing sample: recombinant-75A1-25B9-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-1. +The leaf with the parental node with a minimal branch bootstrap value is A-mutant-1. + + +Analysing sample: recombinant-75A5-25B5-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-5. +The leaf with the parental node with a minimal branch bootstrap value is B-mutant-4. + + +Analysing sample: two-ladders-raxml.newick +There is no recombinant in this sample. +The leaf with the biggest minimal distance to another leaf is root, to A. +The leaf with the parental node with a minimal branch bootstrap value is B-mutant-1. + + diff --git a/out3/recombinant-50A1-50B1-phyml.ascii b/out3/recombinant-50A1-50B1-phyml.ascii new file mode 100644 index 0000000..444994b --- /dev/null +++ b/out3/recombinant-50A1-50B1-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-recombinant + | | + | /-| /-B + | | | | + | | \-| /-B-mutant-1 +--| | | | + | | \-| /-B-mutant-2 + | | | | + | | \-| /-B-mutant-3 + | | | | + | | \-| /-B-mutant-4 + | | | | + \-| | | /-B-mutant-7 + | \-| /-| + | | | | /-B-mutant-9 + | | | \-| + | \-| \-B-mutant-8 + | | + | | /-B-mutant-6 + | \-| + | \-B-mutant-5 + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + \-A-mutant-9 diff --git a/out3/recombinant-50A1-50B1-phyml.newick b/out3/recombinant-50A1-50B1-phyml.newick new file mode 100644 index 0000000..c79455c --- /dev/null +++ b/out3/recombinant-50A1-50B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000001,A-mutant-9:0.05271327,(A-mutant-7:0.00000000,(A-mutant-6:0.00000001,(A-mutant-5:0.00000000,(A-mutant-4:0.00000001,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000001,(A:0.00000001,(root:0.00000001,(recombinant:0.08947097,(B:0.00000001,(B-mutant-1:0.00000000,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00000001,((B-mutant-7:0.01002051,(B-mutant-9:0.05123099,B-mutant-8:0.00000001)1.000000:0.06288109)0.979499:0.02080993,(B-mutant-6:0.01017554,B-mutant-5:0.01005743)0.726545:0.00979768)0.999946:0.04200084)1.000000:0.06322354)0.999851:0.03066156)0.999961:0.03067659)0.999427:0.05195786)0.993987:0.06535557)0.634929:0.04241785)0.999964:0.06352518)0.999996:0.04163545)1.000000:0.05267162)0.999882:0.03055085)0.998217:0.03050794)1.000000:0.06257636)1.000000:0.07383033)0.999996:0.06232997)1.000000:0.06273140); diff --git a/out3/recombinant-50A1-50B1-raxml.ascii b/out3/recombinant-50A1-50B1-raxml.ascii new file mode 100644 index 0000000..8ae250a --- /dev/null +++ b/out3/recombinant-50A1-50B1-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | | /-A-mutant-3 + | | | + | | | /-A-mutant-5 + | | /-| /-| +--| | | | | | /-A-mutant-6 + | /-| | | | \-| + | | | | | | | /-A-mutant-7 + | | | | \-| \-| + | | | /-| | | /-A-mutant-9 + | | | | | | \-| + | | | | | | \-A-mutant-8 + | | | | | | + | | \-| | \-A-mutant-4 + \-| | | + | | \-A-mutant-2 + | | + | \-A-mutant-1 + | + | /-recombinant + | | + | | /-B + \-| | + | | /-B-mutant-1 + | | | + \-| | /-B-mutant-5 + | | /-| + | | | \-B-mutant-6 + | | /-| + \-| | | /-B-mutant-7 + | | \-| + | /-| | /-B-mutant-8 + | | | \-| + | | | \-B-mutant-9 + | /-| | + | | | \-B-mutant-4 + \-| | + | \-B-mutant-3 + | + \-B-mutant-2 diff --git a/out3/recombinant-50A1-50B1-raxml.newick b/out3/recombinant-50A1-50B1-raxml.newick new file mode 100644 index 0000000..8352ec7 --- /dev/null +++ b/out3/recombinant-50A1-50B1-raxml.newick @@ -0,0 +1 @@ +((((recombinant:0.089032,(root:0.000001,(A:0.000001,(((A-mutant-3:0.000001,((A-mutant-5:0.000001,(A-mutant-6:0.000001,(A-mutant-7:0.000001,(A-mutant-9:0.052806,A-mutant-8:0.000001)99:0.062815)100:0.062376)100:0.073930)100:0.062639,A-mutant-4:0.000001)96:0.030525)96:0.030595,A-mutant-2:0.000001)99:0.052744,A-mutant-1:0.000001)87:0.041744)67:0.063757)55:0.042376)90:0.065392,B:0.000001)87:0.052000,B-mutant-1:0.000001)95:0.030664,((((B-mutant-5:0.010011,B-mutant-6:0.010151)69:0.009753,(B-mutant-7:0.010021,(B-mutant-8:0.000001,B-mutant-9:0.050933)99:0.062426)95:0.020663)95:0.041907,B-mutant-4:0.000001)99:0.063165,B-mutant-3:0.000001)97:0.030627,B-mutant-2:0.000001):0.0; diff --git a/out3/recombinant-50A1-50B1.fasta b/out3/recombinant-50A1-50B1.fasta new file mode 100644 index 0000000..16bfc0b --- /dev/null +++ b/out3/recombinant-50A1-50B1.fasta @@ -0,0 +1,44 @@ +>root +TAAACCTGAAGATGCTTGAGCGGAAATGTATGAGCGCAATATGCTCGGCTTTAAAGAAAGGCGGCGCTTGGGTGGTAATTCAGCTTAGATGCGATTCAAC +>A +AAAACCTGAAGATGCTTGAGCGGAAATGTCTGAGCTCAATATGCTCGGCTTTAAAGAAAGGCGGCGCTTGGGTGGTTATTCAGCATAGATGCGATTTAAC +>A-mutant-1 +AAAACCTGATGATGCTTGAGCGGAAATGTCTGAGCTCAATGTGCTCGGCTTTAAAGAAAGGCGGCGCGTGGGTGGTTATTCAGCATAGATGCGATTTATC +>A-mutant-2 +AAAGCCTGATGATGTTTGAGCGGAAATGTCTGAGCTCAATGTGCTCGGCTTTAAAGAAAGACGGCGCGTCGGTGGTTCTTCAGCATAGATGCGATTTATC +>A-mutant-3 +AAAGCCTGATGATGTTTGAGCGGAAATGTCTGAGCTCAATGTGCTCGGCTTTTAAGTAAGACGGCGCGTCGGTGGTTCTCCAGCATAGATGCGATTTATC +>A-mutant-4 +AAAGCCTGATGATGTTTGAGCGGAAATGTCTGAGCTCAATGTGCTCGGCTTTTAAGTTTGACGGCGCGTCGGTGGTTCTCCAGCATAGATGCGATTTATA +>A-mutant-5 +AAAGCCTGATGATGTTAGAGCGGAAATGCCTGAGCTCAATGTACTCGGCTTTTAAGTCTGACGGCGCGTCGGTGGTGCTCCAGCTTAGATGCGATTTATA +>A-mutant-6 +AAAGACTGATAATGTTAGAGCGGAAATGCCTGAGCTCATTGTACTCGCCTTTTAAGTCTGACGTCGCGTCGGTGTTGCTACAGCTTAGATGCGATTTATA +>A-mutant-7 +AAAGACTGATAATGTTAGAGCGGAAATGCCTGAGATCATTGTACTCGTCTTTTAAGTCTGACGACGCATCGGTGTTGCTACAGCCTAGATGCGTTTTATA +>A-mutant-8 +AAAGACTGATAAAGTTAGAGCGGAAATGCCTGAGAGCATTGTAATCTTCTTTTAAGTCTGACGATGCATGGGTGTTGCTACAGCCTAGATGCGTTTTATA +>A-mutant-9 +AAAGACTGATGAAGTTAGGGCGGAAATGCCTGGGAGCATTGTAATCTTTTTTGAAGTCTGACGATGCATGGGTGTTGCTACAGCCTAGATGCGTTTTATA +>B +TAAACCTGTAGATGCCTGAGTGGAAATGTATGAGCGCAATATCCTGGGCCGTAAAGAAAGTCGGCTCTTCGGTGGTAATTCAGCTTAGATGCGATTCAAC +>B-mutant-1 +TAAACCTGTAGATGCCTGAGTGGAAATGTATGTGCGCAATATCTTGGGCCGTAAAGAAAGTCGCCTCTTCGGTGGTAATTCAGCTAAGAGGCGATTCAAC +>B-mutant-2 +TTAACCTGTAGATGCCTGAGTGGAAATGTATGTGGTCAATATCTTGGGCCGTAAAGAAAGTCGCCTCTTCGGTGGTAATTCAGCTAAGAGGCGATTCAAC +>B-mutant-3 +CTAACCTGTAGATGCCTGAGTGGAAATGTATGTGGTCAATATCTTGGGCCGTAAAGAAAGTCGCCTCTTCGGTGGTAATACAGCTAAGAGGCGATTTAAC +>B-mutant-4 +CTTACCTGTAGATGCCTGAGTGGAAATGTATGTGGTCAAGGTCTTGGGCCGTAAAGAAAGTCCCCTCTTCGGTGGTAATACAGCTAAGAGGCTATTTAAG +>B-mutant-5 +CATACCTGTAGATGCCTGAGTGGAAATGTATGTGGTCAAGGTCTTGGGCCGTCAAGAAAGTCCCCTCTTCGGTGGTCATACGGCTAAGAGGCAATTTAAG +>B-mutant-6 +CAGACCTGTAGATGCCTGAGTGGAAATGTATGTGGTCAAGGTCTTGGGCCGTCAAGAAAGTCCCCTCTTCGGTGGTCATACGGCTAAGAGGCCATTTAAG +>B-mutant-7 +CTTACCTGTAGATGCCTGAGTGGAAATGTATGTGGTCAAGGTCTTGGGCCGTCAAGAAAGTACCTTCTTCCGTGGTCATACGGCTAAGAGGCCATTTAAG +>B-mutant-8 +CTTACCTGTAGATGCCTGAGTGGAAACGTATCTGGTCAGGGTCTTCGTCCGTCAAGAAAGTCCCTTCTTCCGTGGTCATACGGCTAAGAGGCCATGTAAG +>B-mutant-9 +CTTACCTGTAGATGTCTGAGTGGAAACGTATCTGGTCAGGGTCTTCGTCCGTCAAGAAAGCCGCTTCTTCCGTGGTCATAATGCTAAGAGGCCATGTAAG +>recombinant +AAAACCTGATGATGCTTGAGCGGAAATGTCTGAGCTCAATGTGCTCGGCTGTAAAGAAAGTCGCCTCTTCGGTGGTAATTCAGCTAAGAGGCGATTCAAC diff --git a/out3/recombinant-50A1-50B9-phyml.ascii b/out3/recombinant-50A1-50B9-phyml.ascii new file mode 100644 index 0000000..4981cb7 --- /dev/null +++ b/out3/recombinant-50A1-50B9-phyml.ascii @@ -0,0 +1,42 @@ + + /-root + | + | /-A + | /-| + | | | /-recombinant + | | \-| +--| | | /-A-mutant-1 + | | \-| + | | | /-A-mutant-2 + | | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + \-| \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-9 + | \-| + | \-A-mutant-8 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/out3/recombinant-50A1-50B9-phyml.newick b/out3/recombinant-50A1-50B9-phyml.newick new file mode 100644 index 0000000..a863439 --- /dev/null +++ b/out3/recombinant-50A1-50B9-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000001,B-mutant-9:0.06447325,(B-mutant-7:0.00000001,(B-mutant-6:0.00000001,(B-mutant-5:0.00000001,(B-mutant-4:0.00000001,(B-mutant-3:0.00000000,(B-mutant-2:0.00000000,(B-mutant-1:0.00000001,(B:0.00000001,(root:0.00000001,(A:0.00947690,(recombinant:0.22219073,(A-mutant-1:0.00000000,(A-mutant-2:0.00993033,(A-mutant-3:0.00000001,(A-mutant-4:0.00000001,(A-mutant-6:0.00000001,(A-mutant-7:0.00000000,(A-mutant-9:0.11048716,A-mutant-8:0.00000001)0.999991:0.05266207)1.000000:0.07493334)0.979233:0.03068533)1.000000:0.09738146)1.000000:0.06324229)0.823590:0.00993218)0.000000:0.00000001)0.993972:0.04123966)0.999352:0.03078379)1.000000:0.09550138)0.999917:0.04993726)1.000000:0.08183625)0.999976:0.04012750)1.000000:0.08486050)0.999998:0.06307836)1.000000:0.09747566)0.999934:0.04174729)1.000000:0.09977025); diff --git a/out3/recombinant-50A1-50B9-raxml.ascii b/out3/recombinant-50A1-50B9-raxml.ascii new file mode 100644 index 0000000..f473866 --- /dev/null +++ b/out3/recombinant-50A1-50B9-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-recombinant + | | + | | /-A-mutant-2 + | | | + | | | /-A-mutant-3 + | /-| /-| | + | | | | | | /-A-mutant-5 + | | | | | | /-| + | | | | \-| | \-A-mutant-6 +--| | | | | /-| + | | | | | | | /-A-mutant-8 + | | \-| | | | /-| + | /-| | \-| \-| \-A-mutant-9 + | | | | | | + | | | | | \-A-mutant-7 + | | | | | + | | | | \-A-mutant-4 + | | | | + | | | \-A-mutant-1 + | | | + \-| \-A + | + | /-B + | | + | | /-B-mutant-2 + | | | + | | | /-B-mutant-4 + | | | | + \-| /-| | /-B-mutant-6 + | | | /-| /-| + | | | | | | | /-B-mutant-7 + | | | | | | \-| + | | | | \-| | /-B-mutant-9 + | | \-| | \-| + \-| | | \-B-mutant-8 + | | | + | | \-B-mutant-5 + | | + | \-B-mutant-3 + | + \-B-mutant-1 diff --git a/out3/recombinant-50A1-50B9-raxml.newick b/out3/recombinant-50A1-50B9-raxml.newick new file mode 100644 index 0000000..51ff527 --- /dev/null +++ b/out3/recombinant-50A1-50B9-raxml.newick @@ -0,0 +1 @@ +((B-mutant-2:0.000001,((B-mutant-4:0.000001,((B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-9:0.064314,B-mutant-8:0.000001)75:0.100233)74:0.041761)76:0.097647,B-mutant-5:0.000001)73:0.063031)75:0.084181,B-mutant-3:0.000001)74:0.039730)76:0.081490,B-mutant-1:0.000001,(B:0.000001,(root:0.000001,((recombinant:0.224763,((A-mutant-2:0.009912,(A-mutant-3:0.000001,(((A-mutant-5:0.000001,A-mutant-6:0.000001)96:0.000001,((A-mutant-8:0.000001,A-mutant-9:0.111441)98:0.052965,A-mutant-7:0.000001)100:0.075712)92:0.030835,A-mutant-4:0.000001)100:0.097348)100:0.063097)59:0.009911,A-mutant-1:0.000001)93:0.000001)48:0.041495,A:0.009284)47:0.031035)60:0.095923)67:0.049666):0.0; diff --git a/out3/recombinant-50A1-50B9.fasta b/out3/recombinant-50A1-50B9.fasta new file mode 100644 index 0000000..3d443ab --- /dev/null +++ b/out3/recombinant-50A1-50B9.fasta @@ -0,0 +1,44 @@ +>root +ATAGATAGTCAGGCCAAACCAGACCTTGCGCTGCATCCTTCGAGAAGCTTGCTCCGACCCCAATTTTGTACCTCATTATAAAATTTGCCCTCAAATAATT +>A +ATAGATAGTCGGGCCAAACCAGACCTTGCGCTGCATCGTTCGAGAAGCTTGCTCCGACCCCAAATTTGTACCTCATTATAACATTTGCCCTCAAATAATT +>A-mutant-1 +ATAGATAGCCGGGCCAAACCAGACCTTGCGCTCCATCGTTCGAGAAGCTTGCTCCGACCCCAAATTTGTATCTCATTAAAAAATTTGCCCTCAAATAATT +>A-mutant-2 +ATAGATAGCCGGGCCAAACCAGACCTAGCGCTCCATCGTTCGAGATGCTTGCTCCGACCCCAAATTTGTATCTCATTAAAAAATTTGCCCTCAAATAATT +>A-mutant-3 +ATAGATAGCCGGGCCAAACCAAACCTTGCGCTCCATCGTTCGAGATCCTTGCTCCGACCCCAAAATTTTATCTTATTAAAATATTTGCCCTCAAATAATT +>A-mutant-4 +ATCGATAGCCGGGCCAAACCAAACCTTGCGCTCCATCGTTCGATATCCTTGCTGCGACCCCAAAATATTAACTTATGAAAATATTTGCTCTCAAATAGTC +>A-mutant-5 +ATCGATAGCCGGGCCAAACCAAACCTTGCGCTCCATCCTTCGATATCCTTCCTTCGACCCCAAAATATTAACTTATGAAAATATTTGCTCTCAAATAGTC +>A-mutant-6 +ATCGATAGCCGGGCCAAACCAAACCTTGCGCTCCATCCTTCGATATCCTTCCTTCGACCCCAAAATATTAACTTATGAAAATATTTGCTCTCAAATAGTC +>A-mutant-7 +ATCGATAGCCGGGCAAAACCAAACCTTGCGCTCCATCCTTCCACATCCTTTCTTCGACCCCGAAATATTAACTTATGAAGATATTTGCTCTCAAATAGTA +>A-mutant-8 +ATCGATAGCCGGGAAAAACAAAACCTTGCGCTCCATCTTTCCACATCTTTTCTTCGACACCGAAATATTAACTTATGAAGATATTTGCTCTCAAATAGTA +>A-mutant-9 +ATCGATAGCCGGGAAAAACAAAACGTTGCCCTCAATCTTTCCACATCTTTCCTTCGACACCGAACTATTAACTTATGGAGATCTTTGCTCCCAAATAATC +>B +ATAGTTAGGCAGGCCAAACCCGACCGTGCGCTGCTTCCTTCGAGAAGCTTGCTGCGACCACAATTTTGTAACTCATTATAAAATATGCCCTCAAATAATT +>B-mutant-1 +ATAGTTAGGCAGGCCAAACCGGACGGTGCGCTGCTTCCTTCGAGAAGCTTGCGGCGACCACAATTTTGTAACTCAGTATAAAATATGCCCTCAAATAAAT +>B-mutant-2 +ATTGTTAGGAAGGCCAAACCTGACAATGCGCTGCTTCATTCGAGAAGCTTGCGGCGACCACGATTTTGTAACTCAGTATAAAATATGTCCTCAAATAAAT +>B-mutant-3 +ATTATTAGGAAGGCCAAACCTGACAATGCTCTGCTTCATTCGAGAACCTTGCGGCGACCACGATTTTGTAACTCAGTATAAAATATGTCCGCAAATAAAT +>B-mutant-4 +ATTATTAGGAAGACCAAACGTAACAATACTCGGCTTCATTCGAGAACCTTTCGGCGACCACGATTTTGTAACTCAGTATAAAAAATTTCCGCAAATAAAT +>B-mutant-5 +ATTACTAGGAAGACGAAACGTAACAATACTCGGCTTCATTCGAGAACCTTTCGGCGACCACGATTTTGTAACTCACTATAGAAAATTACCCCAAATAAAT +>B-mutant-6 +ATTACTAGGAAGACTAAACGTTACAATTCTGGGCTTACTTCGAGAACTTTTCGGCGACCACGATTTTGTAACTCACTATAGAATATTACCCCCAATAAAT +>B-mutant-7 +ATTACTAGGAAGACTAAACGTTACATTTCTGGGCTTACTTCTAGAACTTTTCAGCGACCACAATTTTGTAACTCACTATAGAATATTACCCCCAATAAAT +>B-mutant-8 +ATTACTAGGAAGACTAAACGTTACATTTCTAGGTTCACTTCTAGAACCTTTCAGCGACCAGAATTTTGTAACTCACTAAGGAATATAACCCTCAATAAAT +>B-mutant-9 +ATTACTATGAAGACTCAACGTTACATTTCTCTGTTCACTTCTAGAACCTTTCAGAGACCAGAATTTTGTAACTCACTAAGGGATATAACCCTCAATAAAT +>recombinant +ATAGATAGCCGGGCCAAACCAGACCTTGCGCTCCATCGTTCGAGAAGCTTTCAGAGACCAGAATTTTGTAACTCACTAAGGGATATAACCCTCAATAAAT diff --git a/out3/recombinant-50A5-50random-phyml.ascii b/out3/recombinant-50A5-50random-phyml.ascii new file mode 100644 index 0000000..a164d20 --- /dev/null +++ b/out3/recombinant-50A5-50random-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| +--| | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + \-| \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-8 + | \-| + | \-B-mutant-9 + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-recombinant + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + \-A-mutant-9 diff --git a/out3/recombinant-50A5-50random-phyml.newick b/out3/recombinant-50A5-50random-phyml.newick new file mode 100644 index 0000000..e42dd48 --- /dev/null +++ b/out3/recombinant-50A5-50random-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000000,A-mutant-9:0.05224940,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(recombinant:0.42131550,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,(A:0.00000001,(root:0.01205975,(B:0.00000001,(B-mutant-1:0.00000000,(B-mutant-2:0.00000001,(B-mutant-3:0.00000000,(B-mutant-4:0.00000000,(B-mutant-5:0.00000001,(B-mutant-6:0.00000000,(B-mutant-7:0.00000001,(B-mutant-8:0.00000001,B-mutant-9:0.04105818)1.000000:0.07295654)1.000000:0.08402536)0.999914:0.03033637)1.000000:0.07289183)0.999909:0.03039926)1.000000:0.08414387)1.000000:0.08436622)0.999909:0.03057052)0.999976:0.07324823)1.000000:0.15666541)0.999383:0.03064177)1.000000:0.07355816)1.000000:0.07372632)1.000000:0.06294801)1.000000:0.05193830)0.729500:0.03384537)0.970567:0.06218556)1.000000:0.06272140)1.000000:0.08533624); diff --git a/out3/recombinant-50A5-50random-raxml.ascii b/out3/recombinant-50A5-50random-raxml.ascii new file mode 100644 index 0000000..cf3cdd1 --- /dev/null +++ b/out3/recombinant-50A5-50random-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | | /-A-mutant-2 + | | | + | | | /-A-mutant-3 + | | | | +--| /-| /-| | /-A-mutant-9 + | | | | | | /-| + | | | | | | /-| \-A-mutant-8 + | | | | | | | | + | | | | \-| /-| \-A-mutant-7 + | | | | | | | + | | | | | /-| \-A-mutant-6 + | | \-| | | | + \-| | | /-| \-recombinant + | | | | | + | | \-| \-A-mutant-5 + | | | + | | \-A-mutant-4 + | | + | \-A-mutant-1 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/out3/recombinant-50A5-50random-raxml.newick b/out3/recombinant-50A5-50random-raxml.newick new file mode 100644 index 0000000..aaeccb5 --- /dev/null +++ b/out3/recombinant-50A5-50random-raxml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.000001,B-mutant-9:0.041052,(B-mutant-7:0.000001,(B-mutant-6:0.000001,((B-mutant-4:0.000001,(((B-mutant-1:0.000001,(B:0.000001,((A:0.000001,((A-mutant-2:0.000001,(A-mutant-3:0.000001,((((((A-mutant-9:0.052224,A-mutant-8:0.000001)99:0.085254,A-mutant-7:0.000001)97:0.062672,A-mutant-6:0.000001)87:0.062204,recombinant:0.419110)99:0.033765,A-mutant-5:0.000001)99:0.051902,A-mutant-4:0.000001)98:0.062898)100:0.073676)100:0.073504,A-mutant-1:0.000001)96:0.030632)100:0.156433,root:0.012029)99:0.073214)100:0.030565)100:0.084310,B-mutant-2:0.000001)100:0.084092,B-mutant-3:0.000001)92:0.030394)100:0.072867,B-mutant-5:0.000001)97:0.030332)100:0.083969)100:0.072923):0.0; diff --git a/out3/recombinant-50A5-50random.fasta b/out3/recombinant-50A5-50random.fasta new file mode 100644 index 0000000..9e04423 --- /dev/null +++ b/out3/recombinant-50A5-50random.fasta @@ -0,0 +1,44 @@ +>root +CGTTTTATTCGGTGAGTCGACCCTTACGCTAGTCGCCGATGACAAATACCTTATTAAGCGAGCTAGACCTTATAAGATAATACTCCGTACTACCCTCTTC +>A +CGTATCATTAGGTGAGTGGACCCTTACGCTAGTCGCCGATGACAAAAAACTTACTGAGCGCACTTGACCTTATAAGAGAATATTCCGTACTACCTTCTTT +>A-mutant-1 +CGTATCATTAGGTGAGTGGAACTTTACGCTAGTCGCCGATGACAAAAAACTTACTGAGCGCACTTGACCTTAAAAGAGAATATTCCGTACTACCTTCTTT +>A-mutant-2 +CGCAACATTAGGTGACTGGAACTTTACGCTAGTCGCCGATGACATAAAACTTACTGAGGGCACTTGACTTTAAAAGAGACTATTCCGTACTACCTTCTTT +>A-mutant-3 +CGCAACATTAGGTGACTGGAACTTTACGCTAGTCGCCGACGATATAAAACTTACTGAGGGCACTTAACTTTAAAAGAGACGGTTCCGTACTAAGTTCTTT +>A-mutant-4 +CGCAACATTACGTGACTGGAACTTTACGCTAGTCGTCGACGATATAAAAATTACTGAGTGCACTTAACTTTAAAAGAGACGGTTCCATACTAAGTTCTGT +>A-mutant-5 +CGCAACATTTCGTGACTGCAACCTTACTCTAGTCGTCGACGATATAAAAAATACTGAGTGCACTTAACTTTAAAAGAGACGGTTCCATACTAAGTTCTGT +>A-mutant-6 +CGCAACATTTCGAGACTGCAACCTTACTGTAGTCGTCGACAATATAAAAAATACTGATTGCGCTGAACTTTAACAGAGACGGTTACATACTAAGGTCTGT +>A-mutant-7 +TGCAACATTTCGAGACTGCAACCTTAATGTAGTCGTCGACAATATAAATAATACTGATTGCGCTGAGCTTTAACAGAGACGGTTATACACTAAGGTCTGT +>A-mutant-8 +TGTAACATTTCGAGACTGCAACCTTAATGTAGTCGTCGTCAATGTAAATGAGGCTGATTGCGCTGAGCTTTAACTGAGACGGTTATACACTACGGTCTGT +>A-mutant-9 +TGTAACAATTCGAGACTGCAACCTTAATGAAGTCGGCGTCAATGTAAATGAGGCGGATTGCGCTGAGCTTTAACTGAGGCGGTTATACACTACGGTCTGT +>B +CGTTTTATTCGGTGAGTCGACCCTTAAGCTAGTCGCCGATGACAAATACCTTATTGAGCATGCTAGACCTTATAAGCTACTACTCGGTACTACCCTCTTG +>B-mutant-1 +CGTTTTATTCGGTGAGTCGACCCTTAAGCTAGTCGCCGAAGACAAATAGCTTATTGAGCATGCTACACCTTATAAGCTACTACTCGGTACTACCCTCTTG +>B-mutant-2 +CGTTTTATGCGGTGAATCGCTCCTTAAGCTAGTCGCCGAAGACAAATAGCTTATTGAGCATGCTCCACCTTACAAGCTACTACTCGGTACTACCTTCTCG +>B-mutant-3 +CGTTTTGTGCCGTGAATCGCTCCTTAAGCTAGTGGCCGAAGACAAATAGCTTATTGAGCAAGCTCCTCCTTTCAAGCTACTACTCGGTACCACCATCTCG +>B-mutant-4 +CGTTTTGTGGCGTGAATCGCTCCTTAAGCTACTGGCCGAAGACAAATAGCTTATTGAGCAAGCTCCTCCCTTCAAGCTACTACTCGGTACCACCATCTCG +>B-mutant-5 +CGTTTTGTGGCGTGAATCGCTCCTTAAGCTACTGGCCGACCACAAATAGCTTATTAAGCACGCTTCTCCCTTCCAGCTCCTACTCGGTACCACCATCTCG +>B-mutant-6 +CGTTTTGTGGTGTGAATCGATCCTTAAGCTACTGGCCGACCACAAATAGCTTATTAAGCACGCTTCTCCCTGCCAGCTCCTACTCGGTACCACCATCTCG +>B-mutant-7 +CGTTTTGTGGTGTGTATCGATCCGTACGCTACTGGCCGACCACACATAGCTTATAAAGCACGCTTCTCCATGTCGGCTCCTACTCGGTACCACCATCTCG +>B-mutant-8 +CGTTTTGTGGTGTGTATCCATCTGTACGTTACTGGCCGAAGACACATAGCTTATAAAGCACGCTTCTCCATGTTGGCTCCAACTCGGTACCACCATCTCG +>B-mutant-9 +CGGTTTGTGGTGTGTATCCATCTGTACGTTACTGGCCAAAGACACATAGCTTATAGAGCACGCTTCTCCATGTTGGCTCCAACTCGGTACGACCATCTCG +>recombinant +CGCAACATTTCGTGACTGCAACCTTACTCTAGTCGTCGACGATATAAAAACGCCGCTAGATGGTGTAGAAACAAAGACTTTGAGCTACGTGTGCGTCTGT diff --git a/out3/recombinant-75A1-25B1-phyml.ascii b/out3/recombinant-75A1-25B1-phyml.ascii new file mode 100644 index 0000000..e534818 --- /dev/null +++ b/out3/recombinant-75A1-25B1-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| +--| | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + \-| \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-9 + | \-| + | \-B-mutant-8 + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-recombinant + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + \-A-mutant-9 diff --git a/out3/recombinant-75A1-25B1-phyml.newick b/out3/recombinant-75A1-25B1-phyml.newick new file mode 100644 index 0000000..546a855 --- /dev/null +++ b/out3/recombinant-75A1-25B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000000,A-mutant-9:0.03087184,(A-mutant-7:0.00000000,(A-mutant-6:0.00000001,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(recombinant:0.07427198,(A-mutant-1:0.00000001,(A:0.00000001,(root:0.00000001,(B:0.00000000,(B-mutant-1:0.00965977,(B-mutant-2:0.00000000,(B-mutant-3:0.00000001,(B-mutant-4:0.00940928,(B-mutant-5:0.00000000,(B-mutant-6:0.00000000,(B-mutant-7:0.00000001,(B-mutant-9:0.07506749,B-mutant-8:0.00000001)1.000000:0.05251862)0.999396:0.03095739)1.000000:0.06317462)1.000000:0.09829247)0.918722:0.02104908)0.999995:0.04123112)1.000000:0.05310924)0.999612:0.03146541)1.000000:0.09690511)1.000000:0.13291720)0.999960:0.05188592)0.617361:0.00929773)0.999966:0.04169257)1.000000:0.07281299)1.000000:0.05125312)1.000000:0.07293975)0.999913:0.03058193)1.000000:0.06305472)1.000000:0.07448602); diff --git a/out3/recombinant-75A1-25B1-raxml.ascii b/out3/recombinant-75A1-25B1-raxml.ascii new file mode 100644 index 0000000..f7e4e7b --- /dev/null +++ b/out3/recombinant-75A1-25B1-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B-mutant-2 + | | + | | /-B-mutant-4 + | | | + | /-| /-| /-B-mutant-5 + | | | | | | + | | | | \-| /-B-mutant-6 +--| | | | | | + | | | | \-| /-B-mutant-8 + | | \-| | /-| + | /-| | \-| \-B-mutant-9 + | | | | | + | | | | \-B-mutant-7 + | | | | + | /-| | \-B-mutant-3 + | | | | + | | | \-B-mutant-1 + \-| | + | \-B + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-recombinant + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/out3/recombinant-75A1-25B1-raxml.newick b/out3/recombinant-75A1-25B1-raxml.newick new file mode 100644 index 0000000..744da3c --- /dev/null +++ b/out3/recombinant-75A1-25B1-raxml.newick @@ -0,0 +1 @@ +((A-mutant-6:0.000001,((A-mutant-4:0.000001,(((recombinant:0.074254,(A-mutant-1:0.000001,(((((B-mutant-2:0.000001,((B-mutant-4:0.009405,(B-mutant-5:0.000001,(B-mutant-6:0.000001,((B-mutant-8:0.000001,B-mutant-9:0.075062)100:0.052513,B-mutant-7:0.000001)93:0.030953)100:0.063165)100:0.098283)88:0.021047,B-mutant-3:0.000001)98:0.041225)98:0.053103,B-mutant-1:0.009658)91:0.031461,B:0.000001)100:0.096893,root:0.000001)100:0.132905,A:0.000001)51:0.051876)37:0.009296)100:0.041681,A-mutant-2:0.000001)100:0.072793,A-mutant-3:0.000001)100:0.051239)100:0.072921,A-mutant-5:0.000001)96:0.030575)100:0.063045,A-mutant-7:0.000001,(A-mutant-9:0.030866,A-mutant-8:0.000001)100:0.074474):0.0; diff --git a/out3/recombinant-75A1-25B1.fasta b/out3/recombinant-75A1-25B1.fasta new file mode 100644 index 0000000..3eb4496 --- /dev/null +++ b/out3/recombinant-75A1-25B1.fasta @@ -0,0 +1,44 @@ +>root +CGCCGATGAGATCCTACCGCGCGGCCATACCTTATCTGGGAATCCCAATTCGTCCCGTAGACGACTCGAAAGTTGGAAACCAGTCAGACGATGAGTTTGC +>A +CCCCGATGAGATCCTACCGCGCGGCCATACCCTATCTGGAAATCCCAATTCGTCAGGTAGACGACTCTTAAGTTGGAGACCAGTCAAACGATTAAATTGC +>A-mutant-1 +CCCCGATGAGATCCTACCGCGCGGCCATACCCTATCTGGAAATCCCTCTTCGTCTGGGAGACGACTATTAAGTTGGAGACCAGTCAAACGATTAAATTGC +>A-mutant-2 +CCCCGATGAGATCCTACCGCGCGGCCATACCCTAACTGGAAATCCCTCTTCGTGTGCGAGACGACTATTAAGTTGGAGATCAGTCAAATGATTAAATTGC +>A-mutant-3 +CCCCGATGAGATCCTACCGCCCGGCCGTACCCTAACTGGAAAACCCTCTTCGTGTGCGAGACGACGTGTAAGTTGGAGATCAGTCAAATTATTAAATTGC +>A-mutant-4 +CCCCGATGAGATCCTACCGCCAGGCCGTACCCTAACTGGAAAACCCTCTTCGTGTGCGAGTCGACGTGTAATTTGGAGCTCAGTGAAATTATTAAATTGC +>A-mutant-5 +CCCCGATGAGATCCAACCGCCAGGCCGTACCCTAACTGGAAAACCCTCGTCGTGCGCGAGTCGACGGGTAATTTGGAGCTCACTGAAATTATTAAACTGT +>A-mutant-6 +CCCTGATGATATCCAACCGCCAGGCCGTACCCTAACTGGAAAACCCTCGTCGTGCGCGAGTCGACGGGTAATTTGGCGCTCACTGAAATTATTAAACTGT +>A-mutant-7 +CCCTGATGATATCCAACAGCCAGGCCGTACCCAAACTGGAAAACCCTCGTCGTGCCCGAGTCGACGGGTAAATTGGCGCTCACTGAAAATATAAAACTGT +>A-mutant-8 +CCCTGATGAGATCCAACAGCCAGGCTGTACCCAAACGGGAAAACTCTCGTCGGGCCCGGGTCGACGGGTAAATTGGCGCTCACTGAAAATATAAATCTGT +>A-mutant-9 +CCCTGATGAGATCCAACAGCGAGTCTGTACCCAAACGGGAAAACTCTCGACGGGCCCGGGTCGACGGGTAAATTGGCGCTCACTGAAAATATAAATCTGT +>B +CGCCGGAGAGATCCTACCGCGCGGCCATACCTCTTCTGGGAATCCCAACTCGTCCCGTAGAAGACTCCAAAGTTGGAAATCAGTTAGACGATGAGTTTGC +>B-mutant-1 +CGCCGGAGAGATCCTTCCGCTCGGCCATACCTCTTCTGGGAATCCCCACTCGTCCCGTAGAAGACTCCAAAGTTGGAAATCAGTTAGACGATGAGTTCGC +>B-mutant-2 +CGCCGGAGAGATCCTACCACTCGGCCATACCTCTTCTGGGAGTCCCCACTCGTCCCGTAGAAGACTCCAAAGTTGGAAATCAGTTAGATGATGCCTTCGC +>B-mutant-3 +CGCCGGAGACATCCTACGACTCGGCCATACCTCTTCTGGGAGTCCCCATTCCTCCCGTAGAAGACTCCAAAGTTGGAAATCAGTTAGATGATGCCTTCGC +>B-mutant-4 +CGCCGGAGACATCCTACAACTCGGCCATACCTCTACTGGGAGTCCCCTTTCCTCCCGTAGAAGACTCCAAAGTTGGAAATCAGTTAGATGATGCCTTCGC +>B-mutant-5 +GACCGGAGACAGCTTACAACTCGGCCACACCTATACTCGGTGTCCCCATTCCTCCCGTAGAAGACTCCAAGGTTGGAAATCAGTTAGATGATGCCTTCGC +>B-mutant-6 +GAACGGAGACAGCTTACAACTCGGCCACACCTATACTCGGTGTCCCCAGTCCTCCCGTAGAAGAATCCAAGGTTGTAAATCCGTTAGATGATGCCGTCGC +>B-mutant-7 +GAACGGAGACAGCTTACAACTCGGCCCCACCTATACTCGGTGTCGCCAGTCCTCCCGTAGAAGAATCCAAGGTTGCAAATCCGTTAGATGATGCCGTCGC +>B-mutant-8 +GAACGCAGACAGCTTATAACTCGGCCCCACCTAGACTCGGTGTCGCCAGTCCTCCCGTAGAAGAATCCGAGGTTGCAAATCCGTTAAATGATGCCGTCGC +>B-mutant-9 +GAACGCAGATAGCTGATAACACGGCCCGACCTAGACTCGGTGTCGCAGGTCCTCCCGTAGAAGAATCCGAGGTTGCAAATCCGTGAAATGATGCCGTCGC +>recombinant +CCCCGATGAGATCCTACCGCGCGGCCATACCCTATCTGGAAATCCCTCTTCGTCTGGGAGACGACTATTAAGTTGGAAATCAGTTAGACGATGAGTTCGC diff --git a/out3/recombinant-75A1-25B9-phyml.ascii b/out3/recombinant-75A1-25B9-phyml.ascii new file mode 100644 index 0000000..3e8bb3a --- /dev/null +++ b/out3/recombinant-75A1-25B9-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | | /-A-mutant-2 + | | /-| + | | | | /-A-mutant-3 + | /-| | \-| +--| | | | | /-A-mutant-4 + | | | | \-| + | | | | | /-A-mutant-5 + | | | | \-| + | | | | | /-A-mutant-6 + | | \-| \-| + | | | | /-A-mutant-7 + | | | \-| + \-| | | /-A-mutant-8 + | | \-| + | | \-A-mutant-9 + | | + | | /-A-mutant-1 + | \-| + | \-recombinant + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/out3/recombinant-75A1-25B9-phyml.newick b/out3/recombinant-75A1-25B9-phyml.newick new file mode 100644 index 0000000..5217ead --- /dev/null +++ b/out3/recombinant-75A1-25B9-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.07592229,B-mutant-8:0.00000000,(B-mutant-7:0.00000000,(B-mutant-6:0.00985744,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00000000,(B-mutant-2:0.00000000,(B-mutant-1:0.00000000,(B:0.00000000,(root:0.00000001,(A:0.00000001,((A-mutant-2:0.00000001,(A-mutant-3:0.00000000,(A-mutant-4:0.00000000,(A-mutant-5:0.01633239,(A-mutant-6:0.00000000,(A-mutant-7:0.00000001,(A-mutant-8:0.00000000,A-mutant-9:0.05113451)0.999983:0.05114468)1.000000:0.09606082)0.999880:0.03907440)0.860486:0.01585474)0.999957:0.03044514)1.000000:0.06258727)0.997809:0.03114102,(A-mutant-1:0.00000001,recombinant:0.18498201)0.730549:0.00976913)0.999409:0.04192532)1.000000:0.10925025)1.000000:0.13457370)0.912222:0.01024856)0.965421:0.01023515)0.999910:0.03116551)1.000000:0.06329420)0.999997:0.04134998)0.991381:0.02084673)1.000000:0.06468631)1.000000:0.07582941); diff --git a/out3/recombinant-75A1-25B9-raxml.ascii b/out3/recombinant-75A1-25B9-raxml.ascii new file mode 100644 index 0000000..040e253 --- /dev/null +++ b/out3/recombinant-75A1-25B9-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | | /-A-mutant-1 + | | /-| + | /-| | \-recombinant + | | | | +--| | | | /-A-mutant-3 + | | | | | + | | \-| /-| /-A-mutant-4 + | | | | | | + | | | | \-| /-A-mutant-5 + | | | | | | + | | | | | | /-A-mutant-8 + | | | | \-| /-| + \-| \-| | /-| \-A-mutant-9 + | | | | | + | | \-| \-A-mutant-7 + | | | + | | \-A-mutant-6 + | | + | \-A-mutant-2 + | + | /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-4 + | | + | | /-B-mutant-6 + \-| /-| + | | | /-B-mutant-7 + | | \-| + \-| | /-B-mutant-8 + | \-| + | \-B-mutant-9 + | + \-B-mutant-5 diff --git a/out3/recombinant-75A1-25B9-raxml.newick b/out3/recombinant-75A1-25B9-raxml.newick new file mode 100644 index 0000000..2a81f69 --- /dev/null +++ b/out3/recombinant-75A1-25B9-raxml.newick @@ -0,0 +1 @@ +((B-mutant-6:0.009825,(B-mutant-7:0.000001,(B-mutant-8:0.000001,B-mutant-9:0.075366)99:0.075456)98:0.064547)86:0.020781,B-mutant-5:0.000001,((B-mutant-3:0.000001,(((B:0.000001,((A:0.000001,((A-mutant-1:0.000001,recombinant:0.184831)57:0.009867,((A-mutant-3:0.000001,(A-mutant-4:0.000001,(A-mutant-5:0.016382,(((A-mutant-8:0.000001,A-mutant-9:0.050953)98:0.050986,A-mutant-7:0.000001)100:0.095901,A-mutant-6:0.000001)97:0.038950)88:0.015708)94:0.030406)100:0.062406,A-mutant-2:0.000001)94:0.030997)68:0.041734)82:0.109218,root:0.000001)94:0.133998)61:0.010225,B-mutant-1:0.000001)69:0.010204,B-mutant-2:0.000001)94:0.031037)97:0.062981,B-mutant-4:0.000001)97:0.041254):0.0; diff --git a/out3/recombinant-75A1-25B9.fasta b/out3/recombinant-75A1-25B9.fasta new file mode 100644 index 0000000..8619c02 --- /dev/null +++ b/out3/recombinant-75A1-25B9.fasta @@ -0,0 +1,44 @@ +>root +ATGGACTGTAGGCCACTTTTTTATCTATGGAATTTGCTCGACCGCGCCCGGCGCTGAGAACCAACTAACCGCCTAGGATCTCTGGAGCATCTCCAGCGGT +>A +ATGGACTGTAGGCCACTTTTTTATCTATGGAATTTGCTCGACCGCGCGCGGCGATGAGTACCAACTAACCGCCTGGGAACTCGGGAGCAAATCCATCTGT +>A-mutant-1 +ATGGACTGTAGGCCACTTTTTTATCTATGGAATTTGCTCGACCGCCAGCGCCGACGAGTACCAACTAACCGCCTGGGACCTCGGGAGCAAATCCATCTGT +>A-mutant-2 +ATGGACTGTAGGCCACTTTTTTATCTATGGAATTTGCTTGACCGCCAGCGCCGATGAGTACCAACCAACCGCCTGGGACCTCTGGAGCAAATCCATCTGT +>A-mutant-3 +ATGGACTGTAGGCCTCTTTTTTATCTATGGAATTTGTTTGACCGCCAGCGTCGATGAGTACCAACCAACCGCCTCGGACCTCCGGAGCAAATCCATCTAT +>A-mutant-4 +ATGGACTGTAGCCCTCTTTTTTATCTATGGAATTTGTTTGACCGCCATCGTCGATGAGGACCAACCAACCGCCTCGGACCTCCGGAGCAAATCCATCTAT +>A-mutant-5 +ATGGACTGTAGCCCTCTTTTTTATCTATGGAATTTGTTTGACCGCCCTCGTCGATGCGGACCAACCAACCGTCTCGGACCTCCGGAGCAAATCCATCTAT +>A-mutant-6 +ATGGACTGTAGCCATCTTTTTTATCTGTGGAATTTGTTTGACCGCCATCGTCGATGCGGACCAACCATCCGACTCGGACCTCCGGAGCAAATCCATCTAT +>A-mutant-7 +ATGGACTGTAGACATCTTATTTATGTGTGGAATTCGTTTGACCGCCAACTTCGGTGCGGACCAACCATCCAACTCGGACCTTCGGAGCAAATCCATCTAT +>A-mutant-8 +ATTGACTGTAGACATCTTATTTATGTGTGGAATTCGTTTGACCGCCAACTTCAGTGCGGACCAACCTTCCCACTCGGACCTTCGGAGCAAAACCATCTAT +>A-mutant-9 +ATTGACTGTGGACATCTTATTTATGTGTGGAATGCGTTTGACCGCAATCTTCAGTGCGGACCAACCTTACCACTCGGACCTTCGGAGCAAAACCATCTAT +>B +ATGGACTGTAGGCCCCTTTTTTATCTATGGAATTTGCTCGCCCGCGCCCGGCACTGGGAAGCAACTATGCGCCTAGGACCTTTGGAGCATCTATAGCGGG +>B-mutant-1 +ATGGACTGTAGGCCCCTTTTTTATCTATGGAATTTGCTCGCCCGCGCCCGGCACTGGGAAGCAACTATGCGCCTAGGACCTTTGGAGCATGTATAGCGGG +>B-mutant-2 +ATGGACTGTAGGACCCTTTTTTATCTATGGAATTTGCTCGCCCGCGCCCGGCACTGGGAAGCAACTATGCGCCTAGGACCTTTGGAGCATGTATAGCGGG +>B-mutant-3 +ATGGACTGAAGGACCCTTTTTTATCTATGGAATTTGCTCGCCCGCGCCCTGCACTGGGAAGCCACTATGCGCCTAGGACCTTTGGAGCATGTATAGCGGG +>B-mutant-4 +ATGGACTGAAGGACCCTTTTCTATCTATGAAATTAGCAAGCCCGCGCCCTGCACTGGGAAGCCACTATGCGCCTAGGACCTTTGGAGCATGTATAGAGGG +>B-mutant-5 +ATGGACGGAAGGACCCTTTTCTATCTATGAAATTATCAAGCCCGCGCCCTGCACTGGGAAGCCACTATGCGCTTAGGATCTTTGGAGCATGTATAGAGGG +>B-mutant-6 +ATGGAGGGAAGGACCCTTTTCTATTTATGAAATTATCAAGCCCGCGCCGTGCACTGGGAAGCCACTATGCGCTTAGGATCTTTGGAGCATGTATAGAGGG +>B-mutant-7 +ATGGAGGGTAGGGCCCTTTTCTATCTATGAAATTTTCAAGCCCGCGCCGTGCACTGGGAAGCCACTATGCGCTTAGGGGCTTTCGAGCATGTATAGAGGG +>B-mutant-8 +ATGGAGGGTAGGGCCCTTTTCTATCTTTGACATTTTCAAGCGCGCGCCGTGCACTGGGAAGCCACTATGCGCTTAGGGGCTTTCGAGAATGCATGGAGGA +>B-mutant-9 +ATGGAGGGTAGGGCCCGTTTCTATCTTTGACATTTCCAAGCGCGCGCCGTGCACTCGCAAGTCACAATGCGCTTAGGGGCTTACGAGAATGCATGGAGGA +>recombinant +ATGGACTGTAGGCCACTTTTTTATCTATGGAATTTGCTCGACCGCCAGCGCCGACGAGTACCAACTAACCGCCTGGGGGCTTACGAGAATGCATGGAGGA diff --git a/out3/recombinant-75A5-25B5-phyml.ascii b/out3/recombinant-75A5-25B5-phyml.ascii new file mode 100644 index 0000000..c66d23c --- /dev/null +++ b/out3/recombinant-75A5-25B5-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | /-| /-A-mutant-1 + | | | | + | | \-| /-A-mutant-2 +--| | | | + | | \-| /-A-mutant-3 + | | | | + | | \-| /-A-mutant-4 + | | | | + | | | | /-A-mutant-6 + | | \-| /-| + \-| | | | /-A-mutant-7 + | | | \-| + | | | | /-A-mutant-9 + | \-| \-| + | | \-A-mutant-8 + | | + | | /-recombinant + | \-| + | \-A-mutant-5 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/out3/recombinant-75A5-25B5-phyml.newick b/out3/recombinant-75A5-25B5-phyml.newick new file mode 100644 index 0000000..00684bf --- /dev/null +++ b/out3/recombinant-75A5-25B5-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000000,B-mutant-9:0.06455898,(B-mutant-7:0.00000001,(B-mutant-6:0.00000000,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00000000,(B-mutant-2:0.00000001,(B-mutant-1:0.00000001,(B:0.00757641,(root:0.00000001,(A:0.00000001,(A-mutant-1:0.00000001,(A-mutant-2:0.00000001,(A-mutant-3:0.00000000,(A-mutant-4:0.00000001,((A-mutant-6:0.00000001,(A-mutant-7:0.00000000,(A-mutant-9:0.04082580,A-mutant-8:0.00000000)1.000000:0.07382400)1.000000:0.06183232)0.999783:0.03058365,(recombinant:0.10610460,A-mutant-5:0.00000001)0.676329:0.00935535)0.999705:0.03048170)0.927160:0.00977540)0.999998:0.05112134)0.999922:0.04081213)0.999997:0.05145043)1.000000:0.08472147)1.000000:0.09971255)1.000000:0.07833553)1.000000:0.07489305)0.990869:0.02031241)0.971944:0.01012030)0.999994:0.04128560)1.000000:0.06339395)0.999999:0.05238279)1.000000:0.08648013); diff --git a/out3/recombinant-75A5-25B5-raxml.ascii b/out3/recombinant-75A5-25B5-raxml.ascii new file mode 100644 index 0000000..8c40de5 --- /dev/null +++ b/out3/recombinant-75A5-25B5-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B-mutant-1 + | | + | | /-B-mutant-2 + | /-| | + | | | | /-B-mutant-6 + | | | | | + | | | | /-| /-B-mutant-9 +--| | \-| | | /-| + | | | | \-| \-B-mutant-8 + | | | /-| | + | /-| | | | \-B-mutant-7 + | | | | /-| | + | | | | | | \-B-mutant-5 + | | | \-| | + | | | | \-B-mutant-4 + | | | | + \-| | \-B-mutant-3 + | | + | \-B + | + | /-A + | | + \-| /-A-mutant-1 + | | + \-| /-A-mutant-2 + | | + | | /-A-mutant-3 + \-| | + | | /-recombinant + | | /-| + \-| | \-A-mutant-5 + | /-| + | | | /-A-mutant-6 + | | | | + | | \-| /-A-mutant-9 + \-| | /-| + | \-| \-A-mutant-8 + | | + | \-A-mutant-7 + | + \-A-mutant-4 diff --git a/out3/recombinant-75A5-25B5-raxml.newick b/out3/recombinant-75A5-25B5-raxml.newick new file mode 100644 index 0000000..6daab8d --- /dev/null +++ b/out3/recombinant-75A5-25B5-raxml.newick @@ -0,0 +1 @@ +(((A-mutant-1:0.000001,(A:0.000001,(((B-mutant-1:0.000001,(B-mutant-2:0.000001,((((B-mutant-6:0.000001,((B-mutant-9:0.063994,B-mutant-8:0.000001)100:0.085455,B-mutant-7:0.000001)98:0.051942)100:0.062889,B-mutant-5:0.000001)96:0.041114,B-mutant-4:0.000001)55:0.010113,B-mutant-3:0.000001)82:0.020302)93:0.074414)97:0.077066,B:0.008120)99:0.097714,root:0.000001)97:0.083684)92:0.051043)92:0.040547,A-mutant-2:0.000001)93:0.050753,A-mutant-3:0.000001,(((recombinant:0.104696,A-mutant-5:0.000001)65:0.009363,(A-mutant-6:0.000001,((A-mutant-9:0.040647,A-mutant-8:0.000001)100:0.073235,A-mutant-7:0.000001)100:0.061439)93:0.030386)87:0.030248,A-mutant-4:0.000001)57:0.009751):0.0; diff --git a/out3/recombinant-75A5-25B5.fasta b/out3/recombinant-75A5-25B5.fasta new file mode 100644 index 0000000..e4ace72 --- /dev/null +++ b/out3/recombinant-75A5-25B5.fasta @@ -0,0 +1,44 @@ +>root +TATTTCAGCACCATAGCCCACCGTAAGAGGATAGCGGGAGAACGTTTCAACGCAATGGTCACGGGAATTAGATCCATCGGGTCAGCGATAACCGCGGTGC +>A +TATTCCCGCACCATAGCCCACCGTAAGAGGATTGCGGGAGAACGTTTCAACCCAATCGTCACGGGAATTAGATCCATTGGGTCCGCGATAACCGCGCTGC +>A-mutant-1 +TATTCCCGCACCATAGCCCACCGTAGGAGGATTGCGGAAGAACGTTGCAACCCAATCGTCACGGGAATTAGATCCATTGGGTCCACGATAACCACGCTGC +>A-mutant-2 +TATGCCCGCACCATAGCCCACCGTAGGAGGGTTGCGGAAGAACGTTGGAACCCAATCGTCAGGGGAATTAGATCCATTGGGTCCACGATAACCACGCTGC +>A-mutant-3 +TATGCCCGCACCATAACCCACCGTAGGAGGGTTGCGGAAGAACGTTGGAAAGCAATCGTCATGGGAATTAGATCCATTGGGTCCACGATAACCAGGCTGC +>A-mutant-4 +TATGCCCGCACCATAACCCACCGTAGGAGGGTTGCGGAAGAACGTTGGAAAGCGATCGTCATGGGAATTAGATCCATTGGGTCCACGATAACCAGGCTGC +>A-mutant-5 +TATGCACGCACCATAACCCGCCGTAAAAGGGTTGCGGAAGAACGTTGGAAAGCGATCGTCATGGGAATTAGATCCATTGGGTCCACGATAACCAGGCTGC +>A-mutant-6 +TATGCACTCACCATAACCCGCCGTAAGAGGGTTGCGGAAGAACGTTGGGGAGCGATCGTCATGGGAATTAGATCCATTGGGTCCACGATAACCAGGCTGC +>A-mutant-7 +TATGCACTCTCCATAACCCCCCGTAAGAGGGTTGCGGAAGACCGTTGGGGGGCGATGGTCATGGGAGTTAGATCCATTGGGTCCACGATAACCAGGCTGC +>A-mutant-8 +TATGCACTCTCTATAACCCCTCGTAAGAGGGTTGCGGAAGACCGTTGAGGGGCGATGGTAACGGGAGTTAGATCCATTGGGTCCACGCTAACCAGGCTTC +>A-mutant-9 +TATCCACTCTCTATAACCCCTCGTAAGAGGGTTGCGGAAGACCGTTGAGGGACGATGGTATCGGGAGTTAGATCCAATGGGTCCACGCTAACCAGGCTTC +>B +TATTTCAGGACCATAGCCCACCGTAAGTGGATCGCGGTGGTACCTTTCAACGCAGTGGTCACGGCAATTAGATCCTTCGGGTCAGCGATAACCGCGGTGC +>B-mutant-1 +CATTTCAGGACCATAGCCCACCGTACGTGGATCGCGGTGGAACCTTTCATCGCAGTCGTCGCGGCAATTAGGTCCTTCGGTTCAGCGATAACCGCGGTGC +>B-mutant-2 +AATTTCAGGACCATAGCCCACCGTACGTGGGTCGCGGTGGAGCCTTTCATCGCAATCGTCGCGGCAATTAGGTCATTCGGTTCAGTGATAACCGCGGCGC +>B-mutant-3 +AATTTCAAGACCATAGCCCACCGTACGTGGGTCGCGGTAGAGCCTTTCATCGCAATCGTCGCGGCAATTAGGTCATTCGGTTCAGTGATAACCGCGGCGC +>B-mutant-4 +AATTTCAAGACCATAGCCCACCGTACGTGGGTCGCGGTAGAGCCTTTCATCGCAATCGTCGCGGCAATTAGGTCATTCGGGTCAGTGATAACCGCGGCGC +>B-mutant-5 +AATTTCAAGACCATAGCCCACCGTACGTGGGTCGCGGTAGAGCCTTTCAACGCAATCGTCGCGACAATTAGGTCGTTCGTGTCAGTGATAACCGCGGCGC +>B-mutant-6 +ACTTTCCAGACCATAACCCACCGTACATGGGTCGCGGTAGAGCCTTTCAACGCAATCCTCGCGACAATTAGGTCGGTCGTGTCAGTGATAACCGCGGCGC +>B-mutant-7 +ACTTTCCAGACCATCACCCACCGTGCATGGGTCGCGGTAGAGCCTTACAACGCAATCCCCGCGACAATTAGGTCGGTCGTGTCAGTGATAACCGCGGAGC +>B-mutant-8 +ACTTTCCAGACCATCACCCACCGTGCATGGGTCGCGGTAGTGCCTTAGGACGCAATCCCCGCGCCAATTAGGTCGCTCGTGCCAGTGTTAACCGCGGAAC +>B-mutant-9 +ACTTACCAGACCATCCCCCACCGTGCATGGGTCGCGGTAGTGCCTTAGGACGCAATCCGCGCGCCAATTAGGTCGCTCCTGCCAGTGTTTACCGTGGAAC +>recombinant +TATGCACGCACCATAACCCGCCGTAAAAGGGTTGCGGAAGAACGTTGGAAAGCGATCGTCATGGGAATTAGATCCTTCGTGTCAGTGATAACCGCGGCGC diff --git a/out3/two-ladders-phyml.ascii b/out3/two-ladders-phyml.ascii new file mode 100644 index 0000000..efc4489 --- /dev/null +++ b/out3/two-ladders-phyml.ascii @@ -0,0 +1,42 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| +--| | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + \-| \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-8 + | \-| + | \-B-mutant-9 + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + \-A-mutant-9 diff --git a/out3/two-ladders-phyml.newick b/out3/two-ladders-phyml.newick new file mode 100644 index 0000000..b21b2a0 --- /dev/null +++ b/out3/two-ladders-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000000,A-mutant-9:0.05211939,(A-mutant-7:0.00000001,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00941104,(A-mutant-2:0.00000000,(A-mutant-1:0.00000001,(A:0.00000001,(root:0.00343927,(B:0.00990332,(B-mutant-1:0.00000000,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.01046742,(B-mutant-5:0.01002691,(B-mutant-6:0.00000000,(B-mutant-7:0.01009702,(B-mutant-8:0.00000000,B-mutant-9:0.04089298)0.887664:0.00994772)0.999995:0.04104625)1.000000:0.07442241)0.999941:0.04285632)0.995200:0.03043073)0.999997:0.04111668)0.999999:0.04111707)0.615695:0.01028622)1.000000:0.17801644)1.000000:0.15046448)0.999997:0.06202729)0.999998:0.04097547)1.000000:0.07490356)0.999388:0.03139172)0.999536:0.02029465)0.999235:0.02036328)0.999943:0.04134280)1.000000:0.06287945); diff --git a/out3/two-ladders-raxml.ascii b/out3/two-ladders-raxml.ascii new file mode 100644 index 0000000..1b9ff0c --- /dev/null +++ b/out3/two-ladders-raxml.ascii @@ -0,0 +1,42 @@ + + /-root + | + | /-A + | | + | /-| /-A-mutant-1 + | | | | +--| | | | /-A-mutant-2 + | | \-| | + | | | | /-A-mutant-4 + | | | | /-| + | | \-| | | /-A-mutant-5 + | | | | \-| + | | | | | /-A-mutant-6 + \-| | | \-| + | \-| | /-A-mutant-7 + | | \-| + | | | /-A-mutant-8 + | | \-| + | | \-A-mutant-9 + | | + | \-A-mutant-3 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/out3/two-ladders-raxml.newick b/out3/two-ladders-raxml.newick new file mode 100644 index 0000000..4c06f34 --- /dev/null +++ b/out3/two-ladders-raxml.newick @@ -0,0 +1 @@ +((B-mutant-7:0.010094,((B-mutant-5:0.009990,(B-mutant-4:0.010464,(B-mutant-3:0.000001,((B-mutant-1:0.000001,((root:0.003289,(A:0.000001,(A-mutant-1:0.000001,(A-mutant-2:0.000001,((A-mutant-4:0.000001,(A-mutant-5:0.000001,(A-mutant-6:0.000001,(A-mutant-7:0.000001,(A-mutant-8:0.000001,A-mutant-9:0.052117)99:0.062872)95:0.041340)86:0.020357)89:0.020290)97:0.031398,A-mutant-3:0.009398)100:0.074941)98:0.040967)100:0.062030)100:0.150776)100:0.178443,B:0.009902)54:0.010285)95:0.041120,B-mutant-2:0.000001)98:0.041114)98:0.030431)90:0.042894)100:0.074477,B-mutant-6:0.000001)97:0.041044)70:0.009947,B-mutant-8:0.000001,B-mutant-9:0.040900):0.0; diff --git a/out3/two-ladders.fasta b/out3/two-ladders.fasta new file mode 100644 index 0000000..33f865d --- /dev/null +++ b/out3/two-ladders.fasta @@ -0,0 +1,42 @@ +>root +CATATTGATGCTGCGATTTTACCAACTCAGGTGTAATATAAGATCAGTCACGCTCCTTCCTCGACCCCCTAGACTTTCTTATGTTGACTTAGGGGGACGG +>A +CATATTGATGCTGCGCTGCGACCAACTCAGGTGTAATGTAAGATCAGTCACGCTACTGCCTTGACTCCCTCGACTTTCTGACATTGACTTAGGGGGAGGG +>A-mutant-1 +CATATTGATGCTGCTCTACGAACAACTCAGGTGTAATGTAAGATCAGTCACGCTACTGCGTTCACTCCGTCGACTTTCTGACATTGACTTAGGGGGAGGG +>A-mutant-2 +CATATTGATGCTCCTCTACGAACAACTCAGGTGTAATGTGAGATCCGTCACGCTACTGCGATCACTCCGTCGACTTTCTGACATTGACTTAGGGGGAGGG +>A-mutant-3 +CATATTGATGCTCCTCTTCGAATAACTCAGGTGGAATGTGAGATGCGTCACGCTACTGCGATCTGTCCCTCGACTTTCTGACATTGACTTAGGGGGTGGG +>A-mutant-4 +CATATTGATGCTCCTCTTCGAATAACTCAGGTGTAATATGAGATGCGTCACGCTACTGCGATCTGTCGCTCTACTTTCTGACATTGACTTAGGGGGTGGG +>A-mutant-5 +CATATTGATGCTCCTCTTCGAATAACTCAGGTGTAATATGAGATGCGTCACGCTACTGCGATCTGTCGCTATACTTTCTGCCATTGACTTAGGGGGTGGG +>A-mutant-6 +CATATTGATGCTCCTCTTCGAATAACTCAGGTTTAATATGAGATGCGTCACGCTACTGCGATCTGTCGCTATACTTTCTGCCATTGACTTAAGGGGTGGG +>A-mutant-7 +CATATTGATGCTCCTCTTGGAATAACTCAGGCTTAATATGAGATGCGTCACGCTACTGCGATCTGCCGCTATACTTTCTGCCATTGACTTAAGGTGTGGG +>A-mutant-8 +CTTAGTGATGCTCCTCTTGGAATAACTCAGGCTTAATATGAGATGCTTCACGATACTGCGATCTGCCGCTCTACTTTCTGCCATTGACTTAAGGCGTGGG +>A-mutant-9 +CTTAGTGATGCTCCTCTTGGAATAACTCAGGCTTAGTATGAGATGCTTAACGATACTGCGATCTGCAGTTCTACTTTCTGCCATTGACTAAAGGCGTGGG +>B +CATATTGATGCCCCGATTTTATCAATTCAGGTGTAACATAAGCTCAGTCACGCTCCTGCCTCGAGCGTGTAGACTTTCTCAGGTTGCCTTAGGGGACCGA +>B-mutant-1 +CATATTGATGCCCCAATTTTATCAATTCAGGTGTAACATAAGCTCAGTCACGCTCCTGCCTCGAGCGTGTAGACTTTCTCATGTTGCCTTAGGGGACCGA +>B-mutant-2 +CATATTGATGCCCCAATTTTATCAATTCAGGTGTAACATAGGCTCAGTCACGCTCCTGCCTCGCGCCTGTAGACTTTTTCATGTTGCCTTAGGGGACCGA +>B-mutant-3 +CATATTGATGCCCAAATTTTAGCAATTCAGGTGTAACATAGGCTCAGTCACGCTCCTGCCTCGCGCCTGTAGTCTTGTTCATGTTGCCTTAGGGGACCGA +>B-mutant-4 +CATATTGATCCCCAAATTTTAGCAATTCAAGTGTAACATAGGCTCAGTCACGCTCCTGCTTCGCGCCTGTAGTCTTATTCATGTTGCCTTAGGGGACCGA +>B-mutant-5 +TATATCGATCCCCAAATTTTAGCAATTCAGGTGTAACATAGGCTCAGTCACGCTCCTGCTTCGCTCCTGTAGTCTTATTCATGATGCCTTAGGTGACCGA +>B-mutant-6 +TATATCGATCCCCAAAGTTTAGCAATTCAGGGGTAACAAAAGCTCAGTCACGCTCCTCCCTCGCGCCTGTAGTCTTATTCATGATGGCTTAGGTGACCGA +>B-mutant-7 +TATATCGATGCCCAAAGTATAGCAATTCAGGGGGAACAAAAGCTCAGTCACGCCCCTCCCTCGCGCCTGTAGTCTTATTCATGATGGCTTAGCTGACCGA +>B-mutant-8 +TATATCGATGCCCAAAGTTTAGCAATTCAGGGGGAACAAAAGCTCAGTCACGCCCCTCCCTCGCGCCTGTAGTCTTATTCATGATGGCTTGGCTGACCGA +>B-mutant-9 +TATATCGATGCCAAAAGTTTAGCAATTCAGGGGGAACTAAAGCTCAGTAACGCCCCTCCCTCGCACCTGTAGTCTTATTCATGATGGCTTGGCTGACCGA diff --git a/out4/branchlength_4 b/out4/branchlength_4 new file mode 100644 index 0000000..1c39691 --- /dev/null +++ b/out4/branchlength_4 @@ -0,0 +1,313 @@ +Analysing sample: recombinant-50A1-50B1-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of B is 0.000001. +The support value of B is 98.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 57.000000. +The branchlength of B-mutant-2 is 0.010137. +The support value of B-mutant-2 is 90.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-9 is 0.062127. +The support value of B-mutant-9 is 100.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 97.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 64.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 96.000000. +The branchlength of recombinant is 0.020509. +The support value of recombinant is 49.000000. +The branchlength of A is 0.000001. +The support value of A is 98.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 91.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 91.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 100.000000. +The branchlength of A-mutant-9 is 0.062422. +The support value of A-mutant-9 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 98.000000. +The branchlength of A-mutant-3 is 0.010166. +The support value of A-mutant-3 is 76.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 76.000000. +Analysing sample: recombinant-50A1-50B9-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of A is 0.019597. +The support value of A is 92.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 95.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 96.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 97.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 97.000000. +The branchlength of A-mutant-9 is 0.040842. +The support value of A-mutant-9 is 96.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 96.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-5 is 0.009784. +The support value of A-mutant-5 is 92.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 99.000000. +The branchlength of B is 0.000001. +The support value of B is 79.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 74.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 68.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 52.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 48.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 50.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 45.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 30.000000. +The branchlength of B-mutant-8 is 0.001855. +The support value of B-mutant-8 is 27.000000. +The branchlength of B-mutant-9 is 0.015937. +The support value of B-mutant-9 is 18.000000. +The branchlength of recombinant is 0.263937. +The support value of recombinant is 18.000000. +Analysing sample: recombinant-50A5-50random-raxml.newick +The branchlength of root is 0.004796. +The support value of root is 1.000000. +The branchlength of A is 0.000001. +The support value of A is 98.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 99.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 87.000000. +The branchlength of recombinant is 0.623551. +The support value of recombinant is 61.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 92.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 100.000000. +The branchlength of A-mutant-9 is 0.062816. +The support value of A-mutant-9 is 100.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 83.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 90.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 68.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 96.000000. +The branchlength of B is 0.009968. +The support value of B is 63.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 77.000000. +The branchlength of B-mutant-2 is 0.009697. +The support value of B-mutant-2 is 99.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 92.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 99.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 98.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 94.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 95.000000. +The branchlength of B-mutant-9 is 0.052352. +The support value of B-mutant-9 is 95.000000. +Analysing sample: recombinant-75A1-25B1-raxml.newick +The branchlength of root is 0.021165. +The support value of root is 1.000000. +The branchlength of A is 0.000001. +The support value of A is 1.000000. +The branchlength of B is 0.031278. +The support value of B is 81.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 98.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-9 is 0.041686. +The support value of B-mutant-9 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 97.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 96.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 80.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 100.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 99.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 70.000000. +The branchlength of recombinant is 0.000001. +The support value of recombinant is 72.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 69.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 100.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 84.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 81.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 100.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 98.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 99.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 100.000000. +The branchlength of A-mutant-9 is 0.051711. +The support value of A-mutant-9 is 100.000000. +Analysing sample: recombinant-75A1-25B9-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of A is 0.000001. +The support value of A is 100.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 76.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 77.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 99.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-9 is 0.041791. +The support value of A-mutant-9 is 99.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 99.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 93.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 99.000000. +The branchlength of recombinant is 0.100092. +The support value of recombinant is 99.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 97.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 96.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 95.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 57.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 93.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 99.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 99.000000. +The branchlength of B-mutant-9 is 0.040706. +The support value of B-mutant-9 is 99.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 99.000000. +The branchlength of B is 0.000001. +The support value of B is 99.000000. +Analysing sample: recombinant-75A5-25B5-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 91.000000. +The branchlength of B-mutant-2 is 0.010011. +The support value of B-mutant-2 is 95.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 98.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 87.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 98.000000. +The branchlength of B-mutant-9 is 0.052177. +The support value of B-mutant-9 is 98.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 97.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 99.000000. +The branchlength of B is 0.000001. +The support value of B is 100.000000. +The branchlength of A is 0.000001. +The support value of A is 99.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 98.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 100.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 91.000000. +The branchlength of recombinant is 0.094900. +The support value of recombinant is 77.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 65.000000. +The branchlength of A-mutant-9 is 0.051577. +The support value of A-mutant-9 is 65.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 95.000000. +Analysing sample: two-ladders-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 100.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 88.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 100.000000. +The branchlength of B-mutant-9 is 0.051181. +The support value of B-mutant-9 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 99.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 80.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 98.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 96.000000. +The branchlength of B is 0.000001. +The support value of B is 100.000000. +The branchlength of A is 0.000001. +The support value of A is 100.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 91.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 98.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 85.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 98.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 90.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 82.000000. +The branchlength of A-mutant-9 is 0.062916. +The support value of A-mutant-9 is 82.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 100.000000. diff --git a/out4/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png b/out4/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png new file mode 100644 index 0000000..62a9b66 Binary files /dev/null and b/out4/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png differ diff --git a/out4/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png b/out4/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png new file mode 100644 index 0000000..80a721f Binary files /dev/null and b/out4/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png differ diff --git a/out4/branchlengthplot/recombinant-50A5-50random-raxml.newick.png b/out4/branchlengthplot/recombinant-50A5-50random-raxml.newick.png new file mode 100644 index 0000000..7d1dc0d Binary files /dev/null and b/out4/branchlengthplot/recombinant-50A5-50random-raxml.newick.png differ diff --git a/out4/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png b/out4/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png new file mode 100644 index 0000000..e6d32cb Binary files /dev/null and b/out4/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png differ diff --git a/out4/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png b/out4/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png new file mode 100644 index 0000000..2a2c756 Binary files /dev/null and b/out4/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png differ diff --git a/out4/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png b/out4/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png new file mode 100644 index 0000000..7600955 Binary files /dev/null and b/out4/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png differ diff --git a/out4/branchlengthplot/two-ladders-raxml.newick.png b/out4/branchlengthplot/two-ladders-raxml.newick.png new file mode 100644 index 0000000..a7a1970 Binary files /dev/null and b/out4/branchlengthplot/two-ladders-raxml.newick.png differ diff --git a/out4/minimal_distance_4 b/out4/minimal_distance_4 new file mode 100644 index 0000000..635931b --- /dev/null +++ b/out4/minimal_distance_4 @@ -0,0 +1,36 @@ +Analysing sample: recombinant-50A1-50B1-raxml.newick +The leaf with the biggest minimal distance to another leaf is B-mutant-7, to B-mutant-6. +The leaf with the parental node with a minimal branch bootstrap value is recombinant. + + +Analysing sample: recombinant-50A1-50B9-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to B-mutant-9. +The leaf with the parental node with a minimal branch bootstrap value is B-mutant-9. + + +Analysing sample: recombinant-50A5-50random-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-5. +The leaf with the parental node with a minimal branch bootstrap value is recombinant. + + +Analysing sample: recombinant-75A1-25B1-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-1. +The leaf with the parental node with a minimal branch bootstrap value is root. + + +Analysing sample: recombinant-75A1-25B9-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-1. +The leaf with the parental node with a minimal branch bootstrap value is B-mutant-5. + + +Analysing sample: recombinant-75A5-25B5-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-5. +The leaf with the parental node with a minimal branch bootstrap value is A-mutant-8. + + +Analysing sample: two-ladders-raxml.newick +There is no recombinant in this sample. +The leaf with the biggest minimal distance to another leaf is root, to B. +The leaf with the parental node with a minimal branch bootstrap value is B-mutant-4. + + diff --git a/out4/recombinant-50A1-50B1-phyml.ascii b/out4/recombinant-50A1-50B1-phyml.ascii new file mode 100644 index 0000000..01f3562 --- /dev/null +++ b/out4/recombinant-50A1-50B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-root + | + | /-recombinant + | /-| + | | | /-B + | | \-| + | | | /-B-mutant-1 +--| | \-| + | | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + \-| | /-B-mutant-5 + | \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-8 + | \-| + | \-B-mutant-9 + | + | /-A + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + \-A-mutant-9 diff --git a/out4/recombinant-50A1-50B1-phyml.newick b/out4/recombinant-50A1-50B1-phyml.newick new file mode 100644 index 0000000..c838ddc --- /dev/null +++ b/out4/recombinant-50A1-50B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000000,A-mutant-9:0.06240899,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.01016463,(A-mutant-2:0.01021501,(A:0.00000000,(root:0.00000001,(recombinant:0.02050630,(B:0.00000000,(B-mutant-1:0.00000000,(B-mutant-2:0.01013680,(B-mutant-3:0.00000000,(B-mutant-4:0.00000001,(B-mutant-5:0.00000001,(B-mutant-6:0.00000000,(B-mutant-7:0.00000000,(B-mutant-8:0.00000000,B-mutant-9:0.06211462)1.000000:0.07353474)1.000000:0.07308168)0.997940:0.03064192)1.000000:0.06263771)0.955163:0.01011764)0.999973:0.03104827)0.996599:0.02043983)0.973643:0.01007518)0.999891:0.03097255)0.602014:0.02062386)1.000000:0.07388819)0.887153:0.01020638)1.000000:0.05240254)0.000000:0.00000001)1.000000:0.06325614)1.000000:0.10803978)0.999999:0.05189466)1.000000:0.11915059); diff --git a/out4/recombinant-50A1-50B1-raxml.ascii b/out4/recombinant-50A1-50B1-raxml.ascii new file mode 100644 index 0000000..c960d2f --- /dev/null +++ b/out4/recombinant-50A1-50B1-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | | + | /-| /-B-mutant-1 + | | | | + | | | | /-B-mutant-2 + | | \-| | + | | | | /-B-mutant-5 + | | | | | +--| | | | /-| /-B-mutant-7 + | | \-| | | /-| + | | | | | | | /-B-mutant-8 + | /-| | | \-| \-| + | | | | /-| | \-B-mutant-9 + | | | | | | | + | | | | | | \-B-mutant-6 + | | | \-| | + | | | | \-B-mutant-4 + | | | | + \-| | \-B-mutant-3 + | | + | \-recombinant + | + | /-A + | | + | | /-A-mutant-2 + | | /-| + \-| | \-A-mutant-1 + | | + | | /-A-mutant-8 + | | /-| + \-| /-| \-A-mutant-9 + | | | + | /-| \-A-mutant-7 + | | | + | /-| \-A-mutant-6 + | | | + \-| \-A-mutant-5 + | + | /-A-mutant-3 + \-| + \-A-mutant-4 diff --git a/out4/recombinant-50A1-50B1-raxml.newick b/out4/recombinant-50A1-50B1-raxml.newick new file mode 100644 index 0000000..0f6dca9 --- /dev/null +++ b/out4/recombinant-50A1-50B1-raxml.newick @@ -0,0 +1 @@ +((((((A-mutant-8:0.000001,A-mutant-9:0.062422)100:0.119205,A-mutant-7:0.000001)100:0.051906,A-mutant-6:0.000001)100:0.108098,A-mutant-5:0.000001)98:0.063274,(((root:0.000001,((B:0.000001,(B-mutant-1:0.000001,(B-mutant-2:0.010137,(((B-mutant-5:0.000001,((B-mutant-7:0.000001,(B-mutant-8:0.000001,B-mutant-9:0.062127)100:0.073556)100:0.073101,B-mutant-6:0.000001)97:0.030646)100:0.062659,B-mutant-4:0.000001)64:0.010119,B-mutant-3:0.000001)96:0.031057)90:0.020444)57:0.010076)98:0.030983,recombinant:0.020509)49:0.020630)98:0.073922,A:0.000001)56:0.010208,(A-mutant-2:0.000001,A-mutant-1:0.000001)91:0.010217)100:0.052424)76:0.000001,A-mutant-3:0.010166,A-mutant-4:0.000001):0.0; diff --git a/out4/recombinant-50A1-50B1.fasta b/out4/recombinant-50A1-50B1.fasta new file mode 100644 index 0000000..17336e4 --- /dev/null +++ b/out4/recombinant-50A1-50B1.fasta @@ -0,0 +1,44 @@ +>root +CACGGTTAAAGTTTTCCAGTTGGGCGGTCCCGATGTAGAGCGGATAAAGCCTTGGAGCTGGGCCAGAAACGCCTGGGGGAGGACAGACATATACTAGGGT +>A +CACGGTTAAAGTATTCCAGTTGGGCGGTCCCGATGTAGAGCGGATTAAGCCTCGGAGCCGGGCCAGAAACGCCTGGGGGAGGACAAACGTATACAAGGGT +>A-mutant-1 +CACGGTTAAAGTATTCCAGTTGGGCGGTCCCGATGTAGAGCGGATTAAGCCTCGGAGCCGGGCCAGAAAAGCCTGGGGGAGGACAAACGTATAGAAGGGT +>A-mutant-2 +CACGGTTAAAGTATTCCAGTTGGGCGGTCCCGATGTAGAGCGGATTAAGCCTCGGAGCCGGGCCAGAAAAGCCTGGGGGAGGACAAACGTATAGAAGGGT +>A-mutant-3 +CACGGTTAAAGTATTCCAGTTGGGCTGTCCCGATGTAGAGCGGATGAAGTCTCGGAGCCGGGCCAGAAAAGCCTGGGGGGGGACAAACGTATAAAACGGT +>A-mutant-4 +CACGGTTAAAGTATTCCAGTTGGGCTGTCCCGATGTAGAGCGGATGAAGTCTCGGAGCCGGGCCAGAAAAGCCTGGGGGGGGACAAACGTATACAACGGT +>A-mutant-5 +CACGGTTCAAGTAATCCAGTTGGGCTGTCCCGATGTAGAGCGGATGAAGTCTCATAGCCGGGACAGAAAAGCCTGGGGGGAGACAAACGTATACAACGGT +>A-mutant-6 +CACGGTTCAAGTAATCCTGTCGGGCTGTTCCGAAGTAGATCGGATGAAGTCTCATAGCCGAGATATAAAAGCCTGGGGGGAGACAGACGTATACCACGGT +>A-mutant-7 +CACGGTTCAAGTAATCCTGTCGGGCTGTTCCGAAGTAGATCGGATGAAGTGTCATATCCGAGATATAAAAGTCTGGGCGGAGACAGACGTATACCACAGT +>A-mutant-8 +AACAGTCCAAGTAATCCTGTCGTGTTCTTCCCAAGTTGAGCGGATGAAGTGTCATATCCGACATATAAAAGTCTGGGCGGAGACGGACGTATACCACAGT +>A-mutant-9 +AACACTCCGAGTAAGCCTGTCGTGTTCTTGCCAAGTTGAGCGCATGAAGTGTCATATCCGACATATAAAGGTCTGGGCGGAGACGGACGTATACCACAGT +>B +CACGGTTAAAGTTTTCCAGTTGGGCAGTCCCGATCTAGCGCGGATAAAGCCTTGGAGCTGGGCCAGAAACGACTGGGGGAGGCCAGACATATACTAGGGT +>B-mutant-1 +CACGGTTAAAGTTTTCCAGTTGGGCAGTCCTGATCTAGCGCGGATAAAGCCTTGGAGCTGGGCCAGAAACGACTGGGGGAGGCCAGACATATACTAGGGT +>B-mutant-2 +CACGGGTAAAGTTTTCCAGTTGGGCAGTCCTGATCTAGCGCGGATAAAGCCTTGGAACTGGGCCAGAAACGACTGGGGGAGGCCAGACATAAACTAGGGT +>B-mutant-3 +CACGGGTAAAGTTTTCCATTTGGGCAGTCCTGATCTAGCGCGGATAAAGCCTTGGAACTGGGCCAGAAACGACAGGGGGAGGCGAGACATATACTAGGGT +>B-mutant-4 +CACGGGTAAAGTTTTCCATTTGGGCAGTCCTGATCTAGCGCGGATAAAGCCTTGGAACTGGGCCAGAAACGACAGGGGGAGGCGAGACATATACTAGGTT +>B-mutant-5 +CACGGGTATAGTTTTCCATTTGGGTAGTCCTGAGCTAGTGCGGATAAAGCCTTGGAACTGGGCCAGAAACGACGGGGGAAGGCGAGACATATACTAGGTT +>B-mutant-6 +CACGGGTATAGTTTTCCATTTGGGTAGTCCTGACCTAGTGCGGATAAGGCCTTGGAACTGGTCCAGAAACGACGGGGGAAGGCGAGACATATACTAGGTT +>B-mutant-7 +CACGGGTATAGTTTTCCATTTGGGTAGTTCTGACCTACTGCGGATAAGGCCTCGGAACTGGTCCAGAAACGATGGGGGAATGCAAGACATATGCTAGGTT +>B-mutant-8 +CACGGGTATAGTTTTCCATTTGGGTCGATCTGTCCTACTGAGGATAAGGCCTCGGAACTGGTCCAGAGACGATGGGGGAATGCAAGACATATGCTACGGT +>B-mutant-9 +CACGGGTATAGTTTTCCATTTGAGTCGATCTGTCCTACTGAGGATAAGGCCTGGGAACTTGTCCAGAGACGATGTTGGAATGCAAGACATACGCTACGGT +>recombinant +CACGGTTAAAGTATTCCAGTTGGGCGGTCCCGATGTAGAGCGGATTAAGCCTTGGAGCTGGGCCAGAAACGACTGGGGGAGGCCAGACATATACTAGGGT diff --git a/out4/recombinant-50A1-50B9-phyml.ascii b/out4/recombinant-50A1-50B9-phyml.ascii new file mode 100644 index 0000000..1505d10 --- /dev/null +++ b/out4/recombinant-50A1-50B9-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | /-| + | | | /-A-mutant-1 + | | \-| +--| | | /-A-mutant-2 + | | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + | | \-| + | | | /-A-mutant-5 + \-| \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-9 + | \-| + | \-A-mutant-8 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + | /-recombinant + \-| + \-B-mutant-9 diff --git a/out4/recombinant-50A1-50B9-phyml.newick b/out4/recombinant-50A1-50B9-phyml.newick new file mode 100644 index 0000000..9bbca61 --- /dev/null +++ b/out4/recombinant-50A1-50B9-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00133788,(B-mutant-7:0.00000000,(B-mutant-6:0.00000001,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00000001,(B-mutant-2:0.00000000,(B-mutant-1:0.00000001,(B:0.00000001,(root:0.00000001,(A:0.02029297,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000001,(A-mutant-4:0.00000001,(A-mutant-5:0.00985156,(A-mutant-6:0.00000001,(A-mutant-7:0.00000000,(A-mutant-9:0.04142054,A-mutant-8:0.00000000)0.999919:0.03081961)1.000000:0.06337580)0.999999:0.05271307)0.990449:0.02059700)0.999998:0.05212446)0.999928:0.04140799)0.999948:0.03070533)0.893644:0.02071425)1.000000:0.12522757)1.000000:0.10966893)1.000000:0.09858275)1.000000:0.07527714)1.000000:0.06408468)0.997132:0.02054514)0.999997:0.04182615)1.000000:0.05265530)0.999939:0.03112962)1.000000:0.05184267,(recombinant:0.26783165,B-mutant-9:0.01672803)0.491615:0.01419892); diff --git a/out4/recombinant-50A1-50B9-raxml.ascii b/out4/recombinant-50A1-50B9-raxml.ascii new file mode 100644 index 0000000..722bb39 --- /dev/null +++ b/out4/recombinant-50A1-50B9-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | /-| /-A-mutant-1 + | | | | +--| | \-| /-A-mutant-2 + | | | | + | | | | /-A-mutant-3 + | | \-| | + | | | | /-A-mutant-6 + | | | | | + | | \-| /-| /-A-mutant-9 + \-| | | | /-| + | | | \-| \-A-mutant-8 + | | /-| | + | | | | \-A-mutant-7 + | \-| | + | | \-A-mutant-5 + | | + | \-A-mutant-4 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + | /-B-mutant-9 + \-| + \-recombinant diff --git a/out4/recombinant-50A1-50B9-raxml.newick b/out4/recombinant-50A1-50B9-raxml.newick new file mode 100644 index 0000000..ff36cec --- /dev/null +++ b/out4/recombinant-50A1-50B9-raxml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.015937,(B-mutant-8:0.001855,((B-mutant-6:0.000001,((B-mutant-4:0.000001,(((((root:0.000001,(A:0.019597,(A-mutant-1:0.000001,(A-mutant-2:0.000001,(A-mutant-3:0.000001,(((A-mutant-6:0.000001,((A-mutant-9:0.040842,A-mutant-8:0.000001)96:0.030350,A-mutant-7:0.000001)100:0.062574)97:0.052203,A-mutant-5:0.009784)92:0.020363,A-mutant-4:0.000001)99:0.051446)97:0.040983)96:0.030382)95:0.020937)92:0.123472)79:0.108185,B:0.000001)74:0.097284,B-mutant-1:0.000001)68:0.074398,B-mutant-2:0.000001)52:0.063217,B-mutant-3:0.000001)48:0.020268)50:0.041176,B-mutant-5:0.000001)45:0.051891)30:0.030761,B-mutant-7:0.000001)27:0.050654)18:0.014450,recombinant:0.263937):0.0; diff --git a/out4/recombinant-50A1-50B9.fasta b/out4/recombinant-50A1-50B9.fasta new file mode 100644 index 0000000..e7987f5 --- /dev/null +++ b/out4/recombinant-50A1-50B9.fasta @@ -0,0 +1,44 @@ +>root +AGCCTTCTGTTAGCGCCCGTGCATCTATCAGGTTCGATGCAATGTATAGTCACTCCCCCAGTATGGGCACCGCTGCCCTTAGGAGGAAGGCAGAGGGTCA +>A +AGCTTTCTGTTAGCGTCCGTGCATCGATCAGGTTCGACGCAGTCTATAGTGACTCCCCAGGTATGGGCACCGCTGCCCTTCCGAGTAAAGCAGAGGGTCA +>A-mutant-1 +AGCTTTCTGTTAGCGCCCGTGCATCGATAAGGTTCGATGCAGTCTATAGTGACTCCCCAGGTATGGGCACCGCTGCCCTTCCGAGTAAAGCAGACGGTCA +>A-mutant-2 +AGCTTTCTGTTAGGGCCCGTGCATCGACATGGTTCGATGCAGTCTATAGTGACTCCCCAGGTATGGGCACCGCTGCCCTTCCGAGTAAAGCAGACGGTCA +>A-mutant-3 +AGCTTACTGTTAGGTCCCGCGGATCGACATGGTTCGATGCAGTCTATAGTGACTCCCCAGGTATGGGCACCGCTGCCCTTCCGAGTAAAGCAGACGGTCA +>A-mutant-4 +AGCTTACTGTTAGGACCCGCGGATCGACATGGTTCGATGCAGTCGATTGTGACTCCCCATGTATGGGCACCGCTGCCCTTCCGAGTAAAGCAGACGTTCA +>A-mutant-5 +AGCTTACTGTTAGGAACCGCGGATCGACATGGTTCGATCCAGTCGATTGTGACTCCCCATGTATGGGCACCGCTGCCCTTCCGCGTAAAGCAGACGTTCA +>A-mutant-6 +AGCTTACTGTTAGGAACCGCGGATCGGCAAGGTTCGATCCAGTCGATTGTTACTCCCCATGAATGGGCACCGCTGCCCTTCCGAGTAAAGCAGACGATCA +>A-mutant-7 +AGCTTACTGTTAGAACGCGCGGAGCGGCAAGGTTCGATCCAGTCGATTGTTACTCCCCATGAACGGGCACCGCTGCCCTTCCGACTAAAGCAGACGATCA +>A-mutant-8 +AGCTTACTGTTAGAACGCGCGGAGCGGCAAGGTTCGATCCAGTCGGTTGTTACTCCCCATGAACGGGCACCGCTGCCCTTCTGACTAAAGCAGACGATAA +>A-mutant-9 +AGCTTACCGTTAGAACGCGCGGAGCGGCAAGGTTCGATCCAGTCGGTTGTTACTCCCTATGAAGGGGCACCGCTGTCCTTCTGACTAAAGCAGACGATAA +>B +AGCCTACTGTTAGCGCCCTCGCATCTATCAGGTTCGAAGCAATGTATAGTCACGCCCTCAGTTTGGGCAATGCTGACCTTAGGAGGAAGGCAGAGGGTCA +>B-mutant-1 +AGCCTACTGTTAGCGCCCTCGCAGGTAGCAGGTTCGAAGCAATGTATAATCACGCCCGCAGTGTGGGCAATCCTGACCTTTGGAGGAAGGCAGAGCGTCA +>B-mutant-2 +AGCCTACTGTTAGCGCCCTCGCACGTAGCAGGTTCGAAGCAATGTACAATTACGCACGCAGAGTGGGCAATCCTGACCTTTGGGTGAAGGCAGAGCGTCA +>B-mutant-3 +AGCCTAGTGTTAGCGCCCTAGCACGTCGCAAGTTCGAAGCAATGTACAATTACGCACGAAGAGTGGGCAATCCTGACCTTTGGGTGAAGGCAGAGCGTCG +>B-mutant-4 +AGCCTAGTGTTAGCGCCCTAGCACGTCGCAAGTTCGAAGCAATGTACAATTACGCACGAAGTGTGGGCAATCCTGACCTTTGGGAGAAGGCAGAGCGTCG +>B-mutant-5 +AGCCTAGTTTTAGCGCCATAGCACGTCGCAAGTTCGAAGCAATGTACAATTACGCACGAAGTGTGGGCAATCCTGACCTTTGGGAGAAGGCAGAGCGTGC +>B-mutant-6 +AGCCTAGTTTTAACGCCATAGCACGTCGCAAGTTCGAGGCAATGTACACTTATGCACGAAGTGTGGGCAATCCGGACCTTTGGGAGAAGGCAGAGCGTGC +>B-mutant-7 +AGCCTAGTTTTAACGCCATGGCACGACGCAAGTTCGCGGCAATGTACACTTATGCACGAAGTGTGGGCAATCCGGACCTTTGGGAGAAGGCAGAGCGTGC +>B-mutant-8 +AGCCTAGTTTTAACGCCATGGCACGATGCAGGTTCGCGGCAACGTACACTTATGCACGAAGTGTGGGCAATCCGGACCTTTGGGAGTAGGCAAAGCGTGC +>B-mutant-9 +AGCCTAGTTTTAACGCCATGGCACGATGCAGGTTCGCGACAAAGTACACTTGTGCACGAAGTGTGGGCAATCCGGACCTTTGGGAGTAGGCAAAGCGTGC +>recombinant +AGCTTTCTGTTAGCGCCCGTGCATCGATAAGGTTCGATGCAGTCTATAGTTGTGCACGAAGTGTGGGCAATCCGGACCTTTGGGAGTAGGCAAAGCGTGC diff --git a/out4/recombinant-50A5-50random-phyml.ascii b/out4/recombinant-50A5-50random-phyml.ascii new file mode 100644 index 0000000..1bdad52 --- /dev/null +++ b/out4/recombinant-50A5-50random-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| +--| | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + \-| \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-8 + | \-| + | \-B-mutant-9 + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-recombinant + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/out4/recombinant-50A5-50random-phyml.newick b/out4/recombinant-50A5-50random-phyml.newick new file mode 100644 index 0000000..4278a79 --- /dev/null +++ b/out4/recombinant-50A5-50random-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.06281089,A-mutant-8:0.00000001,(A-mutant-7:0.00000001,(A-mutant-6:0.00000001,(recombinant:0.62304720,(A-mutant-5:0.00000000,(A-mutant-4:0.00000001,(A-mutant-3:0.00000000,(A-mutant-2:0.00000001,(A-mutant-1:0.00000000,(A:0.00000000,(root:0.00959724,(B:0.00996970,(B-mutant-1:0.00000001,(B-mutant-2:0.00969680,(B-mutant-3:0.00000000,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000000,(B-mutant-7:0.00000000,(B-mutant-8:0.00000000,B-mutant-9:0.05234929)0.999969:0.03099427)1.000000:0.04181005)0.999939:0.03097607)1.000000:0.05229931)1.000000:0.06288423)0.995727:0.03116911)1.000000:0.06348635)1.000000:0.05183648)0.977757:0.02156547)1.000000:0.08550826)1.000000:0.09553814)1.000000:0.06241023)0.999909:0.03036968)0.937098:0.02018386)1.000000:0.08446878)0.508862:0.02006995)0.518754:0.02062422)0.999627:0.04103082)1.000000:0.11993796); diff --git a/out4/recombinant-50A5-50random-raxml.ascii b/out4/recombinant-50A5-50random-raxml.ascii new file mode 100644 index 0000000..6b103c1 --- /dev/null +++ b/out4/recombinant-50A5-50random-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | | /-A-mutant-1 + | | | + | /-| | /-A-mutant-3 +--| | | | | + | | | | | /-recombinant + | | | | | | + | | \-| | /-| /-A-mutant-7 + | | | /-| | | /-| + | | | | | | | | | /-A-mutant-8 + | | | | | | \-| \-| + | | | | | /-| | \-A-mutant-9 + \-| | | | | | | + | \-| | | | \-A-mutant-6 + | | \-| | + | | | \-A-mutant-5 + | | | + | | \-A-mutant-4 + | | + | \-A-mutant-2 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/out4/recombinant-50A5-50random-raxml.newick b/out4/recombinant-50A5-50random-raxml.newick new file mode 100644 index 0000000..d8c2737 --- /dev/null +++ b/out4/recombinant-50A5-50random-raxml.newick @@ -0,0 +1 @@ +(B-mutant-5:0.000001,(B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-8:0.000001,B-mutant-9:0.052352)95:0.030995)100:0.041812)94:0.030977,((B-mutant-3:0.000001,(((((A:0.000001,(A-mutant-1:0.000001,((A-mutant-3:0.000001,(((recombinant:0.623551,((A-mutant-7:0.000001,(A-mutant-8:0.000001,A-mutant-9:0.062816)100:0.119957)92:0.041035,A-mutant-6:0.000001)83:0.020603)61:0.020102,A-mutant-5:0.000001)90:0.084484,A-mutant-4:0.000001)68:0.020185)87:0.030372,A-mutant-2:0.000001)96:0.062417)99:0.095551)98:0.085523,root:0.009592)63:0.021574,B:0.009968)77:0.051841,B-mutant-1:0.000001)99:0.063490,B-mutant-2:0.009697)92:0.031169)99:0.062886,B-mutant-4:0.000001)98:0.052301):0.0; diff --git a/out4/recombinant-50A5-50random.fasta b/out4/recombinant-50A5-50random.fasta new file mode 100644 index 0000000..b1b78bc --- /dev/null +++ b/out4/recombinant-50A5-50random.fasta @@ -0,0 +1,44 @@ +>root +GTTCTGAGAGACGTGTAGCAGATTACGGACCTACCCGCCGCAGCACCGGATCATAGCCTAAGGACCAAGTAGTTTTGGAATCATGTTAGGAGCGCTGGTC +>A +ATTCTCAGAGACGTGTAGCAGGTCACGGACCAACCCGCCGAAGCACCTGATCGTAGCCTAAGGACCAAGTAATTTTGGAATCATGTTAGGAGCGCTGGTC +>A-mutant-1 +ATTCTCAGAGACGTGAAGCAAGTCACGGACCATCCCGCCGAACCAGCTGATCGTAGCCAAAGGACCACGTAAATTTGGAATCATGATAGGAGCGCTGGTC +>A-mutant-2 +ACTCTCAGAGACGTGAAGCAAGTAACGGACCATCCCGCCGAACCAGCTAATCGTAGCCAAAGGACCACGCAAATTTGGAATCATCATAGGAGCCCTGGTC +>A-mutant-3 +ACTCTCAGAGACGTGAAGCAAGTAACGGACCATCCCGCCGAACTAGCTAATCGTAGTCAAAGGACCACGCAGATTTGGAATCATCATAGGAGCCCTGGTC +>A-mutant-4 +ACTCTCAGAGACGTGAAGCAAGTAACGGACCATCCCGCCGAACTAGCTAATCGTAGTCAAAGGACCACGGAGATTTGGAATCATCATAGGAGCCCTGTTC +>A-mutant-5 +ACTCTCAGACACGTGAAGCAAGTCACGGACCATACCGCCGAACTAGCCAATCGTAGTCAATGGGCCACGTAGATTTGGAATCATCATAGAAGCCCTGTTC +>A-mutant-6 +ACTCTCAGCCACGTGAAGCAAGTCACGGACCATACCGCCGAACTAGACAATCGTAGTCAATGGGCCACGTAGATTTGGTATCATCATAGATGCCCTGTTC +>A-mutant-7 +TCTCTCAGCCACGTGAAGCAAGTCACGGACCATACCGCCGAACTATACAATCGCAGTCAACGGGCCACGTAGATTTGGTATCATCATAGATGCCCTGTTC +>A-mutant-8 +TCTCTCAGCCACGTGAAGAAAGTCACGGAACCTACCGCCGAACTATACCATCGCAGTCACAGGGCTACGTAGATTTGGTCTCGTCAGAGAAGCCCTGTTC +>A-mutant-9 +TCTCTCAGCAACGTGAAGAAAGTCAGGGAACCTACCGCCGAACTGTATCATCGCAGTCACAGGGCTACGTAGATTGGGTCTCGTTAGAGAAGCCCTGTTC +>B +GTTCTGAGATACGTGTAGCAGATTACGGACCTACCCGCCGCAGCACCGGATCATAGCCTAAGGACCAAGTAATTTTGGAATCATGTTAGGAGCGCGGATC +>B-mutant-1 +GTTCTGAGATACGTGTAGCAGATTCCGGACCTGCCCGCCGAAGCACCGGATCATAGCCTAAGGACCAAGTAATTTTGGAGTCATATTAGGAGCGCGGGTC +>B-mutant-2 +ATTCTCAGTTACATGTAGCAGGTTCCGGACCTGCCCGCCGAAGCACCGGATCATAGCCTAAGGACCAAGTAATTGTGGAGTCATATTAGAAGCGCGGGTC +>B-mutant-3 +ATTCTCAGTTACGTGTAGCAGGTTCCGGACCTGCCCGCCGAAGCACCGGATCATAGCCTAAGGACCAAGTATTTGCGGAGTCATTTTAGAAGCGCGGGTC +>B-mutant-4 +ATTCCCAGTTACGTGTAGCAGGTTCCGGACCTGCCCGCCGAAGCACTGGATCATAGCCTAAGGACCAACTACCTGCGGAGTCAATTTAGAAGCGCGGGTC +>B-mutant-5 +ATTCCCAGTTACGTGTAGCAGGTTCCGGCCCTGCCCGTCGAAGCACTAGATCATAGCCTAAGGCCCAACTACCTGCGGAGTCAATTTAGCAGCGCGGGTC +>B-mutant-6 +ATTCCCAGTTACGTGTAGCAGGTTCCGGCCCTGCCCGTCGAAGCACTAGATCATAGCCTAAGGCCCTACTACCTGCGGAGTCAATTTTGCGGCGCGGGTC +>B-mutant-7 +ATTCCCAGTTACGTGTAGAAGGTTCCGGCCGTGCCCGTCGAAGCACTAGATCATAGCCTAAGTCCCTACTACCTGCGGAGTCATTTTTGCGGCGCGGGTC +>B-mutant-8 +ATTCCCAGTTACGTGTAGAAGGTTCCGGCCGTGCCACTCGAAGCACTAGATCATAGCCTAAGTCCCTACCACCTGCGGAGTCATTTTTGCGGCGCGGGTC +>B-mutant-9 +ATTCCCAATTACGTGTAGAAGGTTCCGGCCGTGCCACTCTAAGCACTAGATCATAGCCTAAGTCCCTGCCACCTGCGTAGTTATTTTTGCGGCGCGGGTC +>recombinant +ACTCTCAGACACGTGAAGCAAGTCACGGACCATACCGCCGAACTAGCCAATTGACGATTTGACCCGCGCACCTGAGCCTGACCTAGTTCGTATCGCTACT diff --git a/out4/recombinant-75A1-25B1-phyml.ascii b/out4/recombinant-75A1-25B1-phyml.ascii new file mode 100644 index 0000000..74a1999 --- /dev/null +++ b/out4/recombinant-75A1-25B1-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | +--| | /-recombinant + | | /-| + | | | | /-B + | | | \-| + | | | | /-B-mutant-1 + \-| | \-| + | | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + \-| | /-B-mutant-5 + | \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-9 + | \-| + | \-B-mutant-8 + | + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + \-A-mutant-9 diff --git a/out4/recombinant-75A1-25B1-phyml.newick b/out4/recombinant-75A1-25B1-phyml.newick new file mode 100644 index 0000000..6ec8e47 --- /dev/null +++ b/out4/recombinant-75A1-25B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000001,A-mutant-9:0.05173878,(A-mutant-7:0.00000001,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,((A:0.00000001,root:0.04234234)0.998277:0.04314301,(recombinant:0.00000001,(B:0.03128579,(B-mutant-1:0.00000000,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000001,(B-mutant-7:0.00000000,(B-mutant-9:0.04169716,B-mutant-8:0.00000000)0.999999:0.04201623)0.999999:0.04207341)0.999984:0.03157586)0.999093:0.02092009)0.999936:0.03163851)1.000000:0.05357206)0.999999:0.04223839)0.000000:0.00000001)1.000000:0.11125870)1.000000:0.08816934)0.581543:0.00938986)1.000000:0.10950790)0.993267:0.02018281)0.997506:0.02019362)1.000000:0.06306365)0.999995:0.04180251)1.000000:0.06340595)1.000000:0.07401033); diff --git a/out4/recombinant-75A1-25B1-raxml.ascii b/out4/recombinant-75A1-25B1-raxml.ascii new file mode 100644 index 0000000..d6ae33e --- /dev/null +++ b/out4/recombinant-75A1-25B1-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | | /-B + | | | +--| | | /-B-mutant-4 + | | | | + | | | | /-B-mutant-8 + | | | | /-| + | | | /-| /-| \-B-mutant-9 + | | /-| | | | | + \-| | | | | /-| \-B-mutant-7 + | | | | | | | + | | | /-| \-| \-B-mutant-6 + | | | | | | + | | | | | \-B-mutant-5 + | /-| | /-| | + | | | | | | \-B-mutant-3 + | | | \-| | + | | | | \-B-mutant-2 + | | | | + \-| | \-B-mutant-1 + | | + | \-recombinant + | + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + \-A-mutant-9 diff --git a/out4/recombinant-75A1-25B1-raxml.newick b/out4/recombinant-75A1-25B1-raxml.newick new file mode 100644 index 0000000..b5ce255 --- /dev/null +++ b/out4/recombinant-75A1-25B1-raxml.newick @@ -0,0 +1 @@ +((A-mutant-7:0.000001,((A-mutant-5:0.000001,((A-mutant-3:0.000001,(A-mutant-2:0.000001,(A-mutant-1:0.000001,(((B:0.031278,((((B-mutant-4:0.000001,((((B-mutant-8:0.000001,B-mutant-9:0.041686)100:0.042007,B-mutant-7:0.000001)97:0.042064,B-mutant-6:0.000001)96:0.031572,B-mutant-5:0.000001)80:0.020919)98:0.031633,B-mutant-3:0.000001)100:0.053561,B-mutant-2:0.000001)99:0.042229,B-mutant-1:0.000001)70:0.000001)81:0.111202,recombinant:0.000001)72:0.088120,(root:0.042330,A:0.000001)35:0.043119)69:0.009391)100:0.109430)84:0.020172)81:0.020183,A-mutant-4:0.000001)100:0.063031)98:0.041787,A-mutant-6:0.000001)99:0.063378)100:0.073965,A-mutant-8:0.000001,A-mutant-9:0.051711):0.0; diff --git a/out4/recombinant-75A1-25B1.fasta b/out4/recombinant-75A1-25B1.fasta new file mode 100644 index 0000000..d1b58c4 --- /dev/null +++ b/out4/recombinant-75A1-25B1.fasta @@ -0,0 +1,44 @@ +>root +GTCCGAGTTACCCGAGAATCTGCTGCCTTCTGTTATCGATCCGCCCCCATCCAGTCACGACCTCGCGCTGAGTCGTGAGTTTTCCGAGTCGTCTTAATCG +>A +GACCGAGTTACCCGAGAATCTGCTGCCTTCTGTTATCGATCCGCCCCCAGCCAGTCACGACCTCGCGCTGAGTCGTGGGTTTTCCGAGTAGTCTTAATCG +>A-mutant-1 +GACCGAGTTACCCGAGAATCTGCTGCCTTCCGTTATAGATGCGCCCCCAGCCAGTCGCGACCTCGCGCTGAGTCGTGGGTTATCCGAGTAGTCTTAATCG +>A-mutant-2 +GACCGAGTTACCCGAGAATCTGCTGCCTTCCGTGATAGATGCGCCCCCAATCAGTCGCGACGTCGCGGTGAGTGGTGCGTTATCCGGGTAGTCTTCAACG +>A-mutant-3 +GACCGAGTTACCCGAGAATCTGCTGCCTTCCGTGATAGATGCGCCCCCAATAAGTCGCGACGTCGCGGTCAGTGGTGCGTTATCCGGGTAGTCTTCAACG +>A-mutant-4 +GACCGAGTTACCCGAGAATCTGCTGCCTTCCGTGATAGATGCGCCCCCAATAAGTCGCGACGTCGCGGTCAGTGGTGCGTTATCCGGGTAGCCTTCAGCG +>A-mutant-5 +GACCGAGTTACCCGAGAATCTGCTGCCTTCCCTGATCGATGCGCACCCAATACGTCGCCACGTCGCGGTCAGTGGTGCGTTATCCGGTTAGCCTTCAGCG +>A-mutant-6 +GACCGAGTTACCCGAGAATCTTCTGCCTTCCCTCATCGATGCGCACCCAATACGTAGTCACGTCGCGGTCAGTGGTGCGTTATCCGGTTAGCCTTCAGCG +>A-mutant-7 +GACCGAGTGACCCGAGAATGTTCCGCCGTCCCTCATCGATGCGCACCCAATACGTAGTCACGCCGCGGTCGGTGGTGCGTTATCCGGTTAGCCTTCAGCG +>A-mutant-8 +GGCCGAATGACCCGAGAATGTTCCGCCGTCCCTAATCGATGCGCACCCAATACGTGGTCACGCCGCCGTCGGTGGTGAGTTATCCGATTAGCCTTCAGCG +>A-mutant-9 +GGACGAATGACACGAGACTGTTCCGCCGTCCCTGATCGATGCGCACCCAATACGTTGTCACGCCGCCGTCGGTGGTGAGTTATCCGATTAGCCTTCAGCG +>B +GTCCTAGTTACCCGAGAGTCTGTTGCCTTCTGTGATCGATACGCCCCCATCCAGTACCGACCTCGCGCTGAGTCGTGAGGTTTCCTAGACGTCTAAATCG +>B-mutant-1 +GTCCTAGTTACCCGAGAGTCTGTTGCCTTCTGTGATCGATACGCCCCCATCCAGTCCCGACCTCGCGCTGAGTCGTTAGGTTTTCTAGACGTCTAAATCG +>B-mutant-2 +GTCCTAGTTAGCCGAGAGTCTGTTGCCTTCTGTGATCCATACGCCCCCATCCAGTCCCGACCTCGCGCAGAGTCGTTAGGTTTTCTAGACGTCCAAATCG +>B-mutant-3 +GTCCTAGTTAGCAGAGAGTCTGTTGCCTTCTGCCATCCATTCGCCCCCCTCCAGTCCCGACCTCGCGCAGAGTCGTTAGGTTTTCTAGACGTCCAAATCG +>B-mutant-4 +GTCCTAGTTAGCAGAAAGTCTGTTGCCTTCTGCCATCCATTCGCCCCCCTCCAGTCCCGACCTCGCGCACAGTCGTTAGGTTTTCTAGACGTCCAAGTCG +>B-mutant-5 +GTCCTAGTTAGCAGAAATTCTGTTGCCTTATGCCATCCATTCGCCCCCCTCCAGTCCCGACCTCGCGCACAGTCGTTAGGTTTTCTAGACGTCCAAGTCG +>B-mutant-6 +GTCCTAGTTAGCAGAAATGGTGTTGCCATATGCCATCCATTCGCCCCCCTCCAGTCCCGACCTCGCGCACAGTCGTTAGGTTTTCTAGACGTCCAAGTCG +>B-mutant-7 +GTCCTAGTTAGCAGAAATGGTGTTACCATATGCCATCCATTCGCCCCCCTCCAGTCTCGACCTCGCGCATAGTCGTTAGGTGTTCTAGACGTCCAAGTCG +>B-mutant-8 +GTCCTAGTTAGCGGAAATGGTGTTACCATATGCCATCCATTCGCCCCCCTCCAGTCTCGACCTTGCGCATAGTCGTTAGGTGTTCTAGACGTCCAACACG +>B-mutant-9 +GTGCTAGTTAGCGGAAATGGTGTTACTAGATGCCATCCAATCGCCCCCCTCCAGTCTCGACCTTGCGCATAGTCGTTAGGTGTTCTAGACGTCCAACACG +>recombinant +GACCGAGTTACCCGAGAATCTGCTGCCTTCCGTTATAGATGCGCCCCCAGCCAGTCGCGACCTCGCGCTGAGTCGTTAGGTTTTCTAGACGTCTAAATCG diff --git a/out4/recombinant-75A1-25B9-phyml.ascii b/out4/recombinant-75A1-25B9-phyml.ascii new file mode 100644 index 0000000..3761146 --- /dev/null +++ b/out4/recombinant-75A1-25B9-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | /-| + | | | /-recombinant + | | \-| + | | | /-A-mutant-1 +--| | \-| + | | | /-A-mutant-2 + | | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + | | \-| + \-| | /-A-mutant-5 + | \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-8 + | \-| + | \-A-mutant-9 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/out4/recombinant-75A1-25B9-phyml.newick b/out4/recombinant-75A1-25B9-phyml.newick new file mode 100644 index 0000000..16e5f81 --- /dev/null +++ b/out4/recombinant-75A1-25B9-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.04075532,B-mutant-8:0.00000000,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00000000,(B-mutant-2:0.00000000,(B-mutant-1:0.00000001,(B:0.00000001,(root:0.00000001,(A:0.00000001,(recombinant:0.10017412,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000000,(A-mutant-4:0.00000001,(A-mutant-5:0.00000001,(A-mutant-6:0.00000000,(A-mutant-7:0.00000001,(A-mutant-8:0.00000000,A-mutant-9:0.04182977)0.999994:0.04151659)0.999320:0.03085402)1.000000:0.12082509)0.999989:0.04179460)1.000000:0.05259099)1.000000:0.05258709)0.999140:0.02055014)0.827471:0.01957892)0.999977:0.05479488)1.000000:0.14581486)1.000000:0.10918009)0.999966:0.05198289)1.000000:0.06250767)0.999962:0.03061440)1.000000:0.04120829)0.970722:0.01009618)0.997905:0.02038828)1.000000:0.07373617)1.000000:0.09578359); diff --git a/out4/recombinant-75A1-25B9-raxml.ascii b/out4/recombinant-75A1-25B9-raxml.ascii new file mode 100644 index 0000000..02f3659 --- /dev/null +++ b/out4/recombinant-75A1-25B9-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | | /-A-mutant-1 + | | | + | | /-| /-A-mutant-2 + | | | | | + | /-| | \-| /-A-mutant-3 + | | | | | | +--| | | | \-| /-A-mutant-4 + | | | | | | + | | | | | | /-A-mutant-6 + | | | | \-| | + | | \-| | /-| /-A-mutant-9 + | | | | | | /-| + | | | | | \-| \-A-mutant-8 + | | | \-| | + | | | | \-A-mutant-7 + | | | | + | | | \-A-mutant-5 + \-| | + | \-recombinant + | + | /-B-mutant-1 + | | + | | /-B-mutant-3 + | | /-| + | /-| | | /-B-mutant-4 + | | | | \-| + | | | | | /-B-mutant-5 + | | | | \-| + | | | | | /-B-mutant-6 + | | \-| \-| + | | | | /-B-mutant-7 + \-| | \-| + | | | /-B-mutant-8 + | | \-| + | | \-B-mutant-9 + | | + | \-B-mutant-2 + | + \-B diff --git a/out4/recombinant-75A1-25B9-raxml.newick b/out4/recombinant-75A1-25B9-raxml.newick new file mode 100644 index 0000000..8d96a3f --- /dev/null +++ b/out4/recombinant-75A1-25B9-raxml.newick @@ -0,0 +1 @@ +((B-mutant-1:0.000001,((B-mutant-3:0.000001,(B-mutant-4:0.000001,(B-mutant-5:0.000001,(B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-8:0.000001,B-mutant-9:0.040706)99:0.095700)99:0.073672)93:0.020364)57:0.010084)95:0.041166)96:0.030578,B-mutant-2:0.000001)99:0.062435)97:0.051916,((A:0.000001,((A-mutant-1:0.000001,(A-mutant-2:0.000001,(A-mutant-3:0.000001,(A-mutant-4:0.000001,((A-mutant-6:0.000001,((A-mutant-9:0.041791,A-mutant-8:0.000001)99:0.041473,A-mutant-7:0.000001)93:0.030820)100:0.120740,A-mutant-5:0.000001)99:0.041750)99:0.052530)100:0.052536)77:0.020528)76:0.019571,recombinant:0.100092)99:0.054729)100:0.145706,root:0.000001)99:0.109088,B:0.000001):0.0; diff --git a/out4/recombinant-75A1-25B9.fasta b/out4/recombinant-75A1-25B9.fasta new file mode 100644 index 0000000..18aa558 --- /dev/null +++ b/out4/recombinant-75A1-25B9.fasta @@ -0,0 +1,44 @@ +>root +AACGGGAAATCCTCCCTTCGTGACTTTCTTAGGTAAGTAGGCGAAAGATGTTGTCCGGGCTGTGCGAGATTGCGCTTTGTTGGATTTGGTATACGAATTG +>A +AACACGAAATTCTCCCTTCGTGACTTTCTTGCGTAAGGTGGCGAAAGATGTTGTCCGGGTTGTGAGGGAATGCGCTTTGTTGGATCTGATATACGAATTG +>A-mutant-1 +AACACGAAATTGTCCCTTCGTGAGTTTCTTGCGTAAGGTGCCGATAGATATTGTCCGGGTTGTGAGGGAATGCGCTTTGTTGGATCTGACATACGAATAG +>A-mutant-2 +AACACGAAAATGTCCCTTCGTGAGTTTCTTGCGTAAGGTGCCGATAGATATTGTCCGGGTTGTGAGGGAATGCGCTTTGTTGGATCTGACATACGAAAAG +>A-mutant-3 +AACACGAAAATGTCCCTTTGGGAGTTTCTTGCGTAAGGTGCCGATCGATATTGTCCGGGTTGTGAGGGAATGCGCTTTGTTGGATCTGACATACTCAAAG +>A-mutant-4 +AACACGAAAGTGTCCCTTTGGCAGTTTCTTGCGTAAGGTGCCGATCGATATTGTCCGGGTTTTGAGGGAATGGGATTTGTTGGATCTGACATACTCAAAG +>A-mutant-5 +AACACGAAAGTGTCCCTTTGGCAGTTTCTTGCGTAAGGTGCCGATCGATATTGTCCCGGTTTTGAGGGAATGGGATTTGTTGTATTAGACATACTCAAAG +>A-mutant-6 +AACATGAAAGCGTCCCGTGGCCCTTACCTTGCGTAAGGTGCCGATCGATGTTGTCCCGGTTTTGAGGGAATGGGATTTGTTGTATTAGACATACTAAAAG +>A-mutant-7 +AACATGGAAGCGTCCCGTGGCCCTTACCTTGCGTCAGGTGCCGATCGATGTTGTCCCGGTTTTGAGGGAATGGGATGTGTTGTATTAGACATACTAAAAG +>A-mutant-8 +AACATGGAAGCGTCCCGTGGCCCTTACCTTGTGTGAGGTGCCGATCGAAGTTGTCCCGGTTTTGAGGGATTGGGATGTGTTGTATTAGACATACTAAAAG +>A-mutant-9 +AACATGCAAGCGTCCCGTGGCCCTTACCTTGTGTGAGGTGCCGATCGAAGTTGTTCCGGTTTTGAGGGTTTGGGAGGTGTTGTATTAGACATACTAAAAG +>B +GCCGGGACATCCCCCCTTCGTGACTTTCTTAGGTGAGTAGGCGAAAGATGTTGTCCGGGCTGGGCGAGTTTGCGCTTAGTTCGACTTGGTATACGAATTG +>B-mutant-1 +GCCGGCACATCCCCCCTTCGTGACTTTCTTAGGTGCGTAGGCGAAAGATGTTGTCAGGGCTGCGCGAGTTTGCGCTTAGTACGACTTGGTATACGAATTG +>B-mutant-2 +GCCGGCACATCCCCCCTGCGTGACTATCTTAGGTGCGTAGGCGAAAGATGTTATCAGGGCTGCGCGAATTTGCGCTTAGTAAGATTTGGTATACGAATTG +>B-mutant-3 +GCCGGCACATCCCCCCTGCGTGACTATCTTAGGTGCGTAGGCAAAAGATGTTATCAGGGTTGCGCGAATTTGCGGTTAGTAAGATTTGGTATACGAATTG +>B-mutant-4 +GGCGGCACATCCCCCCTGCGTGACTATCTTAGGTGCGTAGGCAAAAGATGTTATCAGGGTTGCGCGAAATTGCGGTTAGTAAGATTTGATATACGCATTG +>B-mutant-5 +GGCGGCACATCCCCCCTGCGTGACTATCTTAGGTGTGTAGGCAAAAGATGTTATCAGGGTTGCGCGAAATTGCGGTTAGTAAGATTTGATATACGCATTG +>B-mutant-6 +GGCGGCACCTCCCCCCTGCGTGACTATCTTAGGTGTGTAGGCAAAAGATGTTATCAGGGTTGCGAGAAATTGCGGTTAGTAAGATTTGATATACGCATTG +>B-mutant-7 +GGCGGCACCTCCCCCCTGCGTGACCATCTTAGGAGTGTAGGCAAAAGATGTTATCAGGGTTGAGAGAAATTTCGGGTAGTAAGATTTGATATACACACTG +>B-mutant-8 +AGCGGCCCCTGCCCCCTGCGTGACCGTCTTGGGAGTTTAGGCAAAAGGTGTTATCAGGGTTGAGAGAAATTTCGGCTAGTAAGATTTTATATACACACTG +>B-mutant-9 +AGCGGCCCCTGCCCCCTGCGTGACCGTCTTGGGAGTTTAGGCAAAAGGTGATATCAGGGTTGAAAGAAATATCCGCTAGTAAGATTTTATATACACACTG +>recombinant +AACACGAAATTGTCCCTTCGTGAGTTTCTTGCGTAAGGTGCCGATAGATATTGTCCGGGTTGTGAGGGAATGCGCCTAGTAAGATTTTATATACACACTG diff --git a/out4/recombinant-75A5-25B5-phyml.ascii b/out4/recombinant-75A5-25B5-phyml.ascii new file mode 100644 index 0000000..afa7582 --- /dev/null +++ b/out4/recombinant-75A5-25B5-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | /-| /-A-mutant-1 + | | | | + | | \-| /-A-mutant-2 +--| | | | + | | \-| /-A-mutant-3 + | | | | + | | \-| /-A-mutant-4 + | | | | + | | | | /-A-mutant-6 + | | \-| /-| + \-| | | | /-A-mutant-7 + | | | \-| + | | | | /-A-mutant-9 + | \-| \-| + | | \-A-mutant-8 + | | + | | /-A-mutant-5 + | \-| + | \-recombinant + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/out4/recombinant-75A5-25B5-phyml.newick b/out4/recombinant-75A5-25B5-phyml.newick new file mode 100644 index 0000000..c51f1d3 --- /dev/null +++ b/out4/recombinant-75A5-25B5-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.05256703,B-mutant-8:0.00000000,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00000001,(B-mutant-2:0.01000963,(B-mutant-1:0.00000000,(B:0.00000001,(root:0.00000001,(A:0.00000001,(A-mutant-1:0.00000001,(A-mutant-2:0.00000001,(A-mutant-3:0.00000000,(A-mutant-4:0.00000001,((A-mutant-6:0.00000001,(A-mutant-7:0.00000000,(A-mutant-9:0.05186969,A-mutant-8:0.00000001)0.962311:0.01004187)0.998850:0.04108349)1.000000:0.09543699,(A-mutant-5:0.00000000,recombinant:0.09547739)0.000000:0.00000000)0.999789:0.03027723)0.999999:0.04075550)0.999991:0.04086516)1.000000:0.08499513)0.999986:0.04111190)1.000000:0.07500248)1.000000:0.07399105)0.999853:0.03057765)0.999285:0.03112748)0.999324:0.04269209)0.999977:0.05241697)0.998817:0.02044597)0.999782:0.03097902)1.000000:0.09875183)0.999813:0.04138895); diff --git a/out4/recombinant-75A5-25B5-raxml.ascii b/out4/recombinant-75A5-25B5-raxml.ascii new file mode 100644 index 0000000..1037ec4 --- /dev/null +++ b/out4/recombinant-75A5-25B5-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B-mutant-1 + | | + | /-| /-B-mutant-2 + | | | | + | | | | /-B-mutant-3 + | | \-| | + | | | | /-B-mutant-5 +--| | | | | + | | \-| /-| /-B-mutant-7 + | | | | | /-| + | /-| | | | | | /-B-mutant-8 + | | | | | \-| \-| + | | | \-| | \-B-mutant-9 + | | | | | + | | | | \-B-mutant-6 + | | | | + \-| | \-B-mutant-4 + | | + | \-B + | + | /-A + | | + \-| /-A-mutant-1 + | | + \-| /-A-mutant-2 + | | + | | /-A-mutant-3 + \-| | + | | /-A-mutant-5 + | | | + \-| /-| /-recombinant + | | | | + | | | | /-A-mutant-8 + | | \-| /-| + | | | /-| \-A-mutant-9 + \-| | | | + | \-| \-A-mutant-7 + | | + | \-A-mutant-6 + | + \-A-mutant-4 diff --git a/out4/recombinant-75A5-25B5-raxml.newick b/out4/recombinant-75A5-25B5-raxml.newick new file mode 100644 index 0000000..c76b410 --- /dev/null +++ b/out4/recombinant-75A5-25B5-raxml.newick @@ -0,0 +1 @@ +((A-mutant-5:0.000001,(recombinant:0.094900,(((A-mutant-8:0.000001,A-mutant-9:0.051577)65:0.010018,A-mutant-7:0.000001)100:0.040901,A-mutant-6:0.000001)100:0.094774)77:0.000001)91:0.030219,(A-mutant-3:0.000001,(A-mutant-2:0.000001,(A-mutant-1:0.000001,((((B-mutant-1:0.000001,(B-mutant-2:0.010011,(B-mutant-3:0.000001,((B-mutant-5:0.000001,((B-mutant-7:0.000001,(B-mutant-8:0.000001,B-mutant-9:0.052177)98:0.041157)100:0.097465,B-mutant-6:0.000001)97:0.030788)87:0.020349,B-mutant-4:0.000001)99:0.052080)98:0.042243)95:0.030920)91:0.030480,B:0.000001)100:0.073556,root:0.000001)99:0.074340,A:0.000001)98:0.040953)100:0.084457)100:0.040786)95:0.040668,A-mutant-4:0.000001):0.0; diff --git a/out4/recombinant-75A5-25B5.fasta b/out4/recombinant-75A5-25B5.fasta new file mode 100644 index 0000000..b3d2438 --- /dev/null +++ b/out4/recombinant-75A5-25B5.fasta @@ -0,0 +1,44 @@ +>root +GTACACCACAGAACGGTTTATGAGCGCAGCCCACCGCAACTGGCCCGCTGGTATGTCGAGCGGGGCTCGAACTCCGGTTGCCAAGTCTGGGTACAAATCT +>A +GTACACGGCAGAACGGTTTATCAGCCCAGCCCACCGCAACTCGCCCGCTGGTATGTCGAACGGGGCTCGAACTCCGGTTTCCAAGTCTGGGTACAAATCT +>A-mutant-1 +GTACGCGGCAGAACGGTTTATCAGCCCAGCCCACCGCAACTCGTCCGCTGGTATGTCGAACAGGGCTCGAACTCCGGTTTCCAAGTATGGGTACAAATCT +>A-mutant-2 +GTACGAGGCAGCAAGGTTTATCAGCCCAGCCCACCGCAACTCGTCCGCAGATATGTCGAACAGGCCTCGAACTCTGGTTTCCAAGTATGGGTACAAGTCT +>A-mutant-3 +GTACGAGGCAGCAAGGTTTATCAGCCCAGCCCACCGCAACTCGTGCGCAGATACGTCGAACAGTCCTCGAACTCTGGTTTCCAAGTATGGATACAAGTCT +>A-mutant-4 +GTACGAGGCAGCGAGGTTTATCAGCCCAGCCAACCACAACTCGTGCGCAGATACGTCGAACAGTCCTCGAACTCTGGTTTCCAAGTATGGATACTAGTCT +>A-mutant-5 +GTACGCGGCAGCGAGGTTTATCAGCCCAGTTAACCACAACTCGTGCGCAGATACGTCGAACAGTCCTCGAACTCTGGTTTCCAAGTATGGATACTAGTCT +>A-mutant-6 +GTACGCGGCCGCGAGGTTTATCAACTCAGTTAACCACAACTCGTGCACGGGTACGTCGAACAGTCCTGGAACTCTGGTTTCCAAGTATGTATACTAGGCT +>A-mutant-7 +GAACGCGGCCGCGAGGTTTATCACCTCAGTTAACCACAACTCGTGCACGGGTACGTCGGACAGTCCTGGAACTCTGGTTTCCAAGTATGCATACTAGGCT +>A-mutant-8 +GAACGCGGCCGCGAGGTTTATCACCTCAGTTAACCACAACTCGTGCACGGGTACGTCGGACAGTCCTGGAACTCTTGTTTCCAAGTATGCATACTAGGCT +>A-mutant-9 +GAACTCGGCCGCGAGGTCTATCACCTCAGTTAACCGCAACTCGTGCACTGGTACGTCGGACAGTCCTGGGACTCTTGTTTCCAAGTATGCATACTAGGCT +>B +GTACACCACAGAACGGTTTATGAGCGCAGCCCACCGCAACTGGAATGCTGGTATGTCGAGTGGCGCTCGAACTCCGGTTGCCAAGTATGGGTACAATTCT +>B-mutant-1 +GTACGCCACAGTACGGTTTATGAGCGCAGCCCACCGCAACTGGAATGCTGGTATGTCGAGTGGCGCCCGAACTCCGGTTGCCAAGTATGGGTACAATTCT +>B-mutant-2 +GTACGCCACAGTACGGTTTATGCGCGCAGCCCACCGCAACTGGCATGCTGGTATGTCGAGTGGCGCCCGAACTCCGGTTGCCAAGTATGGGTCCAGTTCT +>B-mutant-3 +GTACGCCACAGTACCGTTTATGAGCGCATCCCACCGCAACTGGCATGCTGGTATGTCGAGTGGCGCCCGAACTGCGGTTGCCAAGTATGGGTCCAGTTCG +>B-mutant-4 +GTACGCCACAGTATCGTTTATGAGCGCACCCCACCGCAACTGGCATGCTGGTATGTCGAGTGGCGCCCGAACTACGGTTGCCAAGTACGGGTCCAGATCG +>B-mutant-5 +GTACGCCACAGTATCGTTTATGAGCGCACCCCACCGCTACTGGCATGCTGGTATGTCGAGTGGCGCCCGAACTACGGTTGCCAAGTACGGGTCCAGATAG +>B-mutant-6 +GTACGCCCCAGTATCGTTTATCAGCGCACCCCACCGCTACTGGCATGCTGGTATGTCGATTGGCGCCCGAACTACGGTTGCCAAGTACGGGTCCAGATAG +>B-mutant-7 +GTACGCCCCAGTATCGTTTACCAGCGCACCCGAGCGCTACTCGCGTTCTGGTATGTCGATTGGCGCCCGAACAACGGTTGCAAAGTACGGGCCCAGATAG +>B-mutant-8 +GTACGCCCCAGTATCGTTTACCAGCGCACCCGAGCGCTACTCGCTTTCTTGTATGTCGATTGTCGCCCGAACAACGGTTGCAAAGTACGGACCCAGATAG +>B-mutant-9 +GTACGCCCCAGTATCGTTTACCAGCGCACCCGAGCGCTACTCGCTTTCTTGTATGTCGATTGTCGGCTGCACAACGGTTGCAAAGTACGGACCAAGATTG +>recombinant +GTACGCGGCAGCGAGGTTTATCAGCCCAGTTAACCACAACTCGTGCGCAGATACGTCGAACAGTCCTCGAACTCTGGTTGCCAAGTACGGGTCCAGATAG diff --git a/out4/two-ladders-phyml.ascii b/out4/two-ladders-phyml.ascii new file mode 100644 index 0000000..5d2ef4e --- /dev/null +++ b/out4/two-ladders-phyml.ascii @@ -0,0 +1,42 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| +--| | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + \-| \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-9 + | \-| + | \-B-mutant-8 + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/out4/two-ladders-phyml.newick b/out4/two-ladders-phyml.newick new file mode 100644 index 0000000..53d4ad0 --- /dev/null +++ b/out4/two-ladders-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.06305181,A-mutant-8:0.00000001,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000001,(A-mutant-1:0.00000000,(A:0.00000000,(root:0.00000001,(B:0.00000000,(B-mutant-1:0.00000000,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000001,(B-mutant-7:0.00000001,(B-mutant-9:0.05123867,B-mutant-8:0.00000001)1.000000:0.07219805)1.000000:0.09400394)0.999935:0.04055356)0.999517:0.02014221)0.998923:0.02007875)1.000000:0.05170698)1.000000:0.05168999)0.999997:0.04109847)1.000000:0.07394480)1.000000:0.07437149)0.998210:0.02049289)0.999900:0.04154166)1.000000:0.06317184)0.997883:0.02038430)1.000000:0.05291599)1.000000:0.05264068)0.999981:0.03105933)0.998881:0.02050849); diff --git a/out4/two-ladders-raxml.ascii b/out4/two-ladders-raxml.ascii new file mode 100644 index 0000000..9d9b620 --- /dev/null +++ b/out4/two-ladders-raxml.ascii @@ -0,0 +1,42 @@ + + /-root + | + | /-B-mutant-3 + | | + | | /-B-mutant-5 + | | | + | /-| /-| /-B-mutant-7 + | | | | | /-| + | | | | | | | /-B-mutant-9 + | | | | \-| \-| +--| | \-| | \-B-mutant-8 + | /-| | | + | | | | \-B-mutant-6 + | | | | + | /-| | \-B-mutant-4 + | | | | + | | | \-B-mutant-2 + | /-| | + | | | \-B-mutant-1 + | | | + \-| \-B + | + | /-A + | | + \-| /-A-mutant-1 + | | + \-| /-A-mutant-2 + | | + \-| /-A-mutant-3 + | | + \-| /-A-mutant-4 + | | + | | /-A-mutant-6 + \-| /-| + | | | /-A-mutant-7 + | | \-| + \-| | /-A-mutant-8 + | \-| + | \-A-mutant-9 + | + \-A-mutant-5 diff --git a/out4/two-ladders-raxml.newick b/out4/two-ladders-raxml.newick new file mode 100644 index 0000000..00ded5d --- /dev/null +++ b/out4/two-ladders-raxml.newick @@ -0,0 +1 @@ +(A-mutant-4:0.000001,((A-mutant-6:0.000001,(A-mutant-7:0.000001,(A-mutant-8:0.000001,A-mutant-9:0.062916)82:0.020480)90:0.031011)98:0.052525,A-mutant-5:0.000001)100:0.052792,(A-mutant-3:0.000001,((A-mutant-1:0.000001,((((((B-mutant-3:0.000001,((B-mutant-5:0.000001,((B-mutant-7:0.000001,(B-mutant-9:0.051181,B-mutant-8:0.000001)100:0.072107)100:0.093844,B-mutant-6:0.000001)99:0.040525)88:0.020131,B-mutant-4:0.000001)80:0.020068)100:0.051630,B-mutant-2:0.000001)98:0.051607,B-mutant-1:0.000001)96:0.041036,B:0.000001)100:0.073774,root:0.000001)100:0.074192,A:0.000001)91:0.020466)98:0.041467,A-mutant-2:0.000001)100:0.063035)85:0.020363):0.0; diff --git a/out4/two-ladders.fasta b/out4/two-ladders.fasta new file mode 100644 index 0000000..56f0c3a --- /dev/null +++ b/out4/two-ladders.fasta @@ -0,0 +1,42 @@ +>root +CGGCCTGGTCCCCAAATGCTGCTGTTAAATGAGCACTCTACGACCCGAAGGAGCCGGTTTTAATCGAGACACGCTAAGCGCCCCTAGTAATGACGCTAAT +>A +CGGCTTGGTGCCCAAATGCTGGTGTTAAAGGAGCACTCTACGACCCGAAGGAGCCGGGTTTAATCGAGACACGCTAAGCGACCCTAGTAATGACGCTGAT +>A-mutant-1 +CGGCTTGGTGCCCAAATGCTGGTGTTAAAGGAGCACTCTACGACCCGAAGGAGCCGGGTTTAATCGAGACACGCTAAACGACCCTAGGAATGACGCTGAT +>A-mutant-2 +CGGCTTGGTGCCCAAATGCTGGCGTTAAAGGAGCACTCTACGACCCGAAGGAGCCGGGGTTAATCGAGACACGCTAAACGACCCTATGAATGACGCTGTT +>A-mutant-3 +CGGCTTGGTGCCCAAATGCTGGCGTTAACGGAGGACTCTACGTCCCGAAGGTGGCGGGCTTAATCGAGACACGCTAAACGACCCTATGAATGACGCTGTT +>A-mutant-4 +CGGCTAGGTGCCCAAATGCGGGCGTTAACGGAGGACTCTACGTCCCGAAGGTGGCGGGCTTAATCGAGACACGCTAAACGACCCTATGAATGACGCTGTT +>A-mutant-5 +CAGGTAGGTGCCCCAATGCGGGCGTAAACGGAGGACTCTACGTCCCGAAGGTGGCGGGCTTAATCGAGACACGCTACACGACCCTATGAATGACGCTGTT +>A-mutant-6 +CAGGTAGGTGCCCCAATGCGGGCGTAAACGGAGGACTCTACGTCCCGAAGGTCGCGGGCTTAATCGAGTTACGATACACGACCCTATGAAAGACGCTGTT +>A-mutant-7 +CAGGTAGGTGCCCCAATGCGGGCGTAAACGGAGGACTCTAAGTTCCGAAGGTCGCGGACTTAATCGAGTTACGATACACGACCCTATGAAAGACGCTGTT +>A-mutant-8 +CAGGTAGGCGCCCCAATGCGGGCGTAAACGGAGGACTCTAAGTTCCGAAGGTCGCGGACTTAATCGAGTTACGATACACGACCCTATGAAAGACGCTATT +>A-mutant-9 +CAGGTAGGCGCCCCTATGCGTGCGTAAACGGCGGACTCTAAGTGCCGAAGGTCGCGGACTTAATCGAGATACGATACACGACCCTTTGAAAGACGCTATT +>B +CTGCCTAGTCCCCAAATGCTGTTGTGAAATGAACACTCTACGACCCGAAGGAGCCGGTTTGAATCGAGACACGCTAAGCTCCCCTAGTAATGACGCTAAT +>B-mutant-1 +CTGCCTAGTCCCAAAATGCTGTTGTGAAATGAACACGCTACGACCCGAAGGAGCCGGTTTGAATCGAGACACGCTAAGGTCCCCTAGTAATGTCGCTAAT +>B-mutant-2 +CTGCCTAGTCCCAAAATGCTGGTGTGTAATGAACACGCTACGACCCGATGGAGCCGGTTTGAATCGCGACACGCTAAGGTCCCCTAGTAACGTCGCTAAT +>B-mutant-3 +CTGCCTAGTCCCAAAATGCTGGTGTGTAATGAACACGCTACGACCCGATGGAGGCGGTTTGAGTCGCGACACGCTGAGGTCCTCTTGTAACGTCGCTAAT +>B-mutant-4 +CTGCCTAGTCCCAAAATGCGGGTGTGTAATGAACACGCTACGACCCGATGGAGGCGGTTTGAGTCGCGACACGCTGAGGTCCTCTTGTAACGTCCCTAAT +>B-mutant-5 +CTGCCTAGTCCCAAAATGTGGGTGTGTAATGAACACGCTACGACCCGATGGAGGCGGTTTGAGTCGCGACACGCTGAGGTCCTCTTGTAACGTCCCTGAT +>B-mutant-6 +CTGCCTAGTCCCAAAATGTGGGTGTGTAATGTACACGCTACTAACCGATGGAGGCGGTTTGAGTCGCGACACGCTGAGGTCCTCTTGCAACGTCCCTGAT +>B-mutant-7 +CTTGCTAGTTCCTAAATGTGGGTGTGTAATGTACACGCTAGAAACCGATCGAGCCGGTTTGAGGCGCGACACGCTGAGGTCCTCTTGCAACGTCCCTGAT +>B-mutant-8 +CGTGCTAGTTCCTAAATGTGGGTGTGAAATGTACATGCTAGAAACCGATCGAGCCGGTTTGAGGCGCGACACGCTAACGTCCTCTTGCAACGTCTCTGCT +>B-mutant-9 +CGTGCTAGTTCCTAAATGTGGGTGTGAAATGTACATGCTAGAAACCGATCAAGCCGGCTTGAGGCGCGACACGCTAACGGCCCCTTGCAACGTCTCAGCT diff --git a/out5/branchlength_5 b/out5/branchlength_5 new file mode 100644 index 0000000..947f61e --- /dev/null +++ b/out5/branchlength_5 @@ -0,0 +1,313 @@ +Analysing sample: recombinant-50A1-50B1-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of recombinant is 0.145322. +The support value of recombinant is 58.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 90.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 60.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 99.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 100.000000. +The branchlength of A-mutant-6 is 0.008595. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 95.000000. +The branchlength of A-mutant-9 is 0.020515. +The support value of A-mutant-9 is 95.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 95.000000. +The branchlength of A is 0.000001. +The support value of A is 89.000000. +The branchlength of B is 0.008579. +The support value of B is 79.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 99.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 83.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 79.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 86.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 96.000000. +The branchlength of B-mutant-9 is 0.030164. +The support value of B-mutant-9 is 96.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 89.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 58.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 100.000000. +Analysing sample: recombinant-50A1-50B9-raxml.newick +The branchlength of root is 0.005822. +The support value of root is 1.000000. +The branchlength of B is 0.000001. +The support value of B is 68.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 68.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 64.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 63.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 64.000000. +The branchlength of recombinant is 0.240073. +The support value of recombinant is 62.000000. +The branchlength of B-mutant-9 is 0.008037. +The support value of B-mutant-9 is 62.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 64.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 64.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 56.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 70.000000. +The branchlength of A is 0.000001. +The support value of A is 95.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 93.000000. +The branchlength of A-mutant-2 is 0.008690. +The support value of A-mutant-2 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 100.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 100.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 100.000000. +The branchlength of A-mutant-9 is 0.030087. +The support value of A-mutant-9 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 60.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 99.000000. +Analysing sample: recombinant-50A5-50random-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of B is 0.000001. +The support value of B is 100.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 100.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 95.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 100.000000. +The branchlength of B-mutant-9 is 0.095456. +The support value of B-mutant-9 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 83.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 100.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 99.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 100.000000. +The branchlength of A is 0.000001. +The support value of A is 99.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 100.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 98.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 100.000000. +The branchlength of recombinant is 0.497675. +The support value of recombinant is 37.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 37.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-9 is 0.030645. +The support value of A-mutant-9 is 99.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 99.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 95.000000. +Analysing sample: recombinant-75A1-25B1-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of A is 0.000001. +The support value of A is 96.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 91.000000. +The branchlength of recombinant is 0.054362. +The support value of recombinant is 58.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 100.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 93.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 99.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 100.000000. +The branchlength of A-mutant-9 is 0.010342. +The support value of A-mutant-9 is 99.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 99.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 99.000000. +The branchlength of B is 0.000001. +The support value of B is 98.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 100.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 100.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 98.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 96.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 98.000000. +The branchlength of B-mutant-9 is 0.040231. +The support value of B-mutant-9 is 98.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 99.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 100.000000. +Analysing sample: recombinant-75A1-25B9-raxml.newick +The branchlength of root is 0.004921. +The support value of root is 1.000000. +The branchlength of recombinant is 0.063947. +The support value of recombinant is 99.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 99.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 100.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 62.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 99.000000. +The branchlength of A-mutant-9 is 0.062628. +The support value of A-mutant-9 is 100.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 100.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 99.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 71.000000. +The branchlength of A is 0.015406. +The support value of A is 76.000000. +The branchlength of B is 0.000001. +The support value of B is 99.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 92.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 100.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 88.000000. +The branchlength of B-mutant-9 is 0.010055. +The support value of B-mutant-9 is 99.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 99.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 99.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 99.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 98.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 92.000000. +Analysing sample: recombinant-75A5-25B5-raxml.newick +The branchlength of root is 0.000000. +The support value of root is 1.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 95.000000. +The branchlength of recombinant is 0.157407. +The support value of recombinant is 53.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 91.000000. +The branchlength of A-mutant-9 is 0.030737. +The support value of A-mutant-9 is 99.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 99.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 99.000000. +The branchlength of A-mutant-4 is 0.010250. +The support value of A-mutant-4 is 66.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 72.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 67.000000. +The branchlength of A is 0.000001. +The support value of A is 96.000000. +The branchlength of B is 0.000001. +The support value of B is 96.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 95.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 97.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 96.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 100.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 96.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 99.000000. +The branchlength of B-mutant-9 is 0.063267. +The support value of B-mutant-9 is 77.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 77.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 98.000000. +Analysing sample: two-ladders-raxml.newick +The branchlength of root is 0.003265. +The support value of root is 1.000000. +The branchlength of B is 0.000001. +The support value of B is 100.000000. +The branchlength of B-mutant-3 is 0.000001. +The support value of B-mutant-3 is 98.000000. +The branchlength of B-mutant-9 is 0.020148. +The support value of B-mutant-9 is 100.000000. +The branchlength of B-mutant-8 is 0.000001. +The support value of B-mutant-8 is 100.000000. +The branchlength of B-mutant-7 is 0.000001. +The support value of B-mutant-7 is 98.000000. +The branchlength of B-mutant-6 is 0.000001. +The support value of B-mutant-6 is 100.000000. +The branchlength of B-mutant-5 is 0.000001. +The support value of B-mutant-5 is 96.000000. +The branchlength of B-mutant-4 is 0.000001. +The support value of B-mutant-4 is 97.000000. +The branchlength of B-mutant-2 is 0.000001. +The support value of B-mutant-2 is 87.000000. +The branchlength of B-mutant-1 is 0.000001. +The support value of B-mutant-1 is 92.000000. +The branchlength of A is 0.000001. +The support value of A is 100.000000. +The branchlength of A-mutant-1 is 0.000001. +The support value of A-mutant-1 is 97.000000. +The branchlength of A-mutant-2 is 0.000001. +The support value of A-mutant-2 is 100.000000. +The branchlength of A-mutant-3 is 0.000001. +The support value of A-mutant-3 is 100.000000. +The branchlength of A-mutant-4 is 0.000001. +The support value of A-mutant-4 is 100.000000. +The branchlength of A-mutant-5 is 0.000001. +The support value of A-mutant-5 is 97.000000. +The branchlength of A-mutant-6 is 0.000001. +The support value of A-mutant-6 is 100.000000. +The branchlength of A-mutant-7 is 0.000001. +The support value of A-mutant-7 is 90.000000. +The branchlength of A-mutant-9 is 0.052090. +The support value of A-mutant-9 is 92.000000. +The branchlength of A-mutant-8 is 0.000001. +The support value of A-mutant-8 is 92.000000. diff --git a/out5/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png b/out5/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png new file mode 100644 index 0000000..65bb8fe Binary files /dev/null and b/out5/branchlengthplot/recombinant-50A1-50B1-raxml.newick.png differ diff --git a/out5/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png b/out5/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png new file mode 100644 index 0000000..49b2134 Binary files /dev/null and b/out5/branchlengthplot/recombinant-50A1-50B9-raxml.newick.png differ diff --git a/out5/branchlengthplot/recombinant-50A5-50random-raxml.newick.png b/out5/branchlengthplot/recombinant-50A5-50random-raxml.newick.png new file mode 100644 index 0000000..fb601db Binary files /dev/null and b/out5/branchlengthplot/recombinant-50A5-50random-raxml.newick.png differ diff --git a/out5/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png b/out5/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png new file mode 100644 index 0000000..ab71554 Binary files /dev/null and b/out5/branchlengthplot/recombinant-75A1-25B1-raxml.newick.png differ diff --git a/out5/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png b/out5/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png new file mode 100644 index 0000000..d9c57d1 Binary files /dev/null and b/out5/branchlengthplot/recombinant-75A1-25B9-raxml.newick.png differ diff --git a/out5/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png b/out5/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png new file mode 100644 index 0000000..87d0f08 Binary files /dev/null and b/out5/branchlengthplot/recombinant-75A5-25B5-raxml.newick.png differ diff --git a/out5/branchlengthplot/two-ladders-raxml.newick.png b/out5/branchlengthplot/two-ladders-raxml.newick.png new file mode 100644 index 0000000..f2b3680 Binary files /dev/null and b/out5/branchlengthplot/two-ladders-raxml.newick.png differ diff --git a/out5/minimal_distance_5 b/out5/minimal_distance_5 new file mode 100644 index 0000000..f6427fe --- /dev/null +++ b/out5/minimal_distance_5 @@ -0,0 +1,36 @@ +Analysing sample: recombinant-50A1-50B1-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-1. +The leaf with the parental node with a minimal branch bootstrap value is recombinant. + + +Analysing sample: recombinant-50A1-50B9-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to B-mutant-9. +The leaf with the parental node with a minimal branch bootstrap value is B-mutant-5. + + +Analysing sample: recombinant-50A5-50random-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-5. +The leaf with the parental node with a minimal branch bootstrap value is recombinant. + + +Analysing sample: recombinant-75A1-25B1-raxml.newick +The leaf with the biggest minimal distance to another leaf is root, to B. +The leaf with the parental node with a minimal branch bootstrap value is recombinant. + + +Analysing sample: recombinant-75A1-25B9-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-1. +The leaf with the parental node with a minimal branch bootstrap value is A-mutant-6. + + +Analysing sample: recombinant-75A5-25B5-raxml.newick +The leaf with the biggest minimal distance to another leaf is recombinant, to A-mutant-3. +The leaf with the parental node with a minimal branch bootstrap value is recombinant. + + +Analysing sample: two-ladders-raxml.newick +There is no recombinant in this sample. +The leaf with the biggest minimal distance to another leaf is root, to B. +The leaf with the parental node with a minimal branch bootstrap value is B-mutant-2. + + diff --git a/out5/recombinant-50A1-50B1-phyml.ascii b/out5/recombinant-50A1-50B1-phyml.ascii new file mode 100644 index 0000000..3fb44ba --- /dev/null +++ b/out5/recombinant-50A1-50B1-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| +--| | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + \-| \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-9 + | \-| + | \-B-mutant-8 + | + | /-A + \-| + | /-recombinant + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/out5/recombinant-50A1-50B1-phyml.newick b/out5/recombinant-50A1-50B1-phyml.newick new file mode 100644 index 0000000..32988d4 --- /dev/null +++ b/out5/recombinant-50A1-50B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.02051127,A-mutant-8:0.00000000,(A-mutant-7:0.00000001,(A-mutant-6:0.00878191,(A-mutant-5:0.00000000,(A-mutant-4:0.00000001,(A-mutant-3:0.00000001,(A-mutant-2:0.00000001,(A-mutant-1:0.00000000,(recombinant:0.14541546,(A:0.00000001,(root:0.00000001,(B:0.00848086,(B-mutant-1:0.00000001,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00000000,(B-mutant-5:0.00000001,(B-mutant-6:0.00000001,(B-mutant-7:0.00000001,(B-mutant-9:0.03015637,B-mutant-8:0.00000001)1.000000:0.06204324)0.999998:0.05189225)0.977842:0.01015690)0.999996:0.03089061)0.997418:0.02043340)1.000000:0.06429900)0.995302:0.02073100)1.000000:0.09026890)0.999997:0.08888278)1.000000:0.18227474)0.984646:0.04197488)0.592321:0.00957257)0.966790:0.01006013)1.000000:0.06231756)1.000000:0.07377497)0.997219:0.03052833)1.000000:0.08791863)1.000000:0.07665219)0.999851:0.03090515); diff --git a/out5/recombinant-50A1-50B1-raxml.ascii b/out5/recombinant-50A1-50B1-raxml.ascii new file mode 100644 index 0000000..5f14318 --- /dev/null +++ b/out5/recombinant-50A1-50B1-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-recombinant + | | + | /-| /-A-mutant-1 + | | | | + | | \-| /-A-mutant-2 + | | | | + | | \-| /-A-mutant-3 +--| | | | + | | \-| /-A-mutant-4 + | | | | + | | | | /-A-mutant-6 + | /-| \-| /-| + | | | | | | /-A-mutant-7 + | | | | | \-| + | | | \-| | /-A-mutant-8 + | | | | \-| + | | | | \-A-mutant-9 + \-| | | + | | \-A-mutant-5 + | | + | \-A + | + | /-B + | | + \-| /-B-mutant-1 + | | + | | /-B-mutant-2 + \-| | + | | /-B-mutant-4 + | | | + \-| /-| /-B-mutant-5 + | | | | + | | | | /-B-mutant-8 + | | \-| /-| + | | | /-| \-B-mutant-9 + \-| | | | + | \-| \-B-mutant-7 + | | + | \-B-mutant-6 + | + \-B-mutant-3 diff --git a/out5/recombinant-50A1-50B1-raxml.newick b/out5/recombinant-50A1-50B1-raxml.newick new file mode 100644 index 0000000..8a9f583 --- /dev/null +++ b/out5/recombinant-50A1-50B1-raxml.newick @@ -0,0 +1 @@ +(B-mutant-2:0.000001,((B-mutant-4:0.000001,(B-mutant-5:0.000001,(((B-mutant-8:0.000001,B-mutant-9:0.030164)96:0.062110,B-mutant-7:0.000001)89:0.051910,B-mutant-6:0.000001)58:0.010152)86:0.030891)79:0.020402,B-mutant-3:0.000001)100:0.064059,((B:0.008579,(((recombinant:0.145322,(A-mutant-1:0.000001,(A-mutant-2:0.000001,(A-mutant-3:0.000001,(A-mutant-4:0.000001,((A-mutant-6:0.008595,(A-mutant-7:0.000001,(A-mutant-8:0.000001,A-mutant-9:0.020515)95:0.030929)100:0.076803)100:0.088044,A-mutant-5:0.000001)95:0.030599)100:0.073926)99:0.062334)60:0.010073)90:0.009594)58:0.041995,A:0.000001)89:0.181916,root:0.000001)79:0.088635)99:0.089868,B-mutant-1:0.000001)83:0.020692):0.0; diff --git a/out5/recombinant-50A1-50B1.fasta b/out5/recombinant-50A1-50B1.fasta new file mode 100644 index 0000000..bf48201 --- /dev/null +++ b/out5/recombinant-50A1-50B1.fasta @@ -0,0 +1,44 @@ +>root +GACCCGCATAACAACATACAATTGAACGTGTAACGGCCCGGCCCATTAGGAACGCGTTACCTTAACGCGAGAGCCAAGTGGAATAGGAAAGCTGGTTAGT +>A +AACCCGCATAACAACATACAATTTAAGGCCTAACGGCTCTGCCTATTTCGAATGCGTTACCTTAATGCGAGAGACAAGTGGAATACGAAAGGTGGTTAGG +>A-mutant-1 +AACCCTCACAACAACATACAATTTAAGGCCTAACAGCTCTGCCTCTTTCGAATGCGTTACCTAAATGCGAGAGACAAGTGGAATACGAAAGGTGGTTAGG +>A-mutant-2 +AACCCTCACAACAACATACAATTTAAGGCCTAACAGCTCTGCCTCTTTCGGATGCGTTACCTAAATGCGAGAGACAAGTGGAATACGAAAGGTGGTTAGG +>A-mutant-3 +AACCCTCACAACAACATAAAATTTAAGGCCTAACAGCTCTGCCTCTTTCGGATGGGTTACCTAAATCCGAGAGACAAGTGGAATACGCAATGTGGTTCGG +>A-mutant-4 +AACCCTCAAAACAACATAAAGTTTAAGCCATAACAGCTCTGCCACTTTCGGATGGGTTACCTTAATCCGAGAGACAAGTGGAATACGCAATGGGGTTCGG +>A-mutant-5 +AACCCTCAAAACAACATAAAGTTTAAGCCATAACAGCTCTGCCCCTTTCGGATGGGTTGCCTTAATCCGAGAGACAAATGGAATACGCAATGGGGTTCGG +>A-mutant-6 +AAGCTTCAAAACAACATAAAGTATAAGCTATAACAGCTCTGCCCCTTTCGGATGGATTGCCTTAATCCGAGAGACAAATGGAACACGCAACGAGGTTAGG +>A-mutant-7 +AAGCTTAAAAACAACATAAAGTATAAGCTATAACAGCTCTTCCCCTTGCGGATGGATTGCGTTAATCCTAGAGACAAATTGAACACCCAACGAGGTTCGG +>A-mutant-8 +AAGCTTAAAAACAACATCAAGTAGAAGCTATAACAGCTCTTCCCCTTGCGGATGGATTGGGTTAATCCTAGAGACAAATTGAACACCCAACGAGGTTCGG +>A-mutant-9 +AAACTTAAAAACAACATCAAGTAGAAGCTATAACAGCTCTTGCCCTTGCGGATGGATTGGGTTAATCCTAGAGACAAATTGAACACCCAACGAGGTTCGG +>B +GACCAGCATAACAACATACAATTGAACGGGAAACGGCACGGCGCATTAGGAACGCGTTACCTTAACGCAAGAGCCAAGTGGAATAGGAAAGCCGTTTAGC +>B-mutant-1 +GACTCGCATAACAACATACAATTGGACGGGAAACGGCAAGGCGCAATAGGAACGCGTTACCGTAACGCAAGAGCGAATTGGAATAGGGAAGCCGTTTAGC +>B-mutant-2 +GACTCGCATAACAACATACAATTGGACGGGAAACGGCAAGGCGCAATAGGAACGCATTACCGTAACGCAAGAGCGAATTGGAATAGGGAAGCCGTTTCGC +>B-mutant-3 +GACTCGCATAACAACATTCAATTGGACGGGAAACGGTAAGGCGCATTAAGAACGCATTAGCGTAACGCAAGAGCGAATTGGAATAGGGAAGCCGTTCCGC +>B-mutant-4 +GACTCGCATCACAACATTCAATTGGACGGGAAACGGTAAGGCGCATTAAGAACGCATTAGCGTAACGCAAGAGCGAATTGTAATAGGGAAGCCGTTCCGC +>B-mutant-5 +GACGCGCATCACAACATTCAATTGGACGGGAAACGGTAAGGCGTATTAAGAACGCATTAGCGTAACACAAGAGCGAATTGTAATAGGGAAGCCGTTCCGC +>B-mutant-6 +GACGCGCATCACAACATTCTATTGGACGGGAAACGGTAAGGCGTATTAAGAACGCATTAGCGTAACACAAGAGCGAATTGTAATAGGGAAGCCGTTCCGC +>B-mutant-7 +GACGCGCATCACATCATTTTATTGGCCGGGAAAGGGTAAGGCGGATTAAGAACGCATTAGCGTAACACAAGAGCGAATTGTAATAGGGAAGCCGTTCCGC +>B-mutant-8 +GACGCGCATCACATCATTTTCTTGGCCGGGAAAGGGTAAGGCGCATTAAGAACGCATTAGTGTAACTCAAGAGCGAATTGGAATAGGGAAGCCGCTCCGC +>B-mutant-9 +GACGCGCATCCCAACATTTTCTTGGCCGCGAAAGGGTAAGGCGCATTAAGAACGCATTAGTGTAACTCAAGAGCGAATTGGAATAGGGAAGCCGCTCCGC +>recombinant +AACCCTCACAACAACATACAATTTAAGGCCTAACAGCTCTGCCTCTTTCGAACGCGTTACCGTAACGCAAGAGCGAATTGGAATAGGGAAGCCGTTTAGC diff --git a/out5/recombinant-50A1-50B9-phyml.ascii b/out5/recombinant-50A1-50B9-phyml.ascii new file mode 100644 index 0000000..5d0fd1c --- /dev/null +++ b/out5/recombinant-50A1-50B9-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| + | | | /-B-mutant-2 +--| | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + | | \-| + \-| | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-8 + | \-| + | | /-recombinant + | \-| + | \-B-mutant-9 + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/out5/recombinant-50A1-50B9-phyml.newick b/out5/recombinant-50A1-50B9-phyml.newick new file mode 100644 index 0000000..19aa8f4 --- /dev/null +++ b/out5/recombinant-50A1-50B9-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.03079812,A-mutant-8:0.00000001,(A-mutant-7:0.00000001,(A-mutant-6:0.00000000,(A-mutant-5:0.00000001,(A-mutant-4:0.00000001,(A-mutant-3:0.00000000,(A-mutant-2:0.00881883,(A-mutant-1:0.00000001,(A:0.00000001,(root:0.01200693,(B:0.00000001,(B-mutant-1:0.00000000,(B-mutant-2:0.00000001,(B-mutant-3:0.00000001,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000000,(B-mutant-7:0.00000000,(B-mutant-8:0.00000001,(recombinant:0.24376441,B-mutant-9:0.00804652)0.984067:0.05697780)0.999999:0.05346257)0.999996:0.05353832)0.999993:0.05273250)0.997724:0.02051752)1.000000:0.05254525)0.999845:0.03104265)0.999987:0.04187910)0.999998:0.07486636)0.999908:0.06410269)1.000000:0.08779040)0.992813:0.02039549)1.000000:0.06636627)0.999933:0.04358535)1.000000:0.07558788)0.999996:0.05211086)1.000000:0.05251678)0.925981:0.01012949)1.000000:0.07541688); diff --git a/out5/recombinant-50A1-50B9-raxml.ascii b/out5/recombinant-50A1-50B9-raxml.ascii new file mode 100644 index 0000000..c2837e4 --- /dev/null +++ b/out5/recombinant-50A1-50B9-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | | + | | /-B-mutant-2 + | | | + | | /-| /-B-mutant-3 + | | | | | +--| /-| | | | /-B-mutant-4 + | | | | \-| | + | | | | | | /-B-mutant-7 + | | | | | | | + | | | | \-| /-| /-recombinant + | | | | | | | /-| + | | \-| | | \-| \-B-mutant-9 + | | | | /-| | + | | | | | | \-B-mutant-8 + \-| | \-| | + | | | \-B-mutant-6 + | | | + | | \-B-mutant-5 + | | + | \-B-mutant-1 + | + | /-A + | | + \-| /-A-mutant-1 + | | + | | /-A-mutant-2 + \-| | + | | /-A-mutant-4 + | | | + \-| /-| /-A-mutant-5 + | | | | + | | \-| /-A-mutant-6 + | | | | + | | \-| /-A-mutant-8 + \-| | /-| + | \-| \-A-mutant-9 + | | + | \-A-mutant-7 + | + \-A-mutant-3 diff --git a/out5/recombinant-50A1-50B9-raxml.newick b/out5/recombinant-50A1-50B9-raxml.newick new file mode 100644 index 0000000..c6a0c4c --- /dev/null +++ b/out5/recombinant-50A1-50B9-raxml.newick @@ -0,0 +1 @@ +((A-mutant-4:0.000001,(A-mutant-5:0.000001,(A-mutant-6:0.000001,((A-mutant-8:0.000001,A-mutant-9:0.030087)100:0.073904,A-mutant-7:0.000001)60:0.009810)100:0.051247)100:0.050978)100:0.073535,(A-mutant-2:0.008690,(((root:0.011643,(B:0.000001,((B-mutant-2:0.000001,(B-mutant-3:0.000001,(B-mutant-4:0.000001,(((B-mutant-7:0.000001,((recombinant:0.240073,B-mutant-9:0.008037)62:0.055241,B-mutant-8:0.000001)64:0.051853)64:0.052069,B-mutant-6:0.000001)64:0.051546,B-mutant-5:0.000001)56:0.019956)63:0.051302)64:0.030282)68:0.040681,B-mutant-1:0.000001)70:0.073076)68:0.062292)95:0.085610,A:0.000001)93:0.019773,A-mutant-1:0.000001)100:0.064770)99:0.042300,A-mutant-3:0.000001):0.0; diff --git a/out5/recombinant-50A1-50B9.fasta b/out5/recombinant-50A1-50B9.fasta new file mode 100644 index 0000000..508e1f2 --- /dev/null +++ b/out5/recombinant-50A1-50B9.fasta @@ -0,0 +1,44 @@ +>root +TCCAACACGTTATAATATTGCAGGGACGGTTCCTGGTTGTATCCATCCTATAGTGACCGGCTATAGGAGCAAAATTCGCTAACTGCATGTAGTCCCCGTG +>A +TTCTAAACGTTATAATATTGCAGGGGGGGTTCCTCGTTGTATCCATCCTATAGTGACCGGTTATAGGAGCAAAATTCGCTAACTGCCTGTAGCCCCCGTG +>A-mutant-1 +TTCTAAACGTTATAATATTGCAGGGGGGGTTCCTCGTTGTATCCATCCTATAGGGACCGGTTATAGGAGCAAAATTCGCTAACTGCCTGTAGCCCCAGTG +>A-mutant-2 +TTCTAAACGTTATAATATTGAATGGGGGATTCCTCGTTGTATCCATCCTATAGGGACCAGTTATAGGAGCAAAATTCCCTAACCGCCTGTAGCCCGAGTG +>A-mutant-3 +TTCTAAACGTTATAATATTGAATGGGGGATTCCTCGTTGTAACCATCCTATAGGGCCCAGTTATAAGAGCAAAATTCCCTAACTGCCTGTAGCCGGAGTG +>A-mutant-4 +TTCTAAACGTTATAATGTTGAATGGCGGATTCGTCGTTGTAACCATCCTATAGGGCCCAGTTTTAAGCTCAAGATTCCCTAACTGCCTGTAGCCGGAGTG +>A-mutant-5 +ATCTAAACGTTATAATGTTGAATGGCTGATTCGTCGATGTAACCATCCTATAGGGCCCAGTCTTAAGCTCAAGATTCCCGAACTGCCTGTAGCCGGAGTG +>A-mutant-6 +ATCTAAACGTTATAATGTTGAATGTCTGATTCGTCGATGTAACCATCCTATATCGCCCAGTCTTAAGCTCAAGACTCCCGAACTGCCTGTAGCCGGCGTG +>A-mutant-7 +ATATAAACGTTATAATGTTGAATGTCTGATTCGTCGATGTAACCATCCTATATCGCCCAGTCTTAAGCTCAAGACTCCCGAACTGCCTGTAGCCGGCGTG +>A-mutant-8 +ATATAAACGTAATAATGTTGGATGTCTGATACGTCGATGTAACCATCCTATATCGCCCAGTCTTAATCTCAAGACTTCCGAACTGCCTGCAGCCGACGTG +>A-mutant-9 +ATATAAACGTAATTATGTTGGATGTCTGATACGTCGCTGTAACCATCCTATATCGCCCAGTCTTATTCTCAAGACTTCCGAACTGCCTGCAGCCGACGTG +>B +TCCAACACGTTATAATATTGGAGGGAGGTTTCCTGGTTGTATCCATCCTATAGAGACCGGGCATAGGAGCAAAATTCGCTAGCTGCATGTAGTCCCCGTG +>B-mutant-1 +TCCAACACGTTATAATATTGGAGGGAGGATTCCTGGTTGAAACCATCCTATAGAGACCGGTCATAGGAGCAATATTTGCTAGCTGCATGTAGTCCCGGTG +>B-mutant-2 +TCCAACACGTTATAATATGGGAGGGAGGATTACTGGTTGAAACCATCCTATAGAGACGGGTCATAGGAGCAATATTTGTTAGCTGCATGTAGTCCCGGTG +>B-mutant-3 +TACAACACGTTATAATATGGGAGGTAGGATTACTGGTTGAAATCATCCTATAGAGACGGGTCATAGGAGCAATATTTGTTAGCTGCATGTAGTCCCGGTG +>B-mutant-4 +TACAACACGTTATATTATGGCAGGTAGGATTACTTGTTGAAATCATCCTATAGAGACGGGTCATAGGAGCCATATTTGATAGCTGCATGTAGTCCCGGTG +>B-mutant-5 +TACAACACGTTATATTATAGCAGGTAGGATTACTTGTTGAAATCATCCTATAGAGACGGGTCAAAGGAGCCATATTTGATAGCTGCATGTAGTCCCGGTG +>B-mutant-6 +AACAACACGTTATATTATAGCAGGTAGGATTACTTGCTGAAATCATCCGATAGAGACGGGTCAAAGGAGTCATATTTGATAGCAGCATGTAGTCCCGGTG +>B-mutant-7 +AACAACACGTTATATTATAGCAGGTAGGATCACTTGCTGAAATCATCCGATAGAGACGGGTCAAAGGAGGCATATTTAATAGCAGCATGAAGTCACGGTG +>B-mutant-8 +AACAACACGTGATATTTTAGCAGGTAGGATCACTTGCTGAAATCATCCGATCGAGACGCGTCAAAGGAGGCATATTTAATAGCAGCATGAAGTCACGTTG +>B-mutant-9 +AACAACACGTGATATTTTAGCATGTAGGATCACTTGCTGAAATCATCCAACCGAGACGCGTCAAAGGAGGCATATTTAAGAGCAGCATGAAGTCATGTTT +>recombinant +TTCTAAACGTTATAATATTGCAGGGGGGGTTCCTCGTTGTATCCATCCTACCGAGACGCGTCAAAGGAGGCATATTTAAGAGCAGCATGAAGTCATGTTT diff --git a/out5/recombinant-50A5-50random-phyml.ascii b/out5/recombinant-50A5-50random-phyml.ascii new file mode 100644 index 0000000..2c898a2 --- /dev/null +++ b/out5/recombinant-50A5-50random-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | /-| /-A-mutant-1 + | | | | + | | \-| /-A-mutant-2 +--| | | | + | | \-| /-A-mutant-3 + | | | | + | | \-| /-A-mutant-4 + | | | | + | | | | /-A-mutant-6 + | | \-| /-| + \-| | | | /-A-mutant-7 + | | | \-| + | | | | /-A-mutant-8 + | \-| \-| + | | \-A-mutant-9 + | | + | | /-A-mutant-5 + | \-| + | \-recombinant + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/out5/recombinant-50A5-50random-phyml.newick b/out5/recombinant-50A5-50random-phyml.newick new file mode 100644 index 0000000..4a6a91a --- /dev/null +++ b/out5/recombinant-50A5-50random-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000001,B-mutant-9:0.09541779,(B-mutant-7:0.00000001,(B-mutant-6:0.00000001,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00000000,(B-mutant-2:0.00000000,(B-mutant-1:0.00000000,(B:0.00000000,(root:0.00000000,(A:0.00000000,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000000,(A-mutant-4:0.00000000,((A-mutant-6:0.00000000,(A-mutant-7:0.00000001,(A-mutant-8:0.00000000,A-mutant-9:0.03063995)0.999972:0.04100363)0.999999:0.05163745)1.000000:0.09732073,(A-mutant-5:0.00000001,recombinant:0.49627886)0.565436:0.00959714)0.999082:0.03139459)1.000000:0.07366889)0.999998:0.04114160)1.000000:0.05155116)0.999998:0.04105945)0.999999:0.07344441)1.000000:0.16723765)1.000000:0.10739565)0.999994:0.05203063)1.000000:0.09606508)0.999866:0.03067668)1.000000:0.08491728)1.000000:0.07346117)0.998270:0.02024214)1.000000:0.05164646); diff --git a/out5/recombinant-50A5-50random-raxml.ascii b/out5/recombinant-50A5-50random-raxml.ascii new file mode 100644 index 0000000..044ad16 --- /dev/null +++ b/out5/recombinant-50A5-50random-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | | + | | /-B-mutant-3 + | | | + | | /-| /-B-mutant-4 + | | | | | +--| | | \-| /-B-mutant-5 + | /-| | | | + | | | | | | /-B-mutant-9 + | | | | \-| /-| + | | | /-| | /-| \-B-mutant-8 + | | | | | | | | + | | | | | \-| \-B-mutant-7 + | | | | | | + \-| \-| | \-B-mutant-6 + | | | + | | \-B-mutant-2 + | | + | \-B-mutant-1 + | + | /-A + | | + \-| /-A-mutant-1 + | | + \-| /-A-mutant-2 + | | + \-| /-A-mutant-3 + | | + \-| /-A-mutant-4 + | | + \-| /-recombinant + | /-| + | | \-A-mutant-5 + \-| + | /-A-mutant-6 + | | + \-| /-A-mutant-9 + | /-| + \-| \-A-mutant-8 + | + \-A-mutant-7 diff --git a/out5/recombinant-50A5-50random-raxml.newick b/out5/recombinant-50A5-50random-raxml.newick new file mode 100644 index 0000000..ceaca19 --- /dev/null +++ b/out5/recombinant-50A5-50random-raxml.newick @@ -0,0 +1 @@ +(A-mutant-6:0.000001,((recombinant:0.497675,A-mutant-5:0.000001)37:0.009601,(((A-mutant-2:0.000001,((A:0.000001,((B:0.000001,(((B-mutant-3:0.000001,(B-mutant-4:0.000001,(B-mutant-5:0.000001,(((B-mutant-9:0.095456,B-mutant-8:0.000001)100:0.051659,B-mutant-7:0.000001)83:0.020241,B-mutant-6:0.000001)100:0.073490)100:0.084940)95:0.030678)100:0.096107,B-mutant-2:0.000001)99:0.052040,B-mutant-1:0.000001)100:0.107461)100:0.167348,root:0.000001)99:0.073471)100:0.041066,A-mutant-1:0.000001)98:0.051566)100:0.041153,A-mutant-3:0.000001)100:0.073700,A-mutant-4:0.000001)94:0.031405)100:0.097398,((A-mutant-9:0.030645,A-mutant-8:0.000001)99:0.041011,A-mutant-7:0.000001)95:0.051649):0.0; diff --git a/out5/recombinant-50A5-50random.fasta b/out5/recombinant-50A5-50random.fasta new file mode 100644 index 0000000..8256fd0 --- /dev/null +++ b/out5/recombinant-50A5-50random.fasta @@ -0,0 +1,44 @@ +>root +TGGGGCAACTTGACGAAGGGTACGGATGCCGACACAAGTGTAAATGAGTGGCTCTCTTCTTTCCCATCAATAACTTAGCACCTAATCCCATTTGGCACCA +>A +TCGGGTACCTTGACGAAGGGTACGAACGCCGACACAAGTGTAAATGAGTGGCTCTCTTCTTTACCATCAATAACTTAGCACCTAATCCCATTTGGAACCA +>A-mutant-1 +TCGGGTACCTTGACGAAGCGTACGAACGCCGCCCCAAGTGTAAATGAGTGGGTCTCTTCTTTACCATCAATAACTTAGCACCTAATCCCATTTGGAACCA +>A-mutant-2 +TCGGGTACCTTGACGAAGCGTACGAACGCCGCCCCAAGTGTAAATGAGTGGGTCTCTTCTTTACCATCAATAATTTAGCAGGTAATCCCATTTAAAACCA +>A-mutant-3 +TCGGGTAACTTGACGAAGCGTACGAACGCCGCCCAAAGTGTAAACGAGTGGGTCTCTTCTTTACCATGAATAATTTAGCAGGTAATCCCATTTAAAACCA +>A-mutant-4 +TCGGGTAAATTGACCAGGCGTTCGAACGCCGCGCAACGTGTAAACGAGTGGTTCTCTTCTTTACCATGAATAATTTAGCAGGTAATCCCATTTAAAACCA +>A-mutant-5 +TCGGGTAAATTGACCAGGCGTTCCATCGCCGCGCAACGTGTAAACGAGTGGTTATCTACTTTACCATGAATAATTTAGCAGGTAATCCCATTTAAAACCA +>A-mutant-6 +TCGGGAAAATTGCCCAGGCGTTCCAACGCCGCGCAACGTATAAACGAGTGGTTATCTACTTCACCATAAATAATTGAGCAGGGAATCCCATTTAATACGA +>A-mutant-7 +CCGGGAGAATTGCCCAGGCGGTCCAACGCCGCGCAACGTATAAACGAGTGGCTATCTGCTTCACCATAAATAATTGAGCAGGGAATCCCATTTAATACGA +>A-mutant-8 +CCGGGAGAATTGCCCAGGCGGTCCAACGCCGCGCAACGTATAAACGAGTGGATATCTGCTTCACCATAAATAATTGAGCAGGGAATCCCGTTTAATATCA +>A-mutant-9 +CCGGGGGAATTGCCCAGGAGGTCCAACGCCGCTCAACGTATAAACGAGTGGATATCTGCTTCACCATAAATAATTGAGCAGGGAATCCCGTTTAATATCA +>B +TGGGGCATCTTGATGAAGGATACGGGTGCCAACACAAGAGTAAATGAGTGACTCTCTTCTTTCCCATCAATAATGTAGCACCTGAACCGAATGGGCGCCA +>B-mutant-1 +TGGGGAATGTTGATGAAGGATACGGGTGCCAACACAAGAGTAGATGAGTGACGGTCTTCTTTCCCGTCAATATTGCAGCATCTGAAGCGAATGGGCGCCA +>B-mutant-2 +TGGGGAATTTTGATGGTGGATACGGGTGCCAACACAAGAGTAGATGAGTGGCGGTCTTCTTTCCCGTCAATCTTGCAGCATCTGAAGCGAATGGGCGCCA +>B-mutant-3 +TGGGGAATTTTGATGGTGGACACGGGTGCCAACACAAGAGCAGATCAGTTGCGGTCCTCTTTCCCGTCAGTCTTGGAGCATCTTAGGCGAATGGGCGCCA +>B-mutant-4 +TGCGGAATTTGGATGGTGGACACGGGTGCCAACACAAGAGCAGATCAGTTGCGGTCCTCTTTCCCGTCAGTCTTGGAGCATCTTAGGGGAATGGGCGCCA +>B-mutant-5 +TGCGGAATTTGGACAGTGGACACGGGTGCCCACACAATAGCAGATCAGTTGCCGTCCTCTTTCCAGTCTGTCTTGGAGCATCTTAGGGGAATGGGCGCCC +>B-mutant-6 +TGCGGTATTTGGACAGTGGACACGGGTGCCCACACAATACCACATCAGTTGCCGTCCTCTGGCCAGTCTGTCTTGGAACATCTCAGGGGAATGGGCGCCC +>B-mutant-7 +TGCTGTATTTGGACAGTAGACACGGGTGCCCACACAATACCACATCAGTTGCCGTCCTCTGGCCAGTCTGTCTTGGAACATCTCAGGGGAATGGGCGCCC +>B-mutant-8 +TGCTGTATTTGGACAGTAGACACGGGGGCCCACACAATACCACATCAGTTGCCGACTTCTGGCCAGTCTGTCTTGGAACATCCCAGGGGAATGGGCGCTC +>B-mutant-9 +TGCTGTATTTGGACAGTAGACATCGGGGCCCACAAAATAGCACATCAGTTGCCGACTTCTGGCCAGCCTGTCTTGGTACACCCCAGGCGAATGGGGGCTC +>recombinant +TCGGGTAAATTGACCAGGCGTTCCATCGCCGCGCAACGTGTAAACGAGTGGTGTCGGTTGTAAGAGTCTCCTCTAAGTCTTCTGCGCAGCTCTTGTACTA diff --git a/out5/recombinant-75A1-25B1-phyml.ascii b/out5/recombinant-75A1-25B1-phyml.ascii new file mode 100644 index 0000000..3761146 --- /dev/null +++ b/out5/recombinant-75A1-25B1-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | /-| + | | | /-recombinant + | | \-| + | | | /-A-mutant-1 +--| | \-| + | | | /-A-mutant-2 + | | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + | | \-| + \-| | /-A-mutant-5 + | \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-8 + | \-| + | \-A-mutant-9 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/out5/recombinant-75A1-25B1-phyml.newick b/out5/recombinant-75A1-25B1-phyml.newick new file mode 100644 index 0000000..6d9288e --- /dev/null +++ b/out5/recombinant-75A1-25B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.04102774,B-mutant-8:0.00000000,(B-mutant-7:0.00000001,(B-mutant-6:0.00000001,(B-mutant-5:0.00000001,(B-mutant-4:0.00000000,(B-mutant-3:0.00000000,(B-mutant-2:0.00000001,(B-mutant-1:0.00000000,(B:0.00000001,(root:0.00000001,(A:0.00000001,(recombinant:0.05521945,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000001,(A-mutant-4:0.00000001,(A-mutant-5:0.00000001,(A-mutant-6:0.00000001,(A-mutant-7:0.00000000,(A-mutant-8:0.00000001,A-mutant-9:0.01056832)0.999999:0.05503055)1.000000:0.07852759)0.974828:0.04296552)1.000000:0.09040544)0.999965:0.05420586)0.999964:0.03225676)1.000000:0.06697783)0.000000:0.00000001)0.999853:0.04321857)1.000000:0.11236090)0.999997:0.07704053)1.000000:0.08887546)0.999997:0.05318136)1.000000:0.09814345)0.999981:0.04133859)0.999986:0.04150620)1.000000:0.09955323)0.999160:0.04150910)1.000000:0.06288416); diff --git a/out5/recombinant-75A1-25B1-raxml.ascii b/out5/recombinant-75A1-25B1-raxml.ascii new file mode 100644 index 0000000..55024ee --- /dev/null +++ b/out5/recombinant-75A1-25B1-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A + | | + | /-| /-A-mutant-1 + | | | | + | | \-| /-recombinant +--| | | | + | | \-| /-A-mutant-2 + | | | | + | | \-| /-A-mutant-3 + | | | | + | | \-| /-A-mutant-4 + | | | | + | | \-| /-A-mutant-5 + \-| | | + | \-| /-A-mutant-7 + | | /-| + | | | | /-A-mutant-9 + | \-| \-| + | | \-A-mutant-8 + | | + | \-A-mutant-6 + | + | /-B + | | + \-| /-B-mutant-1 + | | + | | /-B-mutant-2 + \-| | + | | /-B-mutant-5 + | | /-| + | | | | /-B-mutant-6 + \-| | \-| + | | | /-B-mutant-7 + | /-| \-| + | | | | /-B-mutant-8 + | | | \-| + \-| | \-B-mutant-9 + | | + | \-B-mutant-4 + | + \-B-mutant-3 diff --git a/out5/recombinant-75A1-25B1-raxml.newick b/out5/recombinant-75A1-25B1-raxml.newick new file mode 100644 index 0000000..0a658b3 --- /dev/null +++ b/out5/recombinant-75A1-25B1-raxml.newick @@ -0,0 +1 @@ +(B-mutant-1:0.000001,(B-mutant-2:0.000001,(((B-mutant-5:0.000001,(B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-8:0.000001,B-mutant-9:0.040231)98:0.061699)96:0.040736)100:0.097981)98:0.040678,B-mutant-4:0.000001)99:0.040550,B-mutant-3:0.000001)100:0.096341)100:0.052102,(B:0.000001,((A:0.000001,(A-mutant-1:0.000001,(recombinant:0.054362,(A-mutant-2:0.000001,(A-mutant-3:0.000001,(A-mutant-4:0.000001,(A-mutant-5:0.000001,((A-mutant-7:0.000001,(A-mutant-9:0.010342,A-mutant-8:0.000001)99:0.053992)100:0.077191,A-mutant-6:0.000001)99:0.042163)100:0.088868)99:0.053230)93:0.031667)100:0.065982)58:0.000001)91:0.042490)96:0.110635,root:0.000001)98:0.075771)100:0.087294):0.0; diff --git a/out5/recombinant-75A1-25B1.fasta b/out5/recombinant-75A1-25B1.fasta new file mode 100644 index 0000000..caf73e9 --- /dev/null +++ b/out5/recombinant-75A1-25B1.fasta @@ -0,0 +1,44 @@ +>root +AAAGACCTTTTGCCCATTAAGCTTTAAAACTCTTTCGGCTTTGCGGCTCCGCACCCGCTGGCAACTTGAGCTGCGCCATATTCATAGTAGGTTTTCAGTG +>A +AAAGACCTTTTGCCCATTAACCTTTTAAACTCTTTCGGCTTTAGGCCTCCGCACGCGCTTGCAGCTTGAGCAGCGCCATATTCATAGTAGGTTTTCAGTA +>A-mutant-1 +AAAGACCTCTTGCCCATTAACCTTTTAAACTCCTTCGGCTTTAGGCCTCCGCACACGCTTGCAGCTTGACCAGCGCCATATTCATAGTAGGTTTTCAGTA +>A-mutant-2 +AAGGACCTCTTGCCCATTAACCTTTTTAACTCCTTCGGCTTTAGGTCTCCGCACACGCTCGCCGCTTGACCAGCGCCATATGCATAGTAGGTTTTCAGTA +>A-mutant-3 +AAGGACCTCTTGCCCATTCACCTTTTTAACTCCTTCGGCTTTAGCTCTCCGCACACGCTCGACGCTTGACCAGCGCCATATGCATAGTAGGTTTTCAGTA +>A-mutant-4 +AAGGACCTCTTGCCCATACACCTTTTTAACTCCTTCGGCTTTAGCGGTCCGCACACGCTCGACTCTTGACCAGCGCCATATGCATAGTAGGTATTCAGTA +>A-mutant-5 +CAGGACCTCTTGCCGATACACCTTATCAACTCCTTCGGCTTTTGCGGTCCGCACACGCTCGACCCTTGACCATCGCCATATGCATAGTAGGTATTCAGTG +>A-mutant-6 +GAGGACCTCTTGCCGATACACCTTATCAACTCCTTCGGCTTTTGCGGTCCGCACACGCTCGACCCTTGTCCATCGCCATATCCATAGGAGGTATTCAGTG +>A-mutant-7 +GACGACCTCTTGCCGATACACCTTATCAACTCCTTCGGCGTTTGCGGTTCGCACACGCTCCATCCTTGTCCATCGCCATATTCATAGCAGGTATTCAGTG +>A-mutant-8 +GACGACCTCCTGCCGATACACCTTATCAACTCCTTCGGCGTTTGCGGTTCACACACGCTCCATCCTTGTCCATCGCCAAATTCATAGCAGCTAGTCAGTG +>A-mutant-9 +GACGACCTCCTGCCGATACACCTTATCAACTCCTTCGGCGTTTGCGGTTCACACACGCTCCATCCTTGTCCAGCGCCAAATTCATAGCAGCTAGTCAGTG +>B +AAAGACCTTTAGCCCATTAAGCTTTAACACTCTTTCGGCTTTTCGGCTCCGCACCCGCTGGCAACTTGAGCTGCGCCATATTCATAGTAGGTTGTCTGCC +>B-mutant-1 +AAGGATCGTAGGCCCATTTAGCTTTAACACTCTTTCGGCTTTTCGGATCCGCACCCGCTGGCAACTTGAGCTGCGCCATATTCATAGAAGGTTGTCTGCC +>B-mutant-2 +AAGGATCGTAGGCACATTTAGCTTTAACACTCTTTCGGCTTTTCGGATCCGCACCCGCTGGCAACTTGAGGTGCCACATATTCATAGAAGGTTGTCTGAC +>B-mutant-3 +AAGGATCGTAGGCACATTTAGCTTTTACACTCTTTCGGCGTTTCGGATCCGCACCCGCTAGCAACTTGTAGTGACAGATATTCGTAGAAGGTTGTCTGTC +>B-mutant-4 +AAGGATCGTTGGCACATTTAGCTTTTACGCTCTTTCGGCGTTTCGGATCCGCACCCGCTAGCAACTTGTAGTGACAGATATTCGTAGAAAGTTGGCTGTC +>B-mutant-5 +AAGAATCGTTGGCACATTGAGCTTTTACGCTCTTTCGGCGTTTCGGATCCGCACCCGCTAGCAACTTGTAGTGACAGATCTTCGTACAAAGTTGGCTGTC +>B-mutant-6 +AAGAATTGCTGGCACATTGAGCTTTTACGCTCTTTCGGCATTTCGCATCCGCACCCGCTAGGAACTGGTAGTGACAGATCTTCGTACATAGTTCGCTGTT +>B-mutant-7 +AAGAATGGCTGGCACATTGAGCTTTTACGCTCATTCGGCATTTCGCATCCGCACGAGCTAGGAACTGGTAGTGACAGATCTTCGTACATAGTTCGCTGTT +>B-mutant-8 +AAGTATGGCTGGCACATTGTGCTTTTACGCTCATTCGGCATTTCGCATCCGCACGAGCTAGGAACTGGTATTGACAGATCTACGTACATAGTTCACTGTG +>B-mutant-9 +AAGTATTGCAGGCACATTGTGCTTTTACGCTCATTCGGCATTTCGCATCCGCACGAGCTAGGAACTGGTATGGACAGATCTACGTACATAGTTCAGTGTG +>recombinant +AAAGACCTCTTGCCCATTAACCTTTTAAACTCCTTCGGCTTTAGGCCTCCGCACACGCTTGCAGCTTGACCAGCGCCATATTCATAGAAGGTTGTCTGCC diff --git a/out5/recombinant-75A1-25B9-phyml.ascii b/out5/recombinant-75A1-25B9-phyml.ascii new file mode 100644 index 0000000..ad90214 --- /dev/null +++ b/out5/recombinant-75A1-25B9-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-recombinant + | /-| + | | | /-A + | | \-| + | | | /-A-mutant-1 +--| | \-| + | | | /-A-mutant-2 + | | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + | | \-| + \-| | /-A-mutant-5 + | \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-9 + | \-| + | \-A-mutant-8 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/out5/recombinant-75A1-25B9-phyml.newick b/out5/recombinant-75A1-25B9-phyml.newick new file mode 100644 index 0000000..a3b3825 --- /dev/null +++ b/out5/recombinant-75A1-25B9-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000000,B-mutant-9:0.01005614,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000001,(B-mutant-4:0.00000000,(B-mutant-3:0.00000000,(B-mutant-2:0.00000000,(B-mutant-1:0.00000000,(B:0.00000000,(root:0.00983864,(recombinant:0.06393036,(A:0.01541259,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000001,(A-mutant-4:0.00000000,(A-mutant-5:0.00000001,(A-mutant-6:0.00000000,(A-mutant-7:0.00000001,(A-mutant-9:0.06261950,A-mutant-8:0.00000001)0.999998:0.04101393)1.000000:0.06269176)0.938405:0.00997593)1.000000:0.07229523)0.999990:0.04075250)1.000000:0.09482324)0.999994:0.04064383)0.919429:0.01467108)0.922718:0.02565474)1.000000:0.07988621)0.999998:0.05292788)0.999987:0.03102736)1.000000:0.06292437)0.998276:0.02032019)0.999947:0.03077501)1.000000:0.06317538)1.000000:0.09604974)1.000000:0.05161134)1.000000:0.05182902); diff --git a/out5/recombinant-75A1-25B9-raxml.ascii b/out5/recombinant-75A1-25B9-raxml.ascii new file mode 100644 index 0000000..c225d44 --- /dev/null +++ b/out5/recombinant-75A1-25B9-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-recombinant + | | + | | /-A-mutant-3 + | | /-| + | | | | /-A-mutant-4 + | | | \-| + | | | | /-A-mutant-5 +--| | | \-| + | /-| | | /-A-mutant-6 + | | | /-| \-| + | | | | | | /-A-mutant-7 + | | | | | \-| + | | | | | | /-A-mutant-9 + | | | /-| | \-| + | | | | | | \-A-mutant-8 + | | | | | | + \-| \-| | \-A-mutant-2 + | | | + | | \-A-mutant-1 + | | + | \-A + | + | /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + | | /-B-mutant-3 + \-| | + | | /-B-mutant-9 + | | /-| + | | /-| \-B-mutant-8 + \-| | | + | /-| \-B-mutant-7 + | | | + | /-| \-B-mutant-6 + | | | + \-| \-B-mutant-5 + | + \-B-mutant-4 diff --git a/out5/recombinant-75A1-25B9-raxml.newick b/out5/recombinant-75A1-25B9-raxml.newick new file mode 100644 index 0000000..ba5badc --- /dev/null +++ b/out5/recombinant-75A1-25B9-raxml.newick @@ -0,0 +1 @@ +((B:0.000001,((recombinant:0.063947,((((A-mutant-3:0.000001,(A-mutant-4:0.000001,(A-mutant-5:0.000001,(A-mutant-6:0.000001,(A-mutant-7:0.000001,(A-mutant-9:0.062628,A-mutant-8:0.000001)100:0.041016)99:0.062701)62:0.009975)100:0.072310)99:0.040760)100:0.094851,A-mutant-2:0.000001)99:0.040648,A-mutant-1:0.000001)71:0.014680,A:0.015406)76:0.025680)99:0.079927,root:0.009843)99:0.052937)92:0.031035,B-mutant-1:0.000001,(B-mutant-2:0.000001,(B-mutant-3:0.000001,(((((B-mutant-9:0.010055,B-mutant-8:0.000001)99:0.051835,B-mutant-7:0.000001)99:0.051617,B-mutant-6:0.000001)99:0.096086,B-mutant-5:0.000001)98:0.063191,B-mutant-4:0.000001)92:0.030777)88:0.020319)100:0.062939):0.0; diff --git a/out5/recombinant-75A1-25B9.fasta b/out5/recombinant-75A1-25B9.fasta new file mode 100644 index 0000000..edae8d9 --- /dev/null +++ b/out5/recombinant-75A1-25B9.fasta @@ -0,0 +1,44 @@ +>root +TTTCGAATGGAGTGCTCTGAAGAGTACGGCATGTTCAGGAGATGGCGCATGGTAGCCTCGTTTATCTGCAATTTCAACCACGGTCTAGGACCGTCTTACA +>A +TTTCGGATGGAATGCCCTGAAGAGTACGGCAAGTTCAGGAGTTGGCGCATGGTCGCCTCGTTTATGTGCAATATCAACCACGGTCTCGGACAGTCTGACA +>A-mutant-1 +TTTCGGATGGAATGCCCTGAAGAGTACGGGAAGTTCAGGAGTTGGCGCATGGTCGCCTCGTTTATCTGCAATATCAACCACGGTCTCGGACAGTCTGACT +>A-mutant-2 +TTCCGGATGGAATGCCCTGAAGAGTACGGGAAGTTCAGGAGTTGGCGCATGGTCGCCTCGTTAATCTGCAATATCAACCACGGTCTCGAACTGTCTGACT +>A-mutant-3 +TTCCGGATGGAATGCCCTTAACAGTACGGGAAGTTCAGGAGTCGGTGCATGGTCGCGTCGTTATTCAGCAATATCAAGCACGGTCACGAACTGTCTGACT +>A-mutant-4 +TTCCGAATGGAATGCCCTTAACACTACGGGAAGGTCAGGAGTCGGTGCATGGTCGCGTCGTTATTCAGCAATATCGAGCACGGTCACGAACTGTCTGACT +>A-mutant-5 +TTCCGAATGGAATGCCCTTAACACTACAGGATCGACGGGAGTCGGTGCATCGTCGCGTCGTTATTCAGCAATATCGAGCACGCTCACGAACTGTCTGACT +>A-mutant-6 +TTCCGAATGGAATGCCCTTAACACTACAGGGTCGACGGGAGTCGGTGCATCGTCGCGTCGTTATTCAGCAATATCGAGCACGCTCACGAACTGTCTGACT +>A-mutant-7 +TTCCGAATGGAATGCCCTAAACACTACAGGGTCGATGGGAATCGGTGCATCGTCCCGTCTTTATTCAGCAATATCGAGCACGCTCAAGAACTGTCTGACT +>A-mutant-8 +TTCCGAATGGAATGCCCTAAACACTACGAGGTCGATGGGAATCGGTGCATCGTCCCGTCTTGATTCAGCAATATCGAGCACGCTCAAGAGCTGTCTGACT +>A-mutant-9 +TTCCGAATGGAATGTCCTAAAGACTACGAGGTCGGTGGGCATCGGTGCATCGTCCCGTCTTGATTCATCAATATCGAGCACCCTCAAGAGCTGTCTGACT +>B +TTTCGAATGGAGTCCTTTGAAGAGTACGGCCTGTTCACGAGATGGCTCATGGTCGCCTCGTTTATCTGCAATTTCAACCACGGTCTAGGACCGTCTTACA +>B-mutant-1 +TTTCGAATGGAGTCCTTTGAAGAGTACGGCCTGTTCACGAGATGGCTCATGGTCGCCTCGTTTATCTGCATTGTCAACCACGGTCTAGGAACGTCTTACA +>B-mutant-2 +TTTCGAATCGAGTCCTTCGAAGAGAACGGTCTGTTCACGCGATGGCTCATAGTCGCCTCGTTTATCTGCATTGTCAACCACGGTCTAGGAACGTCTTACA +>B-mutant-3 +TTTCGAACCGAGTCCTTCGAAGAGAACGGTCTGTTCACGCGATGGCTCATAGTCGCCTCGTTTATCTGCATTGTCAACCACGGTCTAAGAACGTCTTACA +>B-mutant-4 +TTTCGAACCGAGTCCTTCGAAGAGAACGATCTGTGCACGCGATGGCTCATAGTCGCCTCGTTTATCTGCATTGTCAACCACGGTCTAACAACGTCTTACA +>B-mutant-5 +TTTCGAACAGAGTCCTTCGAAGAAAACGATCGGTGCACGCGATGGCTCACAGTCGCCTCGTTTATCTGCATTATCAAGCACGGTCTAACAACGTCTTACA +>B-mutant-6 +TTTCGATGATAGTCCTTCGAAGAAAACGAGCGGTGCAGGCGATGGCTCACAGTCGCCTCGTTTATGTGCGATATCAAGCACGGTCTAACATCGTCTTACA +>B-mutant-7 +TTTCGATGATAGTTCTTGGAAGAAAACGAGCGGTGCAGGCGATGGCTCACAATCGCCTCGTTTATGTGCGATATCAAGTACGGTCTAACATCGTCTCACA +>B-mutant-8 +TTTCAATGATAGTTCTTGGAAGAAAACGAGCGGGGCAGGCGATGACTCACAATCGCCTCGTTCATGTGCGATATGAAGTACGGTCTAACATCGTCTCACA +>B-mutant-9 +TTTCAATGATAGTTCTTGGAAGAAAACGAGCGGGGGAGGCGATGACTCACAATCGCCTCGTTCATGTGCGATATGAAGTACGGTCTAACATCGTCTCACA +>recombinant +TTTCGGATGGAATGCCCTGAAGAGTACGGGAAGTTCAGGAGTTGGCGCATGGTCGCCTCGTTTATCTGCAATATCAAGTACGGTCTAACATCGTCTCACA diff --git a/out5/recombinant-75A5-25B5-phyml.ascii b/out5/recombinant-75A5-25B5-phyml.ascii new file mode 100644 index 0000000..9373fd3 --- /dev/null +++ b/out5/recombinant-75A5-25B5-phyml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-B + | /-| + | | | /-B-mutant-1 + | | \-| +--| | | /-B-mutant-2 + | | \-| + | | | /-B-mutant-3 + | | \-| + | | | /-B-mutant-4 + | | \-| + | | | /-B-mutant-5 + \-| \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-8 + | \-| + | \-B-mutant-9 + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-recombinant + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/out5/recombinant-75A5-25B5-phyml.newick b/out5/recombinant-75A5-25B5-phyml.newick new file mode 100644 index 0000000..6f94596 --- /dev/null +++ b/out5/recombinant-75A5-25B5-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.03090855,A-mutant-8:0.00000001,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000001,(A-mutant-4:0.01017301,(recombinant:0.15816925,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,(A:0.00000001,(root:0.00000001,(B:0.00000001,(B-mutant-1:0.00000001,(B-mutant-2:0.00000000,(B-mutant-3:0.00000001,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000000,(B-mutant-7:0.00000000,(B-mutant-8:0.00000001,B-mutant-9:0.06370092)0.994873:0.02024217)1.000000:0.05223425)0.999952:0.03067781)0.999863:0.03085677)1.000000:0.08513543)0.999995:0.05285813)1.000000:0.05213104)0.999897:0.03098388)1.000000:0.09720493)1.000000:0.07509622)1.000000:0.07405154)0.996278:0.02034844)0.999999:0.04142813)0.446792:0.01288047)0.653233:0.03084952)0.999869:0.04150784)1.000000:0.06320203)0.999878:0.03090860)1.000000:0.06323620); diff --git a/out5/recombinant-75A5-25B5-raxml.ascii b/out5/recombinant-75A5-25B5-raxml.ascii new file mode 100644 index 0000000..a99676d --- /dev/null +++ b/out5/recombinant-75A5-25B5-raxml.ascii @@ -0,0 +1,44 @@ + + /-root + | + | /-A-mutant-1 + | | + | | /-recombinant + | | | + | | | /-A-mutant-7 + | | | /-| + | | /-| | | /-A-mutant-9 + | /-| | | /-| \-| +--| | | | | | | \-A-mutant-8 + | | | | | /-| | + | | | | | | | \-A-mutant-6 + | | | /-| \-| | + | | | | | | \-A-mutant-5 + | /-| | | | | + | | | \-| | \-A-mutant-4 + | | | | | + | | | | \-A-mutant-3 + | | | | + \-| | \-A-mutant-2 + | | + | \-A + | + | /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-4 + | | + \-| /-B-mutant-5 + | | + \-| /-B-mutant-7 + | /-| + | | | /-B-mutant-9 + \-| \-| + | \-B-mutant-8 + | + \-B-mutant-6 diff --git a/out5/recombinant-75A5-25B5-raxml.newick b/out5/recombinant-75A5-25B5-raxml.newick new file mode 100644 index 0000000..96c2f47 --- /dev/null +++ b/out5/recombinant-75A5-25B5-raxml.newick @@ -0,0 +1 @@ +((B-mutant-5:0.000001,((B-mutant-3:0.000001,((B-mutant-1:0.000001,(B:0.000001,(((A-mutant-1:0.000001,(((recombinant:0.157407,((((A-mutant-7:0.000001,(A-mutant-9:0.030737,A-mutant-8:0.000001)99:0.062833)91:0.030699,A-mutant-6:0.000001)100:0.062790,A-mutant-5:0.000001)99:0.041167,A-mutant-4:0.010250)66:0.030269)53:0.013150,A-mutant-3:0.000001)72:0.041197,A-mutant-2:0.000001)67:0.020260)95:0.073646,A:0.000001)96:0.074511,root:0.000001)96:0.096858)95:0.030858)97:0.051975,B-mutant-2:0.000001)96:0.052724)100:0.084715,B-mutant-4:0.000001)96:0.030699)98:0.030565,(B-mutant-7:0.000001,(B-mutant-9:0.063267,B-mutant-8:0.000001)77:0.020180)99:0.051960,B-mutant-6:0.000001):0.0; diff --git a/out5/recombinant-75A5-25B5.fasta b/out5/recombinant-75A5-25B5.fasta new file mode 100644 index 0000000..637a1ab --- /dev/null +++ b/out5/recombinant-75A5-25B5.fasta @@ -0,0 +1,44 @@ +>root +GGTCCGGTTACGTGTCTCCGATGTCACTATCAGAGGAACCTGCGGAATGACCAACTTCAACAATCTACGTCACCTTGATCCGGACAAGCACCGGGCCCAT +>A +GGTCCCGTAAAGTGTCTCCGATGTGACTATTAGAGGAACCCGCGGAATCACCAACTTCAACAATCTACGTCACCTTGATCCGGACAAGCACCGGGCCCAT +>A-mutant-1 +GGTCTCGTAAAGTGTCTCCGATGTGACTATTAGAGGAATCCGCGGAATAACCAGCTTCAACAATCTACGTCACCTTAATCCGGACAAGCACCAGCCCCAT +>A-mutant-2 +GGTCTCGTAAAGTATCTCCGATGTGACTATTAGAGGAATCCGCGGAATAACCAGCTTCAACAATCTACGTCACCTTAGTCCGGACAAGCACCAGCCCCAT +>A-mutant-3 +GGTCTCGTAAAGTATGTCCGATATGACTATTAGAGGAATCCGCGGAATAACCAGCTTCGACAATCTACGTCACCTTAGTCCGGACCAGCACCAGCCCCAT +>A-mutant-4 +GGTCTCGTAAAGTATGTCCGATATGACTATTAGAGGCATCCGCGGAATAACCAGCCTCGACAATCTACGTCACCTTAGTCCGGTCCAGCACCTGCTCCAT +>A-mutant-5 +GGTCTCGTAAAGTATGTCCGCTATGACTATTAGAGGAATCCGCGGAATAACCAGCCTAGACAATCTACGTCACCTTAGCCCGGTCCAACACCTGCTCCAT +>A-mutant-6 +TGTCTCGTAAAGTATGTCCGCTATGGCTATTAGAGGAATCCGCGGAATAACCAGCCTAAACAAGCTACTTCACCTTAGCCCGGTCCAACATCTGCTCCAT +>A-mutant-7 +TGTCTCGTAAAGTATGTCCGCTATGGCTATTATAGGAATCCGCGGAATAACCAGCCTAAACAAGCTACTTCACCTGAGCCAGGTCCAACATCTGCTCCAT +>A-mutant-8 +TGTCTCGTAAAGTATGTCCGCTATGGCTATTATAGGAATCCGCGGAATACCCAGCCTAGACAAGATCCTTCACCTGATCCAGGTCCAACATTTGCTCCAT +>A-mutant-9 +TGTCTCGTAAAGTATGTCAGCTATGGCTATTATAGGAATCCGCGGAATACCCCGCCTAGACAAGATCCTTCACCTGATCCAGGTCAAACATTTGCTCCAT +>B +CGTCCGGTTACGTGTCTCCGATGTCACTCTCAGAGGAACCTGCGGAATGACCAACTTAAACAACCTTCGTCACCTTGATCCGGACAGGTACCGGGCCTAG +>B-mutant-1 +CGTCCGGTTACGTGTCACCGATGTGACTCTCAGAGGAACCTGCGGAATGACCAACTTAAACAACCTTCTTCACCTTGATCCGGACAGGTACCGGGCCTAG +>B-mutant-2 +CGTCTGGTTACGTGTCACGGATGTGACTCTCAGGGGAGCCTGCGGAATGACCAACTTAAACAACCTTCTTCACCTTGATCCGGACAGCTACCGGGCCTAG +>B-mutant-3 +CGTCTGGTTACGTTTCACGGATCTGACTCTCAGGGGAGCCTGCGGAATGACCAACTAAAACAACCTACTTCACCTTGATCCGGACAGCTACCGGACCTAG +>B-mutant-4 +CGTCTGGTTACGTTTCATGGATCTGACCCTAAGGGGAGCCTGCGGAATGACCAGCTAAAATAACCTGCTTCACCTTGATCCGGAAAGCTACCGCACCTAG +>B-mutant-5 +CGTCTGGTTACGTTTCATGGATCTGACCCAAAGGGGAGCCTGCGGAATGACCAGCTAAAATACACTGCTTCACCTTGATCCGGAAAGCTACCGCACCTAG +>B-mutant-6 +CGTCTGGTTACGTTTCATGGATCTGACCCAAAGGGTAGCCTGCGGAATGACCAGCTAAAATACACTGCTTCACCTTGAGCCGGAAAGCTACCGAACCTAG +>B-mutant-7 +CGTCTGACTACGTTTCTTGGATCTGACCCAAAGGGTAGCCTGCGGAATGACCAGCTAAAATACACGGCTTCACCTTGCGCCGGAAAGCTACCGAACCTAG +>B-mutant-8 +CGTCTGACTACGTTTCTTGGATCTGACCCAAAGGGTAGCCCGCGGAATGACCAGCTAAAATACACGGCTTCACCTTGCGCCGGAAAGTTACCGAACCTAG +>B-mutant-9 +CGTCTGACCACGTTTCTTGGATCTGACCCAAAGGGTAGCCCGCGGAATGACCAGCTTAAATACACTGCTTCACCTTGCGCCGCAAAGTTACCGAACGGAG +>recombinant +GGTCTCGTAAAGTATGTCCGCTATGACTATTAGAGGAATCCGCGGAATAACCAGCCTAGACAATCTACGTCACCTTGATCCGGAAAGCTACCGCACCTAG diff --git a/out5/two-ladders-phyml.ascii b/out5/two-ladders-phyml.ascii new file mode 100644 index 0000000..7a5a2f5 --- /dev/null +++ b/out5/two-ladders-phyml.ascii @@ -0,0 +1,42 @@ + + /-root + | + | /-A + | /-| + | | | /-A-mutant-1 + | | \-| +--| | | /-A-mutant-2 + | | \-| + | | | /-A-mutant-3 + | | \-| + | | | /-A-mutant-4 + | | \-| + | | | /-A-mutant-5 + \-| \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-9 + | \-| + | \-A-mutant-8 + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/out5/two-ladders-phyml.newick b/out5/two-ladders-phyml.newick new file mode 100644 index 0000000..38195aa --- /dev/null +++ b/out5/two-ladders-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.02014905,B-mutant-8:0.00000000,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00000001,(B-mutant-2:0.00000000,(B-mutant-1:0.00000000,(B:0.00000001,(root:0.00656003,(A:0.00000001,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000001,(A-mutant-4:0.00000000,(A-mutant-5:0.00000000,(A-mutant-6:0.00000000,(A-mutant-7:0.00000001,(A-mutant-9:0.05207562,A-mutant-8:0.00000001)0.999996:0.04130705)0.999966:0.03074188)1.000000:0.05186429)0.999942:0.03062495)1.000000:0.07321183)1.000000:0.07400163)1.000000:0.05230410)0.998962:0.04149177)1.000000:0.14859296)1.000000:0.07775249)0.999919:0.03064696)0.999546:0.02032986)0.999991:0.04136794)0.999984:0.04120331)0.999996:0.04110460)1.000000:0.06245971)0.999972:0.03067728)1.000000:0.07359757); diff --git a/out5/two-ladders-raxml.ascii b/out5/two-ladders-raxml.ascii new file mode 100644 index 0000000..a3b6211 --- /dev/null +++ b/out5/two-ladders-raxml.ascii @@ -0,0 +1,42 @@ + + /-root + | + | /-B + | | + | | /-B-mutant-3 + | | | + | | | /-B-mutant-9 + | | | /-| +--| | | /-| \-B-mutant-8 + | /-| /-| | | + | | | | | /-| \-B-mutant-7 + | | | | | | | + | | | | | /-| \-B-mutant-6 + | | | /-| | | | + | | | | | \-| \-B-mutant-5 + | | | | | | + \-| \-| | \-B-mutant-4 + | | | + | | \-B-mutant-2 + | | + | \-B-mutant-1 + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/out5/two-ladders-raxml.newick b/out5/two-ladders-raxml.newick new file mode 100644 index 0000000..fcfd0d3 --- /dev/null +++ b/out5/two-ladders-raxml.newick @@ -0,0 +1 @@ +((A-mutant-6:0.000001,((((A-mutant-2:0.000001,((A:0.000001,((B:0.000001,(((B-mutant-3:0.000001,(((((B-mutant-9:0.020148,B-mutant-8:0.000001)100:0.073614,B-mutant-7:0.000001)98:0.030680,B-mutant-6:0.000001)100:0.062471,B-mutant-5:0.000001)96:0.041110,B-mutant-4:0.000001)97:0.041210)98:0.041375,B-mutant-2:0.000001)87:0.020332,B-mutant-1:0.000001)92:0.030652)100:0.077808,root:0.006529)100:0.148740)97:0.041502,A-mutant-1:0.000001)100:0.052319)100:0.074035,A-mutant-3:0.000001)100:0.073236,A-mutant-4:0.000001)97:0.030629,A-mutant-5:0.000001)100:0.051874)90:0.030746,A-mutant-7:0.000001,(A-mutant-9:0.052090,A-mutant-8:0.000001)92:0.041313):0.0; diff --git a/out5/two-ladders.fasta b/out5/two-ladders.fasta new file mode 100644 index 0000000..b983b7a --- /dev/null +++ b/out5/two-ladders.fasta @@ -0,0 +1,42 @@ +>root +GTCCGAAGACAAGTGGCGCATGTTAGCGAAAATTCAGTGTGCCGATCACCGGCCTCTTTTGACGCGTGGAGAGTCTGCCTCCGTAGATTGTTTCTACCCT +>A +CTCCAAAGCGACCTGGCGCATGTTAGCGCAAATTCAGTTTGCCGATCACCGGCCTCTTATGGCGCGTGGAGTGTCTGCGTCCGTAGATTTTCTCTACCCT +>A-mutant-1 +CTCCAAAGCGACCTGGCGCATGTTAGCGGAAATTCAGTTTTCCGATCACCCGCCTCTTATGGCGCGTAGAGTGTCTGCGTCCGTAGATTTTCTCTACCCT +>A-mutant-2 +CTCCAAAGCGACCTGGCGCAACTTGGCGGAAATTCAGTTTTCCGATCACCCGCCTCTTATGGCGCGTAGAGTGACTGCGTCGGTAGATTTTCTCTACCCT +>A-mutant-3 +CTCCAAGGCGACCTGGCGCAACTTGACGGAAAAGCCGTTTTCCGATCACCCGCATCTTATGGCGCGTAGAGTGACTGCGTCGGTAGATTTTCTCTACCCC +>A-mutant-4 +CTCCAAGGCTAGCTGGCGCAACTTGACGGAAAAGCCGTTTTCCGATCACCCGCATCTTATGGCGCGTAGACTCACTGCGTCGGTAGATTTTGGCTACCCG +>A-mutant-5 +CTCCAAGGCTAGCTGGCGCAAATTGACTGAAAAGCCGTTTTCCGATCATCCGCATCTTATGGCGCGTAGACTCACTGCGTCGGTAGATTTTGGCTACCCG +>A-mutant-6 +CTCCGACGCTAGCTGGCGCAAATTGACTGAAAAGCCGTTCTCCTATCATCCGCATCTTATGGCGCGTAGACTCACTGCGTCGCTAGATTTTGGCTACCCG +>A-mutant-7 +CTCCGACGCTAGGTAGCGCAAATTGACTGAAAAGCCGTTCTCCTATCATCCGCGTCTTATGGCGCGTAGACTCACTGCGTCGCTAGATTTTGGCTACCCG +>A-mutant-8 +ATCCGACTCTAGGTAGCGCAAATTGACTGAAAAGCCGTTCTCCTATCGTCCGCGTCTTATGGCGCGTAGACTCACTGCTTCGCTAGATTTTGGCTACCCG +>A-mutant-9 +ATCCGACTCTAGTTAGCGCAAATTGACTGAAAAGCAGTTCTCCTATCGTCCGCACCTTATGGCGCGTAGACTCACTGCTTCGCTAGATTTTGGCTAGCCG +>B +GTCCAAAGACAAGTGGCGCATGTTAGCGAAAATTCAGTGTGCCGCTCGCTGGCCTCTTTTGACGCGTGTAGATTTTGCCTCCGTAGAGTGTTTCTACCCT +>B-mutant-1 +GTCCAAAGACAAGTGGCGCATGTTAGCGAAAACTCAGTGTGCCGCTCGCTGGCCTCTTTTGACGCGTATAGATTTTGCCTCCGGAGAGTGTTTCTACCCT +>B-mutant-2 +GTCCAAAGACAAGTGGCGCATGTTAGCGAAAACTCAGTGTGCCGCTCGCTGGCCTCTTTCGACGCGTATTGATTTTGCCTCCGGAGAGTGTTTCTACCCT +>B-mutant-3 +GTCCATAGACAAGTGGCGCATGTTAGCGAAAACTCAGTGTGTCGCACGCTGGCCTCTTTCGACGCGTATTGATTTTGCCTCCGGACAGTGTTTCTACCCT +>B-mutant-4 +GTCCATAGACAAGTGGCGCATGTTAGCGAAAGCTCAGGGTGTCGCCCGCTGGCCTCTTTCGACGCGTATTGATTTTGCCTCGGGACAGTGTTTCTACCCT +>B-mutant-5 +GTCCATAGACAAGTGGCGCATGTTAGCGGAAGCTCAGGGTGTCGCCCGCTGGCCTCTTTCGACGCGTATTGATTTGGCCTCGGGACGCTGTTTCTACCCT +>B-mutant-6 +GTCCATAGAGAAGGGGCGCATGGTAGCGGAAGCTCAGCGTGTCGCCCGCTAGCCTCTTTCGACGCGTATTGATTTGGCCTCGGGCCGCTGTTTCTACCCT +>B-mutant-7 +GTCCATAGAGAAGGGGCGCCTGGTAGCGGAAGCTCAGCGTGTCGCCCGCTAGCCTCTTTCGACGCGTATTGATCTGGCCTCGGGCCGCTGTTTCTACCCA +>B-mutant-8 +GACCATAGAGAAGGGGCGCCTGGTAGTTGAAGCTCAGCGTGTCGCCCGCTAGCCACATTTGACGCGTATTGATCTGGCCTCGGGCCGCTGTTTCTACACA +>B-mutant-9 +GACCATAGAGAAGGGGCGCCTGGTAGTTGACGCTCAGCGTGTCGCCCGCTAGCCACATTTGACGCGTATTGATCTGGCCTCGGGCCGCTGTTTTTACACA diff --git a/recombinationgradients/recombinationgradient_A1B1/Makefile b/recombinationgradients/recombinationgradient_A1B1/Makefile new file mode 100644 index 0000000..fc2618b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/Makefile @@ -0,0 +1,52 @@ +OUTGROUP := root +OUTDIR := out + +.PRECIOUS: $(OUTDIR)/%.fasta $(OUTDIR)/%.newick + +JSON := $(wildcard *.json) + +PHY := $(patsubst %.json, $(OUTDIR)/%.phy, $(JSON)) +FASTA := $(patsubst %.json, $(OUTDIR)/%.fasta, $(JSON)) +PHYML_ASCII := $(patsubst %.json, $(OUTDIR)/%-phyml.ascii, $(JSON)) +RAXML_ASCII := $(patsubst %.json, $(OUTDIR)/%-raxml.ascii, $(JSON)) +PHYML_NEWICK := $(patsubst %.json, $(OUTDIR)/%-phyml.newick, $(JSON)) +RAXML_NEWICK := $(patsubst %.json, $(OUTDIR)/%-raxml.newick, $(JSON)) + +ASCII := $(PHYML_ASCII) $(RAXML_ASCII) +NEWICK := $(PHYML_NEWICK) $(RAXML_NEWICK) + +all: $(OUTDIR) $(ASCII) $(NEWICK) + +out: + test -d $(OUTDIR) || mkdir $(OUTDIR) + +$(OUTDIR)/%.fasta : %.json + seq-gen.py --specification $< > $@ + +$(OUTDIR)/%.phy: $(OUTDIR)/%.fasta + fasta-to-phylip.py < $< > $@ + +$(OUTDIR)/%-phyml.newick: $(OUTDIR)/%.phy + phyml -m GTR -q -i $< -o tlr -f m -v e --run_id xxxxx >/dev/null + mv $(OUTDIR)/*_tree_xxxxx.txt $@ + rm -f $(OUTDIR)/*.phy_phyml_*_xxxxx* + +$(OUTDIR)/%-raxml.newick: $(OUTDIR)/%.phy + raxml-ng --msa $< --model GTR+G --prefix xxxxx --seed $$RANDOM --threads 1 >/dev/null + mv xxxxx.raxml.bestTree $@ + rm -f xxxxx.* + +$(OUTDIR)/%.ascii: $(OUTDIR)/%.newick + newick-to-ascii.py --outgroup $(OUTGROUP) < $< > $@ + +uptree_branchlength: + uptree_branchlength.sh + +minimal_branchlength: + minimal_branchlength.sh + +clean: + rm -f $(ASCII) $(NEWICK) $(PHY) $(OUTDIR)/*xxxxx* xxxxx.* + +clobber: clean + rm -fr $(OUTDIR) diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/outtest b/recombinationgradients/recombinationgradient_A1B1/out1/outtest new file mode 100644 index 0000000..b3aefb2 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/outtest @@ -0,0 +1,405 @@ +Analysing sample: recombinant-10A1-B1-raxml.newick + + /-A + | + | /-A-mutant-1 + /-| | + | | | /-A-mutant-3 + | | | | + | | | | /-A-mutant-7 + | \-| | /-| + | | /-| | | /-A-mutant-8 + | | | | /-| \-| + | | | | | | \-A-mutant-9 + | | | | /-| | +--| | | | | | \-A-mutant-6 + | \-| \-| | + | | | \-A-mutant-5 + | | | + | | \-A-mutant-4 + | | + | \-A-mutant-2 + | + | /-B + | | + \-| /-B-mutant-1 + | | + \-| /-recombinant + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-4 + | | + | | /-B-mutant-6 + \-| /-| + | | | /-B-mutant-7 + | | \-| + \-| | /-B-mutant-8 + | \-| + | \-B-mutant-9 + | + \-B-mutant-5 +Distance of A1 to recombinant is 0.345363 +Distance of B1 to recombinant is 0.030494 +Analysing sample: recombinant-20A1-B1-raxml.newick + + /-A + | + | /-A-mutant-6 + | | + | /-| /-A-mutant-8 + | | | /-| + | | \-| \-A-mutant-9 + /-| /-| | + | | | | \-A-mutant-7 + | | /-| | + | | | | \-A-mutant-5 + | | /-| | + | | | | \-A-mutant-4 + | | /-| | +--| | | | \-A-mutant-3 + | \-| | + | | \-A-mutant-2 + | | + | \-A-mutant-1 + | + | /-recombinant + | | + \-| /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + | | /-B-mutant-3 + \-| | + | | /-B-mutant-7 + | | /-| + \-| | | /-B-mutant-8 + | /-| \-| + | | | \-B-mutant-9 + | /-| | + | | | \-B-mutant-6 + \-| | + | \-B-mutant-5 + | + \-B-mutant-4 +Distance of A1 to recombinant is 0.245761 +Distance of B1 to recombinant is 0.054719 +Analysing sample: recombinant-30A1-B1-raxml.newick + + /-B-mutant-2 + /-| + | | /-B-mutant-3 + | \-| + | | /-B-mutant-4 + | \-| + | | /-B-mutant-5 + | \-| + /-| | /-B-mutant-6 + | | \-| + | | | /-B-mutant-7 + | | \-| + | | | /-B-mutant-9 + /-| | \-| + | | | \-B-mutant-8 + | | | + | | \-B-mutant-1 +--| | + | \-B + | + | /-recombinant + | | + \-| /-A + | | + \-| /-A-mutant-1 + | | + | | /-A-mutant-2 + \-| | + | | /-A-mutant-4 + | | /-| + \-| | | /-A-mutant-5 + | | \-| + | | | /-A-mutant-6 + | | \-| + \-| | /-A-mutant-7 + | \-| + | | /-A-mutant-8 + | \-| + | \-A-mutant-9 + | + \-A-mutant-3 +Distance of A1 to recombinant is 0.194895 +Distance of B1 to recombinant is 0.061668 +Analysing sample: recombinant-40A1-B1-raxml.newick + + /-B-mutant-1 + | + | /-B-mutant-2 + | | + | | /-B-mutant-5 + | | | + /-| | /-| /-B-mutant-9 + | | /-| | | /-| + | | | | | | | | /-B-mutant-7 + | | | | | \-| \-| + | | | | /-| | \-B-mutant-8 + | | | | | | | + | \-| | | | \-B-mutant-6 + /-| | \-| | + | | | | \-B-mutant-4 + | | | | + | | | \-B-mutant-3 + | | | +--| | \-B + | | + | \-recombinant + | + | /-A + | | + \-| /-A-mutant-1 + | | + | | /-A-mutant-2 + \-| | + | | /-A-mutant-5 + | | | + | | /-| /-A-mutant-6 + \-| | | | + | | \-| /-A-mutant-9 + | | | /-| + | /-| \-| \-A-mutant-8 + | | | | + | | | \-A-mutant-7 + \-| | + | \-A-mutant-4 + | + \-A-mutant-3 +Distance of A1 to recombinant is 0.152118 +Distance of B1 to recombinant is 0.110654 +Analysing sample: recombinant-50A1-B1-raxml.newick + + /-recombinant + | + | /-B-mutant-1 + | | + | | /-B-mutant-2 + | /-| | + /-| | | | /-B-mutant-4 + | | | | | | + | | | \-| /-| /-B-mutant-5 + | | | | | | | + | | | | | | | /-B-mutant-9 + | | | | | \-| /-| + | \-| | | | /-| \-B-mutant-8 + | | \-| | | | +--| | | \-| \-B-mutant-7 + | | | | + | | | \-B-mutant-6 + | | | + | | \-B-mutant-3 + | | + | \-B + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + \-A-mutant-9 +Distance of A1 to recombinant is 0.183151 +Distance of B1 to recombinant is 0.154438 +Analysing sample: recombinant-60A1-B1-raxml.newick + + /-A + | + | /-A-mutant-1 + /-| | + | | | /-A-mutant-3 + | | | | + | | | /-| /-A-mutant-4 + | \-| | | | + | | | | | /-A-mutant-6 + | | | \-| /-| + | | | | | | /-A-mutant-7 + | | | | | \-| +--| \-| \-| | /-A-mutant-9 + | | | \-| + | | | \-A-mutant-8 + | | | + | | \-A-mutant-5 + | | + | \-A-mutant-2 + | + | /-recombinant + | | + \-| /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-4 + | | + \-| /-B-mutant-5 + | | + \-| /-B-mutant-6 + | | + \-| /-B-mutant-9 + | /-| + \-| \-B-mutant-8 + | + \-B-mutant-7 +Distance of A1 to recombinant is 0.088498 +Distance of B1 to recombinant is 0.155604 +Analysing sample: recombinant-70A1-B1-raxml.newick + + /-B-mutant-5 + /-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + /-| \-| + | | | /-B-mutant-9 + | | \-| + /-| | \-B-mutant-8 + | | | + | | \-B-mutant-4 + /-| | + | | \-B-mutant-3 + | | + /-| \-B-mutant-2 + | | + | | /-B + /-| \-| + | | \-B-mutant-1 + | | + | \-recombinant +--| + | /-A + | | + | | /-A-mutant-1 + | | | + \-| | /-A-mutant-5 + | | | + | | /-| /-A-mutant-6 + | | | | | + \-| | \-| /-A-mutant-8 + | | | /-| + | /-| \-| \-A-mutant-9 + | | | | + | | | \-A-mutant-7 + | | | + \-| | /-A-mutant-4 + | \-| + | \-A-mutant-3 + | + \-A-mutant-2 +Distance of A1 to recombinant is 0.117447 +Distance of B1 to recombinant is 0.194680 +Analysing sample: recombinant-80A1-B1-raxml.newick + + /-B-mutant-2 + | + | /-B-mutant-3 + /-| | + | | | /-B-mutant-6 + | | | | + | \-| /-| /-B-mutant-9 + | | | | /-| + | | | \-| \-B-mutant-8 + /-| | /-| | + | | | | | \-B-mutant-7 + | | \-| | + | | | \-B-mutant-5 + /-| | | + | | | \-B-mutant-4 + | | | + | | \-B-mutant-1 +--| | + | \-B + | + | /-A + | | + \-| /-recombinant + | /-| + | | \-A-mutant-1 + \-| + | /-A-mutant-2 + | | + \-| /-A-mutant-3 + | | + \-| /-A-mutant-4 + | | + \-| /-A-mutant-5 + | | + | | /-A-mutant-8 + \-| /-| + | /-| \-A-mutant-9 + | | | + \-| \-A-mutant-7 + | + \-A-mutant-6 +Distance of A1 to recombinant is 0.020100 +Distance of B1 to recombinant is 0.289771 +Analysing sample: recombinant-90A1-B1-raxml.newick + + /-A + | + | /-A-mutant-4 + | | + | | /-A-mutant-7 + | /-| /-| + | | | | | /-A-mutant-9 + /-| | | /-| \-| + | | | | | | \-A-mutant-8 + | | /-| \-| | + | | | | | \-A-mutant-6 + | | | | | + | | /-| | \-A-mutant-5 + | | | | | + | | | | \-A-mutant-3 +--| \-| | + | | \-A-mutant-2 + | | + | | /-recombinant + | \-| + | \-A-mutant-1 + | + | /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-4 + | | + \-| /-B-mutant-5 + | | + \-| /-B-mutant-6 + | | + \-| /-B-mutant-9 + | /-| + \-| \-B-mutant-8 + | + \-B-mutant-7 +Distance of A1 to recombinant is 0.020489 +Distance of B1 to recombinant is 0.274911 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1-phyml.ascii new file mode 100644 index 0000000..353176b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-9 + | +--|--A-mutant-8 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-recombinant + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1-phyml.newick new file mode 100644 index 0000000..e9de034 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.02028509,A-mutant-8:0.00000001,(A-mutant-7:0.00000001,(A-mutant-6:0.00000001,(A-mutant-5:0.00000001,(A-mutant-4:0.00000000,(A-mutant-3:0.00000001,(A-mutant-2:0.00000001,(A-mutant-1:0.00000001,(A:0.00000001,(B:0.00000001,(B-mutant-1:0.00000001,(recombinant:0.02051124,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00000001,(B-mutant-5:0.01010693,(B-mutant-6:0.00000000,(B-mutant-7:0.00000000,(B-mutant-9:0.07629834,B-mutant-8:0.00000000)0.931714:0.01024042)1.000000:0.04199509)0.999938:0.03136951)0.994969:0.02073973)0.999585:0.02047070)1.000000:0.04158767)0.997674:0.02060346)0.546637:0.01011949)0.997944:0.04130668)1.000000:0.22331576)0.999617:0.05131471)0.999728:0.03045131)1.000000:0.09585115)0.999970:0.04070547)0.999997:0.04109739)1.000000:0.05194491)1.000000:0.06263605)0.999911:0.04099353); diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1-raxml.ascii new file mode 100644 index 0000000..d2ddf5f --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-6 + /-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-8 + | \-| + | \-B-mutant-9 + | + |--B-mutant-5 + | + | /-recombinant + | | + | | /-B-mutant-1 + | | | + | /-| | /-A + | | | | | + | | | | | /-A-mutant-1 + | | | | /-| | +--| | \-| | | | /-A-mutant-3 + | | | | | | | + | | | | | | | /-A-mutant-7 + | | | | \-| | /-| + | | | | | /-| | | /-A-mutant-8 + | | | | | | | /-| \-| + | | | | | | | | | \-A-mutant-9 + | /-| \-| | | | /-| | + | | | | | | | | | \-A-mutant-6 + | | | | \-| \-| | + | | | | | | \-A-mutant-5 + | | | | | | + | | | | | \-A-mutant-4 + | /-| | | | + | | | | | \-A-mutant-2 + | | | | | + | | | | \-B + \-| | | + | | \-B-mutant-2 + | | + | \-B-mutant-3 + | + \-B-mutant-4 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1-raxml.newick new file mode 100644 index 0000000..fb0bc1a --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1-raxml.newick @@ -0,0 +1 @@ +((B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-8:0.000001,B-mutant-9:0.075992):0.010183):0.041754):0.031182,B-mutant-5:0.010116,((((recombinant:0.020407,(B-mutant-1:0.000001,((A:0.000001,(A-mutant-1:0.000001,((A-mutant-3:0.000001,((((A-mutant-7:0.000001,(A-mutant-8:0.000001,A-mutant-9:0.020249):0.040878):0.062371,A-mutant-6:0.000001):0.051672,A-mutant-5:0.000001):0.040891,A-mutant-4:0.000001):0.040421):0.095469,A-mutant-2:0.000001):0.030268):0.050943):0.222810,B:0.000001):0.041116):0.010086):0.020541,B-mutant-2:0.000001):0.041366,B-mutant-3:0.000001):0.020352,B-mutant-4:0.000001):0.020595):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1.fasta new file mode 100644 index 0000000..5401a9b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-10A1-B1.fasta @@ -0,0 +1,42 @@ +>A +CTTTCCCGATTCTATCCGACAGGACGACGGTTATTCACATAGAAGGTACAGGCTAAGACGGCCCACCCTAGGAGTTTTCTGTGGGTAGCCGGGAGACCAA +>A-mutant-1 +CTTTCCCGATTCTATCCGACAGGACGACGGATATTCGCATAGAAGCTACAGGCTAAGACGGCCCACCCTAGGAGTTTTCTGTGAGTAGCCGGGAGAGCAA +>A-mutant-2 +CTTTCCCGAATCTAACCGACAGGACGACGGATATTCGCATAGAAGCTACAGGTTAAGACGGCCCACCCTAGGAGTTTTCTGTGAGTAGCCGGGAGAGCAA +>A-mutant-3 +CTTTCCCGAATCTAATCGACTGGACGACGGATAGTGGCATAGAAGCAACAGCTTAAGACGGCCCGCCCTAGGAGTTTTCTTTGAGGAGCCGGGAGAGCAA +>A-mutant-4 +CTTTGCCGAATCTAATCGACTGGACGACCGATAGTGGCATAGAAGGAACAGCTTAAGACGGCCCGCCCTAGGAGTTTTCTTTAAGGAGCCGGGAGAGCAA +>A-mutant-5 +CTATGCCGAATCTAATCGACTGGACGACCGATAGTCGCACAGAAGGAACAGCTTAAGACGGCCCGCCCTAGGAGTATTCTTTAAGGAGCCGGGAGAGCAA +>A-mutant-6 +CTATGCCGAATCTCATCGACTGGACGACCGATAGTCTCACAGAAGGAACAGCTTCAGACGGCCCGCCCTAATAGTATTCTTTAAGGAGCCGGGAGAGCAA +>A-mutant-7 +CTATGCCGAATCTCATCGACTGGACGACCGATAGTCTCACAGAAGGTACAGCTTCAGACGGCCCGCCCTAATAGTATTCGTTCAAGAGCCTGGAGAGAAA +>A-mutant-8 +CTATGCCGAATCTCATCGACTAGAAGACCGATAGTCTCACAGAAGGTACAGCTTCAGACGGCCCGCCCTAATAGTATTCGTTGAAGAGCCTGGAGAGAAC +>A-mutant-9 +CTATGCCGAATCTCATCGACTAGAAGACCGATAGTCTCACAGAAGATACAGCCTCAGACGGCCCGCCCTAATAGTATTCGTTGAAGAGCCTGGAGAGAAC +>B +CTTTCGCGCGTCTATAGAACAGGACGACGGGGATTCACAGAGAAGGTACATACTAAGACGCCCCACCCTGGGTGATTTCAGGGGGTAGCCGGGAGACCGG +>B-mutant-1 +CTTTCGCGCGTCTCAAGAACAGGACGACGGGGATTGACAGAGAAGGTACATACTAAGACGCCCCACCCTGGGTGATTTCAGGGGGTCGCCGGGAGACCGG +>B-mutant-2 +CTTTCCCGCGTCTCAAGAACAGGACGACGGGGATTGACAGAGAAGGTACATACTAAGACGCCCCACCCTGGGTGATTTCAGGGGGTAGCCGGGAGACCGC +>B-mutant-3 +CTTTCCCGCGTCGCAAGAACAGGACGACGGGGATTGACAAAGAAGGTACATACTAAGACGTCCCACCCTGGGTGATTTCAGGGGGTAGCCGTGAGACCGC +>B-mutant-4 +CTTTCCCGCGTCGCAAGAACAGGACGACGGGGATTGACAAAGAAGGTACATACTAAGACGTCCCACCCTGGGCGATGTCAGGGGGTAGCCGTGAGACCGC +>B-mutant-5 +CTTTCCCGCGTCGCAGGAACAGGACGACGGGGATTGACAAAGAAGGTACGTACTAAGACGTCCCACCCTGGGCGATGTCGGGGGGTAGCCGTGAGACCGC +>B-mutant-6 +CTTTCCCGAGTCGCAGGAACAGGACGACGGGGATTGACAAAGAGGGTACAAACTAAGACGTCCCACCCTGGGCGATGTCGGGGGGTAGCCGTGAGACCGC +>B-mutant-7 +CTCTCCCGAGTCGCAGCAACAGGACGACGGGGATAGACAAAGAGGGTACAAACTAAGACGTCCCACCCTGGGCGTTGTCGGGGGGTAGCCGTGAGACCGC +>B-mutant-8 +CTCTCCCGAGTCGCAGCAACAGGACGACGGGGATAGACAAAGAGCGTACAAACTAAGACGTCCCACCCTGGGCGTTGTCGGGGGGTAGCCGTGAGACCGC +>B-mutant-9 +CTCTCCCGAGGCGCAGCAACAGGACGCCGGGGATAGACAAAGAGCGTACAACCTAAGACGTCCCACCCTACGCGTTGTCGGGGGGAAGCCGTGAGATCGC +>recombinant +CTTTCCCGATTCTCAAGAACAGGACGACGGGGATTGACAGAGAAGGTACATACTAAGACGCCCCACCCTGGGTGATTTCAGGGGGTCGCCGGGAGACCGG diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1-phyml.ascii new file mode 100644 index 0000000..c3b31c1 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-8 + | +--|--B-mutant-9 + | + | /-B-mutant-7 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-1 + \-| + | /-B + \-| + | /-recombinant + \-| + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1-phyml.newick new file mode 100644 index 0000000..ea2c6df --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000001,B-mutant-9:0.00996625,(B-mutant-7:0.00000000,(B-mutant-6:0.00000001,(B-mutant-5:0.00000000,(B-mutant-4:0.00000001,(B-mutant-3:0.00000001,(B-mutant-2:0.00000001,(B-mutant-1:0.00000000,(B:0.04929015,(recombinant:0.00000001,(A:0.00000001,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000000,(A-mutant-4:0.00000000,(A-mutant-5:0.00986032,(A-mutant-6:0.00000001,(A-mutant-7:0.00000000,(A-mutant-9:0.05259387,A-mutant-8:0.01005279)0.992600:0.02059894)0.999999:0.05166729)1.000000:0.06372019)0.999364:0.03131407)0.999998:0.04109851)1.000000:0.07350837)1.000000:0.06358459)0.999993:0.06322321)1.000000:0.18245104)0.676055:0.02652142)0.991355:0.02817760)1.000000:0.06258926)1.000000:0.07342466)0.999999:0.04100530)1.000000:0.07369626)1.000000:0.06240685)1.000000:0.07346334)0.999957:0.03044636); diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1-raxml.ascii new file mode 100644 index 0000000..d9ca344 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-3 + | + | /-B-mutant-2 + | | + | | /-A + | | | + /-| | | /-A-mutant-6 + | | | | | + | | | | /-| /-A-mutant-8 + | | | | | | /-| + | | | | | \-| \-A-mutant-9 + | | | /-| /-| | + | | | | | | | \-A-mutant-7 + | \-| | | /-| | + | | | | | | \-A-mutant-5 + | | | | /-| | + | | | | | | \-A-mutant-4 + | | /-| | /-| | + | | | | | | | \-A-mutant-3 + | | | | \-| | + | | | | | \-A-mutant-2 + | | /-| | | + | | | | | \-A-mutant-1 +--| | | | | + | \-| | \-recombinant + | | | + | | \-B + | | + | \-B-mutant-1 + | + | /-B-mutant-7 + | /-| + | | | /-B-mutant-8 + | /-| \-| + | | | \-B-mutant-9 + |--| | + | | \-B-mutant-6 + | | + | \-B-mutant-5 + | + \-B-mutant-4 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1-raxml.newick new file mode 100644 index 0000000..700b3ed --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1-raxml.newick @@ -0,0 +1 @@ +((B-mutant-3:0.000001,(B-mutant-2:0.000001,((((A:0.000001,((((((A-mutant-6:0.000001,((A-mutant-8:0.010054,A-mutant-9:0.052597):0.020597,A-mutant-7:0.000001):0.051667):0.063729,A-mutant-5:0.009858):0.031319,A-mutant-4:0.000001):0.041099,A-mutant-3:0.000001):0.073516,A-mutant-2:0.000001):0.063598,A-mutant-1:0.000001):0.063239):0.182520,recombinant:0.000001):0.026532,B:0.049285):0.028185,B-mutant-1:0.000001):0.062595):0.073426):0.041003,(((B-mutant-7:0.000001,(B-mutant-8:0.000001,B-mutant-9:0.009965):0.030444):0.073463,B-mutant-6:0.000001):0.062411,B-mutant-5:0.000001):0.073704,B-mutant-4:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1.fasta new file mode 100644 index 0000000..ef4d06f --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-20A1-B1.fasta @@ -0,0 +1,42 @@ +>A +TCCCACATCGAGAGACACGGCAAAAAGATCTTAACCCAGTCATGGGCTAGGTCGCTGCAGCTAGAGTCCACTTTAAACAGCCATGCTTCTCGCCTACCGC +>A-mutant-1 +TCCCACATCGAGAGACACGGCCAAAAGATATTAACCCAGTCATGGGCTAGGTCGCTCCAGCTAGAGTCCACTTTAAACACCCAGGCTTCTCGCCTGCCGC +>A-mutant-2 +TCCTACGTCGAGAGACACGGCCAAAAGATATTAACCTAGTCATGGTCTAGGTCGCTCCAGCTAGAGTCCACATTAAAAACCCAGGCTTCTCGCCTGCCGC +>A-mutant-3 +TCCTACGTCAAGAGACACGGCCAATAGATATTAACCTAGTGATGGTCTAGGCCGCTCCAGCTAGAGTCCTCATTAAAAACCCAGGCTTGTCGCGTGCCGC +>A-mutant-4 +TCCTACGTCAAGAGACACGGCCAATAGATATTAACCTACTGATGGTCTAGTCAGCTCCACCTAGAGTCCTCATTAAAAACCCAGGCTTGTCGCGTGCCGC +>A-mutant-5 +TCCTACGTCAAGACACACGACCATTAGATATTAACCTACTGATGGTCTAGTCAGCTCCACCTAGAGTCCGCATTAAAAACCCAGGCTTGTCGCGTGCCGC +>A-mutant-6 +CCCTACGTCAAGACAAACGGCGATTAGATATTAACCTGCTGATGGTCTAGTCAGCTCCACCTACAGTCCGCATTAAAAACGCAGGCTTGTCGCGTGCCGC +>A-mutant-7 +CCCTACGTCAAGACAAAGGGCTATTAGATATTAACCTGCTGATGGTCTAGTCAGCTCCACCAACAGTCCGCATTAAAAACGCAGGCTTGTAGCGTGCCCC +>A-mutant-8 +CCCTACGTCAAGACAAAGGGATATTAGATATTAACCTGCTGATGGTCTAGTCAGCTCCACCAACAGTCCGCATTAAAAACACAGGCTTGTAGCTTGCCCC +>A-mutant-9 +CCCTACGTCAAGACAAAGGGCTATTAGATATTAACATGCTGAGGGTCTAGTCAGCTCCACCAACAGTCCGCAATAAAAACACAGGCTTCTACCTTGCCCC +>B +TCCGACATCGAGAAACAGGACAAAAAGATCTTTTCCCCGTAATGAGCTAGGTCGCTGCAGCTCAAGTCCACTTTAAGACGTCATGCTACTCGCCTACCGG +>B-mutant-1 +TCCCAAAACGAGAAACAAGACAAAAAGATGTGTTCCCCGTAATGAGCTAGGTCGCTGCAGCTCAAGTCCACTTTAAGACGTCATGCAACTCGCCTACCGG +>B-mutant-2 +TCCCTAAACGAGAAACAAGACAAAAAGATGTGTTCCCTGTAATGAGCTAGGTCGCTGGAGCTCAAGTCCACTTTAAGACGTGATGCAACTCCCCGACCGG +>B-mutant-3 +TCCCTAAACGAGAAATAAGACAAAAAGATGTGTTCCCTGTAATGAGCTAGGTCGATGTGGGTCAAGTCCTCTTTAAGACGTGATGCAACTCCCCGCCCGG +>B-mutant-4 +TCCCTTAACGAGAACTAAGACAAAAAGACGTGTTCCCTGTAATGAGCTAGGCCGATGTGGGTCAAGTCCTCTTTAAGACGTGATGCAACTCCCCGCCCGG +>B-mutant-5 +TCCCATAACGAGAACTATGACAAAAAGACGTGTTCCCTGTAATGAGCTAGGCCGATATGGGTCAAGTCCCCTTCAAGACGAGATGCAACTCCCCGCCAGG +>B-mutant-6 +TCCCATAACAAGAACTATGGGAAAAAGACGTGTTCCCTGTAATCAGCTAGGCCGATATGGGTCAAGTCCCCTTCATGACGAGATGCAACTCCCCGCAAGG +>B-mutant-7 +TCCCATAACAAGAACTTGGTGAAAAAGACGTGTTCCCTGTGGTCAGCTAGGCCGATATGGGTCAAGTCCCCTTCATGACGAAATGCTACTCCCCGCAAGG +>B-mutant-8 +TCCCATAACAAGAACTTGGTGAAAAAGACGTGTTCCCTGGGGTCAGCTAGGCCGTTATGGGTCAAGCCCCCTTCATGACGAAATGCTACTCCCCGCAAGG +>B-mutant-9 +TCCCATAACAAGAACTTGGTGAAAAAGACGTGTTCCCTGGGGTCAGCTAGGCCGTTATGGGTCAAGCCCCCATCATGACGAAATGCTACTCCCCGCAAGG +>recombinant +TCCCACATCGAGAGACACGGCAAAAAGATGTGTTCCCCGTAATGAGCTAGGTCGCTGCAGCTCAAGTCCACTTTAAGACGTCATGCAACTCGCCTACCGG diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1-phyml.ascii new file mode 100644 index 0000000..c3b31c1 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-8 + | +--|--B-mutant-9 + | + | /-B-mutant-7 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-1 + \-| + | /-B + \-| + | /-recombinant + \-| + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1-phyml.newick new file mode 100644 index 0000000..8445574 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000001,B-mutant-9:0.02054982,(B-mutant-7:0.00000000,(B-mutant-6:0.00974960,(B-mutant-5:0.00000000,(B-mutant-4:0.01275699,(B-mutant-3:0.01244704,(B-mutant-2:0.00000001,(B-mutant-1:0.00000001,(B:0.01002834,(recombinant:0.00000001,(A:0.01116821,(A-mutant-1:0.00000001,(A-mutant-2:0.00000000,(A-mutant-3:0.00000000,(A-mutant-4:0.00000000,(A-mutant-5:0.00000000,(A-mutant-6:0.00000001,(A-mutant-7:0.00000001,(A-mutant-9:0.01004988,A-mutant-8:0.00000000)0.999964:0.03059108)0.999999:0.04111547)0.999999:0.04085331)1.000000:0.04094073)0.999230:0.02014995)1.000000:0.05152103)0.999997:0.04060748)0.960654:0.02910626)1.000000:0.16837867)0.999676:0.04141869)0.992729:0.02047412)1.000000:0.09664241)1.000000:0.07435950)0.999590:0.04934563)0.999990:0.05145215)0.999854:0.03158741)0.999975:0.04229328)1.000000:0.10919671); diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1-raxml.ascii new file mode 100644 index 0000000..2363710 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-2 + /-| + | | /-B-mutant-3 + | \-| + | | /-B-mutant-4 + | \-| + | | /-B-mutant-5 + | \-| + /-| | /-B-mutant-6 + | | \-| + | | | /-B-mutant-7 + | | \-| + | | | /-B-mutant-9 + /-| | \-| + | | | \-B-mutant-8 + | | | + /-| | \-B-mutant-1 + | | | + | | \-B + /-| | + | | \-recombinant + | | + | \-A + | +--|--A-mutant-1 + | + | /-A-mutant-2 + | | + | | /-A-mutant-4 + | | /-| + \-| | | /-A-mutant-5 + | | \-| + | | | /-A-mutant-6 + | | \-| + \-| | /-A-mutant-7 + | \-| + | | /-A-mutant-8 + | \-| + | \-A-mutant-9 + | + \-A-mutant-3 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1-raxml.newick new file mode 100644 index 0000000..8797d8c --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1-raxml.newick @@ -0,0 +1 @@ +((((((B-mutant-2:0.000001,(B-mutant-3:0.012491,(B-mutant-4:0.012839,(B-mutant-5:0.000001,(B-mutant-6:0.009775,(B-mutant-7:0.000001,(B-mutant-9:0.020470,B-mutant-8:0.000001):0.107984):0.041982):0.031376):0.051088):0.048904):0.073610):0.095777,B-mutant-1:0.000001):0.020415,B:0.010010):0.041251,recombinant:0.000001):0.165925,A:0.011282):0.028968,A-mutant-1:0.000001,(A-mutant-2:0.000001,((A-mutant-4:0.000001,(A-mutant-5:0.000001,(A-mutant-6:0.000001,(A-mutant-7:0.000001,(A-mutant-8:0.000001,A-mutant-9:0.010035):0.030502):0.040941):0.040685):0.040759):0.020096,A-mutant-3:0.000001):0.051281):0.040506):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1.fasta new file mode 100644 index 0000000..8c431e7 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-30A1-B1.fasta @@ -0,0 +1,42 @@ +>A +ACGGTCGGTTTTTTGACGACAATCTTGCCGATCTGAGCCAAGAGCGTTATCTCCCTCCCCGCTAGCGTTGAGTTCCGCCGGCCGTCTATAAAGGAGACTA +>A-mutant-1 +ACGGTCGGTTTTTTGACGACAATCTTGCCGATCTGAGCCAAGAGCATTATCTCCCTCCCCGCTACCGTTGAGTTACGCCGGCCGTCCATAAAGGAGACTA +>A-mutant-2 +ACTATCGGTTTTTTGACGACAATCTTGCCGATCTTAGCCAAGAGCATTATCTCCCTCCCCGCTACCGTTTAGTTACGCCGGCCGTCCATAAAGGAGACTA +>A-mutant-3 +ACTATCGGTTTTTGGACGACAATCTTGCCGATCTTAGCCAAGAGCATTATCTCCCTCCCCGCTACCGTTTAGTTACTCCGGCGGTCCATAAAGGCGACTT +>A-mutant-4 +ACTATCGGTTTTTGGACGACAATCTTGCCGATCTTAGCCAAGAGCATTATCTCCCTCCCCGCTACCTTTTAGTTACTCCGGCGGTCCATAAAGGCGTCTT +>A-mutant-5 +ACTATCGGTTTTTGGACGACAATCTGGCCGATCTTAGCCATGAGCGTTATCTCCCTCCCCGCTACCTTTTAGTTACTCCGGAGGTCCATAAAGGCGTCTT +>A-mutant-6 +ACTATTGGTTTTTGGACGACAATATGGCCGATATTAGCCATGAGCGTTATCTCCCTCCCCGCTACCTTCTAGTTACTCCGGAGGTCCATAAAGGCGTCTT +>A-mutant-7 +ACTATTGGGTTTTGGACGAAAATATGGCCGATATTAGCCATGAGCGTTATCTCCCTCCCCGCTACCTTCAAGTTACTCCGGAGGTCCATAAAGGAGTCTT +>A-mutant-8 +ACTATTGGGTTTTTGACGAAAATATGGCCGATATTAGGCATGAGCGTTATCTCCCTCCCCGCTACCTTGAAGTTACTCCGGAGGTCCATAAAGGAGTCTT +>A-mutant-9 +ACTATTGGGTTTTTGACGAAAATATGGCCGATATTAGGCATGAGCGTTATCTCCCTCCCCGCTACCTTGAAGTTACTCCGGAGGTCCATAAAGGAGTCCT +>B +ACGGTAGATTTTTTGACGACAATTTTGCCAATCTGAGTGAAGAGCGTTATCTCTCTCCCACCGAGGATTGTGTTTCCCAGGCCGTACATAAAGGAGTCTA +>B-mutant-1 +ACGCTAGATTTCTTGACGACAATTTTGCCAACCTGAGTGAAGAGCGTTATCTCTCTCCCACCGAGGATTGTGTTTCCCAGGCCGTACATAAAGGAGTCTA +>B-mutant-2 +ACGCTAGATTTCTTGACTACAATTTTGCCAACCTGAGTGAAGAGCGCTATATTTCTCCCACCGCGGATTGAGTTTCCCAGGCCGTACACAAAGAAGTCTC +>B-mutant-3 +ACGCTAGATTTCTTGACTACAATTTTGCCTACCTGAGTCAAGAGCCCTATATTCCTCCCGCCGCGTATTGAGTATCCCTGGCCGTACACAAAGAAGTCTC +>B-mutant-4 +ACGCTAGATTTCTTGACTACAATTTTGCATACCTGAGTCAAGAGCCCCATATTGCTCCCGCCGGGGATTCAGTATCCCTGGCCGTACGCAAAGAAGTCTC +>B-mutant-5 +ACGCTAGATTTCTTGACTACAATTTTGCATAGCTGAGTCAAGAGCCCTATATTGCTTCCGCCGAGGATTCAGTATCCCTGGCCGAACGTAAAGAAGTCTC +>B-mutant-6 +ACGCTATATTTGTTGACTACAATTTTGCATAGCTAAGTCAAGAGCCCTATAATGCTTCCGCCGAGGATTCAGTATCCCTGGCCGAACGTAAAGAAGTCTC +>B-mutant-7 +ACGCTATATTTCTTGACTACAATTTTGCATAGCTAAGTCGACAGCCCTATCATGCTTCCGCCGAGGATTCAGTATCCCTGTCCGAACGTAAAGAAGTCTC +>B-mutant-8 +ACTCTATATTGCTCGACTACAAGTTTGGATAGCTAAGTCGACAGCCGTATCATGTTTCCGTCGAGGATTCAGTATCCCTGTACGAACGTAAAAAAGTCTC +>B-mutant-9 +ACTCTATATTGCTCGACTACAAGTTTGGATAGCTAAGTGGACAGCCGTATCATGTTTCCGTCGAGGATTCAGTATCCCTGTACGAACTTAAAAAAGTCTC +>recombinant +ACGGTCGGTTTTTTGACGACAATCTTGCCGACCTGAGTGAAGAGCGTTATCTCTCTCCCACCGAGGATTGTGTTTCCCAGGCCGTACATAAAGGAGTCTA diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1-phyml.ascii new file mode 100644 index 0000000..37d58c5 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1-phyml.ascii @@ -0,0 +1,40 @@ + + /-A-mutant-9 + | +--|--A-mutant-8 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-recombinant + \-| + | /-B-mutant-1 + \-| + | /-B + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1-phyml.newick new file mode 100644 index 0000000..424dcdf --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.07441712,A-mutant-8:0.00000000,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,(A:0.03802968,(recombinant:0.00000001,(B-mutant-1:0.00000001,(B:0.03212620,(B-mutant-2:0.00000000,(B-mutant-3:0.00000001,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000000,(B-mutant-9:0.04112541,B-mutant-8:0.00000001)1.000000:0.06315926)0.999920:0.03044270)1.000000:0.06246575)0.999807:0.03064319)0.999976:0.03107188)1.000000:0.05400528)0.697588:0.00996592)1.000000:0.11058645)1.000000:0.12435367)0.883604:0.02763320)0.999977:0.03124554)0.999999:0.04151258)0.999171:0.02025819)1.000000:0.05205979)0.999891:0.03063528)1.000000:0.07342472)1.000000:0.06268949); diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1-raxml.ascii new file mode 100644 index 0000000..964a2ec --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-2 + | + | /-B-mutant-1 + | | + | | /-B-mutant-2 + | | | + | | | /-B-mutant-5 + | | | | + | /-| | /-| /-B-mutant-9 + | | | /-| | | /-| + | | | | | | | | | /-B-mutant-7 + /-| | | | | | \-| \-| + | | | | | | /-| | \-B-mutant-8 + | | | | | | | | | + | | | \-| | | | \-B-mutant-6 + | | /-| | \-| | + | | | | | | \-B-mutant-4 + | | | | | | + | | | | | \-B-mutant-3 + | | /-| | | + | | | | | \-B + | | | | | + | \-| | \-recombinant + | | | + | | \-A +--| | + | \-A-mutant-1 + | + | /-A-mutant-5 + | | + | /-| /-A-mutant-6 + | | | | + | | \-| /-A-mutant-9 + | | | /-| + |--| \-| \-A-mutant-8 + | | | + | | \-A-mutant-7 + | | + | \-A-mutant-4 + | + \-A-mutant-3 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1-raxml.newick new file mode 100644 index 0000000..0fe7f87 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1-raxml.newick @@ -0,0 +1 @@ +((A-mutant-2:0.000001,((((B-mutant-1:0.000001,((B-mutant-2:0.000001,(((B-mutant-5:0.000001,((B-mutant-9:0.041130,(B-mutant-7:0.000001,B-mutant-8:0.000001):0.000001):0.063176,B-mutant-6:0.000001):0.030440):0.062474,B-mutant-4:0.000001):0.030643,B-mutant-3:0.000001):0.031072):0.054029,B:0.032138):0.009965):0.110652,recombinant:0.000001):0.124447,A:0.038009):0.027669,A-mutant-1:0.000001):0.031248):0.041516,((A-mutant-5:0.000001,(A-mutant-6:0.000001,((A-mutant-9:0.074437,A-mutant-8:0.000001):0.062695,A-mutant-7:0.000001):0.073432):0.030634):0.052058,A-mutant-4:0.000001):0.020257,A-mutant-3:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1.fasta new file mode 100644 index 0000000..c21694b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-40A1-B1.fasta @@ -0,0 +1,42 @@ +>A +GTGAATTCTAATCCATCATCTCCAGCCAAACGACTATCAGTCGCCGAAATATCCAAAGAGGCTTACAAGCAGGGCTAGTCGAAATAATCGGGGGAAGGCG +>A-mutant-1 +GTGAATTCCAATCCATCACCTCCAGCCAAACGACGATCAGTCGCCGAAATATCCAAAGAGGCCTACAACCAGGGCTTGTCGAAATAATCGGGGGAAGGCG +>A-mutant-2 +GTGAATTCCAATCTATCACCTCCAGCCAAACGACGATCAGTCGCCGAAATATCCAATGAGGCCTACAACCAGGGCTTGTCGAGATAATCGGGGGAAGGCG +>A-mutant-3 +GTGAAGTCCAATCTATCACCTCCAGCCTAACGACGATCAGTCGCCGAAATATCCAATGAGGCCTATAACCAGGGCTTGTCGAGTTAATCGGGGGAAGGCG +>A-mutant-4 +GTGAAGTCCAATCTATCACCTCCAGCCTAACGACGATCAGTCGCCGAAATATCCAATGAGGCCTGTAACCAGGGCTTGTCGAGTTAATCGGGGGAAGTCG +>A-mutant-5 +TTGAAGTCCAATCTATCACCTCCAGCCTAACGACGAGCAGTCGCCGAAATATCCAATGAGGCCTGTAAAAAGGGCTTGTCGAGTTACTCGGGGGAAGTCG +>A-mutant-6 +TTGAAGTCCAATCTATCACCTCCAGCCTAACGACGAGCAGTCGCCGAAATATCCAGTGAGGCCTGTAAAAAGGGCTTGTCGAGTGACTCGGGGGAAGCCG +>A-mutant-7 +TTGTAGTCCAACCTATCACCCCCAGCCTATCGACGAGCAGTCGCCGAGATATTCAGTGAGGCCTGTAAAAAGGGCTTGTCGAGTGACTCGAGGGAAGCCG +>A-mutant-8 +TTGTAGTCCAACCTATCAACCCCAGCCTCTCGACGAGCAGTCGCCGAGATATTCAGTGAGGCCTGTAAAAAGGGCTTGTCGAGTGTCTCGAAGGACGCCT +>A-mutant-9 +CTGTAGGCCAACCTATCATCCCCAGCCTCTCGACGAGCAGACGCCGAGATATTCAGTGAGGCCTGTAAAAACCGCTTGTCGAGTCTCTCGAAGGACGCCT +>B +GTGAATGATGATACATCAACTCCAGCCGGACGACTATCAATCGCCCAAATATCCAAAGAGTCTCACAAACAGGGCAAGTCGAAAGAATCTGGGGAAGGCG +>B-mutant-1 +GTGAATGATGATACATCAACTCCAGCCGGACGACTATCAATCGCTCAAATATCCAAAGAGTCTCACAAACTGGGCAAGTCGAAAGAATCTGGGGGAGACG +>B-mutant-2 +GTGAATGTTGATACATCAACTCCAGCCGGACGACTATCAATCGCTCAAATATCCAAAGAGTCTCACAAACAGGGCAAGTCCAAAGAATTTGGTGGAAACG +>B-mutant-3 +GTGAATGTTGATACATCAAGTCCAGCCGGACGACTATCAATCGCTTAAATATCCAAAGAATCTCACAAACAGGGCAAGTCCAAAGAATTTGGTGGAAACG +>B-mutant-4 +GTGAATGCTGATACATCAAGTCCAGCCGGACGACTATCAATCGCTTAAATATCCAAAGAATCTCATAAACAGGGTAAGTCCAAAGAATTTGGTGGAAACG +>B-mutant-5 +GTGCTTGCTGATACATCAAGTCCAGCCGGACGACTATCAATCGCTTAAACATCCGAAGAATCTCATAAACAAGGTAAGTCTAAAGAATTTGGTGGAAACG +>B-mutant-6 +GTGCTTGCTGATACATCCAGTCCAGCCGGACGATTATCAATCGCTTAAACACCCGAAGAATCTCATAAACAAGGTAAGTCTAAAGAATTTGGTGGAAACG +>B-mutant-7 +GAGCTTGGTGATACATCCAGTCCAGCCGGACTGTTATAAATCGCTTAAACACCCGAAGAATCTCAAAAACAAGGTAAGTCTAAAGAATTTGGTGGAAACG +>B-mutant-8 +GAGCTTGGTGATACATCCAGTCCAGCCGGACTGTTATAAATCGCTTAAACACCCGAAGAATCTCAAAAACAAGGTAAGTCTAAAGAATTTGGTGGAAACG +>B-mutant-9 +GAGATTGGCGATACATCCAGTCCAGCCGGACTGTTATAAATCGCTTAAACACCCGAAGTATCTTAAAAACAAGGTAAGTCTAAAGAATTTGGTGGAAACG +>recombinant +GTGAATTCCAATCCATCACCTCCAGCCAAACGACGATCAGTCGCTCAAATATCCAAAGAGTCTCACAAACTGGGCAAGTCGAAAGAATCTGGGGGAGACG diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1-phyml.ascii new file mode 100644 index 0000000..b8b77e5 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-8 + | +--|--A-mutant-9 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-recombinant + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1-phyml.newick new file mode 100644 index 0000000..1943ffe --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000001,A-mutant-9:0.04105867,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000001,(A-mutant-4:0.00932203,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000001,(A:0.03657625,(recombinant:0.00000001,(B:0.00870022,(B-mutant-1:0.00739638,(B-mutant-2:0.00700245,(B-mutant-3:0.00000000,(B-mutant-4:0.00000001,(B-mutant-5:0.00000000,(B-mutant-6:0.00996383,(B-mutant-7:0.00000001,(B-mutant-9:0.04105810,B-mutant-8:0.00000000)1.000000:0.06327668)1.000000:0.09981448)0.999992:0.05382886)0.999997:0.05267216)1.000000:0.08590807)0.993686:0.02375363)1.000000:0.05585743)0.998929:0.03637968)1.000000:0.11052037)1.000000:0.15660123)0.764496:0.02641874)1.000000:0.05188931)1.000000:0.09644691)1.000000:0.08496557)0.999247:0.03117195)0.999864:0.03041399)1.000000:0.08378953)1.000000:0.08466477); diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1-raxml.ascii new file mode 100644 index 0000000..b1b05ea --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-7 + | + | /-A-mutant-2 + | | + | | /-recombinant + | | | + | | | /-B-mutant-1 + | | | | + | | | | /-B-mutant-2 + | | | /-| | + | | /-| | | | /-B-mutant-4 + | | | | | | | | + | /-| | | | \-| /-| /-B-mutant-5 + | | | | | | | | | | + | | | | | | | | | | /-B-mutant-9 + | | | | | | | | \-| /-| + /-| | | | \-| | | | /-| \-B-mutant-8 + | | | | | | \-| | | | + | | | | /-| | | \-| \-B-mutant-7 + | | | | | | | | | + | | | | | | | | \-B-mutant-6 + | | /-| | | | | | + | | | | | | | | \-B-mutant-3 + | | | | \-| | | + | | | | | | \-B + | | | | | | + | | /-| | | \-A + | | | | | | +--| | | | | \-A-mutant-1 + | | | | | + | | /-| | \-A-mutant-3 + | | | | | + | | | | \-A-mutant-4 + | \-| | + | | \-A-mutant-5 + | | + | \-A-mutant-6 + | + |--A-mutant-8 + | + \-A-mutant-9 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1-raxml.newick new file mode 100644 index 0000000..70730e3 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1-raxml.newick @@ -0,0 +1 @@ +((A-mutant-7:0.000001,(((((A-mutant-2:0.000001,(((recombinant:0.000001,((B-mutant-1:0.007338,(B-mutant-2:0.006938,((B-mutant-4:0.000001,(B-mutant-5:0.000001,(((B-mutant-9:0.041062,B-mutant-8:0.000001):0.063306,B-mutant-7:0.000001):0.099927,B-mutant-6:0.009945):0.053893):0.052694):0.085943,B-mutant-3:0.000001):0.023813):0.055931):0.036494,B:0.008666):0.110605):0.156731,A:0.036588):0.026418,A-mutant-1:0.000001):0.051899):0.096483,A-mutant-3:0.000001):0.084999,A-mutant-4:0.009316):0.031178,A-mutant-5:0.000001):0.030416,A-mutant-6:0.000001):0.083806):0.084671,A-mutant-8:0.000001,A-mutant-9:0.041059):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1.fasta new file mode 100644 index 0000000..e0b1eb6 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-50A1-B1.fasta @@ -0,0 +1,42 @@ +>A +ATATCCAGGGAGGCCTCGAGGACCCTCCCCCCCGCTCTTTTCTGGCCGTCGGTTTGCGTACAGAACTTCGGGACGTGGCAACGACGCAGACATTGGTACG +>A-mutant-1 +ATAGCCAGGGAGGCCTCTAGGACCCTCCCCCCCGGTCTTTTCTGGCCGTCGGTTTGCGTACAGAACTTCCGGACGTGGCAACGACACATACATTGGTACG +>A-mutant-2 +ATAGCCAGGGAGGCCTCTAGCACCCTCCCCCCCGGACTTTTCTGGCCGTCGGTTTGCGTCCAGAACTTCCGGACGTGGCAACGACACCTACATTGGTAGG +>A-mutant-3 +AAAGCAAGAAAGGCTTCTAGCACCCTCCCCCCCGGACTTTTCTGGCCGTCGGTTTGCGTCCAGAACTTCCGGACGAGGCAACCAGACCTACATTGGTAGC +>A-mutant-4 +AAAGCAAGAAAGGATTCTTGCACCCTCCCCCCCGTACTTTACTGGCCGTAAATATGCGTCCAGAACTTCCGGACGAGGCAACCAGACCTACATTTGTAGC +>A-mutant-5 +AAAGCAACAAAGGCTTCTTGCACCCTACCCCCCGTACTTTACTGGCCGTAAATATGCGTCCAGAACTTCCGGACGAGGCAACCAGACCTACATTTGCAGC +>A-mutant-6 +AAAGCGACAAAGGCTTCTTGCACCCTACCCCCCGGACTTTACTGGCCGTAAATATGCGTCCAGAACTTCCGGACGACGCAACCAGACCTACATTTGCAGC +>A-mutant-7 +AAATCGACAAAGGCTTCTTGCACCCTACCCCCCGGACTTTACTTGCCGTAAATATGCGTCCGGAACATCCGGACGACTCAACAAGACCTACAATTTCAGC +>A-mutant-8 +AAATCGACACAGGCTTCTTGCACCCTACCCCCTGGACTTGACTTGCCGTAAATAGGCGTCCGGGACATCCGGTCGACTCACCAAGACCTACAATCTCAGC +>A-mutant-9 +AAATCGACACATGCTTCTTGCACCCTACCCCCTGGACTTGACTTGCGGTAAATAGGCGTCCGGGACATCCCGTCGACTCACCAAGACCAACAATCTCAGC +>B +GTATCCGGGGAGGCCTCGAGCACCCTCACCCCCGCACTCGTCTGGCCGTCGGTGTGCCTTCAGATCTTCTCGAGGTGGGAACTACGCCGGCAATGGTAAG +>B-mutant-1 +GTGTTCGGGGAGGCCTCGGGCGCCCTCACCCCCGCACTCGTCTGGCCGTCGGTGTGCCTTCAGATCTTCTCGAGGTGGGTACTACGCCGGCAATGGTAAG +>B-mutant-2 +GTTTTCGGGGAGGCCTCGGTCGCCCTCACCCCCGCACTCGTCTGGCCGTCTGGGTACCTTCAGATCTTCTCGAGGTGGGTACTACACCGGCAATGGTAAG +>B-mutant-3 +GTATTCGGGGAGGCCTCGGTCGCCCTCACCCCCGCACTCGACTGGCCGTCTGGGTACCTTCAGATCTTCTCGAGGTGGGTACTACACCGGCAATGGTAGG +>B-mutant-4 +GAATTCGGGGAGGCCTCGGCCGCCCTCACCCCCGCACTCGAATGGCCGTCTGGCTACCTTCACTTTTTCTCGAGGTGGGCACTACACCGGCAATGGTAGG +>B-mutant-5 +GAATTCGGGGAGGCCGCGGCCGCCCTCACCCCCGCGCTCGAATGGCCGTCCGGCTACCTTCACTTATTCTCGAGGTGGGCACTACAACGGCAATGGTAGG +>B-mutant-6 +GAATACGGGGAGGCCGCGGCCGCCCTCACCCCCGCGCTCCAATGCCCGTCCGGCTACCTTCACTTATTCTCGAGGTGGGCACCACAACAGCAATGGTCGG +>B-mutant-7 +GAATACGGGGAGGCCGCGGCCGCCCTCCGCCCCGCGCGCCAATGCCCGTCCGGATATGTTCTCTTATTCTCGACGTGGGCACTACAACAGGAATGGTCGG +>B-mutant-8 +AAATACGGGGAGGACGCGGCCGCCCTCCGCCCCGCGCGCCAATGCCCGTCCGAATATGTTCTCTTTTTCTCGACGTGGGCACTAAAATAGGAATGGTCGG +>B-mutant-9 +AAATACGGGGAGGACGGGGCCGCCCTTCGCCCCGCGCGCCAATGCCCGTCCGAATATGTTCCCTTTTTCTCGACGTGGGCACTAAAATAGGAATGGACGG +>recombinant +ATAGCCAGGGAGGCCTCTAGGACCCTCCCCCCCGGTCTTTTCTGGCCGTCGGTGTGCCTTCAGATCTTCTCGAGGTGGGTACTACGCCGGCAATGGTAAG diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1-phyml.ascii new file mode 100644 index 0000000..6756eeb --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-8 + | +--|--A-mutant-9 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-recombinant + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1-phyml.newick new file mode 100644 index 0000000..85ddeb6 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000000,A-mutant-9:0.07470408,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000001,(A-mutant-3:0.00000001,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,(A:0.05029388,(recombinant:0.00948780,(B:0.00000001,(B-mutant-1:0.00000000,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00949852,(B-mutant-5:0.00000001,(B-mutant-6:0.00000000,(B-mutant-7:0.00000000,(B-mutant-8:0.00000001,B-mutant-9:0.08608292)0.999853:0.04117090)0.999974:0.03051890)0.999924:0.03049462)1.000000:0.07430337)0.984784:0.02068071)1.000000:0.04064474)0.999985:0.03040160)0.999465:0.04082365)1.000000:0.12230445)0.998778:0.05289976)0.979994:0.02835942)1.000000:0.06485362)1.000000:0.06435414)1.000000:0.05292839)0.999919:0.04225040)1.000000:0.06414801)1.000000:0.07484211)1.000000:0.07461137); diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1-raxml.ascii new file mode 100644 index 0000000..35604c6 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-4 + | + | /-B-mutant-3 + | | + | | /-recombinant + | | | + | | /-| /-A + /-| | | | | + | | | | | | /-A-mutant-1 + | | | | \-| | + | | | | | | /-A-mutant-3 + | | | | | | | + | | | | | | /-| /-A-mutant-4 + | | | | \-| | | | + | \-| | | | | | /-A-mutant-6 + | | | | | \-| /-| + | | /-| | | | | | /-A-mutant-7 + | | | | | | | | \-| + | | | | \-| \-| | /-A-mutant-9 + /-| | | | | | \-| + | | | | | | | \-A-mutant-8 + | | | | | | | + | | | /-| | | \-A-mutant-5 + | | | | | | | + | | | | | | \-A-mutant-2 + | | | | | | + | | \-| | \-B + | | | | +--| | | \-B-mutant-1 + | | | + | | \-B-mutant-2 + | | + | \-B-mutant-5 + | + |--B-mutant-6 + | + | /-B-mutant-9 + | /-| + \-| \-B-mutant-8 + | + \-B-mutant-7 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1-raxml.newick new file mode 100644 index 0000000..e68a5f1 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1-raxml.newick @@ -0,0 +1 @@ +(((B-mutant-4:0.009496,(B-mutant-3:0.000001,((((recombinant:0.000001,(A:0.051341,(A-mutant-1:0.000001,((A-mutant-3:0.000001,(A-mutant-4:0.000001,((A-mutant-6:0.000001,(A-mutant-7:0.000001,(A-mutant-9:0.074151,A-mutant-8:0.000001):0.074039):0.074268):0.063694,A-mutant-5:0.000001):0.041966):0.052549):0.063926,A-mutant-2:0.000001):0.064467):0.026487):0.062009):0.123213,B:0.008055):0.032389,B-mutant-1:0.000001):0.030223,B-mutant-2:0.000001):0.040421):0.020537):0.073936,B-mutant-5:0.000001):0.030336,B-mutant-6:0.000001,((B-mutant-9:0.085688,B-mutant-8:0.000001):0.040960,B-mutant-7:0.000001):0.030356):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1.fasta new file mode 100644 index 0000000..2c2a4b1 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-60A1-B1.fasta @@ -0,0 +1,42 @@ +>A +TTCTTGTGCGTTTTCTGGTGGTTACATTTCCTGCAGGAAGATTGCTAACATCTTTTTTTAGTGGGATTCGAGTGACAAAACCAGTATCTATTGGCGGTAC +>A-mutant-1 +CTCTTGTGCGTCTTCTGGTGGTTACATTTACTGCAGGAAGATTTCTAACATCTTTTTTTAGTGGGATTCGATTGACAAAACCAGTAATTATTGGCGGTAC +>A-mutant-2 +CGCTTGTGAGTCTTATGGTGGTTACATTTACTACAGGAAGATTTCTAACATCTTTTCTTAGTGGGATTCGATTGACAAAACCAGTAATTATTGGCGGTCC +>A-mutant-3 +CGCTTGTGAGTCTTAGGGTGGTTACATTTACTACAGGAAGATTTCAAAGATCGTTTCTTAGTGGCATTCGATTGACAAAACCAATAATTATTGGCGGTCC +>A-mutant-4 +GGCTTGTGAGTCTTAGGGTGGTTACAATTGCTACAGGAAGATTTCAAAGATCGTTTCTTAGTGGCATTCGATTGACAAAACCAATAATTATTGCCTGTCC +>A-mutant-5 +GGCTTGTGAGTCTTAGGGTGGTTACAATTGCTGCAGGAAGATTTCAAAGATCGTTTTTTAGTGGAATTCGATTGACAAAACCAATAATAATTGCCTGTCC +>A-mutant-6 +GGCTTGTGAGTCTTAGGGTGGTTAGAATTGCTCCAGGAACATTTCAAAGATCGTTCTTTACTGGAATTCGATTGACTAAACCAATAATAATTGCCTGTCC +>A-mutant-7 +GGATTGTGAGTCTTAGGGTGATTAGAATTGCTCCAGGAACATTTAAAAGAACGTTCTTTACTGGAATTCGATTGCGTCAACCAATAATAATTGCCTGTCC +>A-mutant-8 +GGAGTGTGAGTCTTACGGTGATTAGAATTGCTCCAGGACCATTTAAAAGAACGTTCTTTACTGGAATTCGATTGCGTCAAGAAGTAATAATTGCCTCTCC +>A-mutant-9 +GGAGTGTGATTCTTACGGTGGTTAGAATTGCTCAAAGACCATTTAAAAGAACGTTCGTTACTGGAATTCGATTGCGTCAAGGAGTAAAAATTGCCTCTCC +>B +GTCTTGTGCGCATTCTCGTGGTTACATTTCCTGCAGGATGATTGCTAACACCCATTTTTGGTGGAATCCGAGTCACAAAACCAGTAGCTAGTGGCGGTAC +>B-mutant-1 +GTTTTGTGCGCATTCTCGTGGATACATTCCCTGCAGGATGATTGCTAACACCCATTTTTGGTGGAATCCGAGTCACAAAACCAGTAGCTAGTGGAGGTAC +>B-mutant-2 +GTTTAGTGCGCATTCTCGTGTATACATTCCCTGCAGGATGATTGCTAACACCCATTTTTGGTGGAATCCGAGTCACAAAACCAGTTGCTAGTGGAGGTAC +>B-mutant-3 +GTTTAGTGCGCAGTCTCGTGTATACATTCCCTGCAGGATGATTGCTCACTCCCATTTTTGGTGGAATCCGAGTCACACAACCAGTTGCTAGTGGAGGTAC +>B-mutant-4 +GTTTAGTGCGCAGTCTCGTGTATACATTCCCTTCAGAATGATTGCTCACTCCCATTTTTGGTGGAATCCGAGTCACACAACCAGTTGCTCGTGGAGGTAC +>B-mutant-5 +GTTTAGCGCGCAGTCTCGGGTATACATTCACTTCAGAATGATTGCTCACTCCAATTTTTGTTCGAATCCGAGTCACACAACCAGTTGCTAATGGAGGTAC +>B-mutant-6 +GTTTAGCACGCAGTCTCGGGTATACATTCACTTCAAAATGATTGCTCACTCCAATTTTTGTTCGAATCCGACTCACACAACCAGTTGCTAATGGAGGTAC +>B-mutant-7 +GTTTAGCACGCAGTCTCGGGTATACAATCTCTTCAAAATGATTGCTCACTCCAATTTTTGTTCGAATCCGACTAACACAACCAGTTGCTAATGGAGGTAC +>B-mutant-8 +GTTTAGCACGGATTCTCGGGTATAGAATCTCTACAAAATGATTGCTCACTCCAATTTTTGTTCGAATCCGACTAACACAACCAGTTGCTAATGGAGGTAC +>B-mutant-9 +GATTAGCTCGGATTCTCGGGTACATAATCTCTACAAAATGATTGCTCACTCCAATGTTTGTTTGTATCCGACTAACACAACCAATTGCTAATGGAGGTAC +>recombinant +CTCTTGTGCGTCTTCTGGTGGTTACATTTACTGCAGGAAGATTTCTAACATCTTTTTTTAGTGGAATCCGAGTCACAAAACCAGTAGCTAGTGGAGGTAC diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1-phyml.ascii new file mode 100644 index 0000000..1cca5d5 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1-phyml.ascii @@ -0,0 +1,40 @@ + + /-A-mutant-9 + | +--|--A-mutant-8 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-recombinant + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1-phyml.newick new file mode 100644 index 0000000..785853c --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.04144837,A-mutant-8:0.00000000,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000001,(A-mutant-2:0.00000000,(A-mutant-1:0.00000001,(A:0.03210260,(recombinant:0.00000000,(B:0.05222305,(B-mutant-1:0.00000000,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000000,(B-mutant-7:0.00000000,(B-mutant-8:0.00000000,B-mutant-9:0.04109618)0.968018:0.01009012)0.987990:0.01013609)0.937269:0.01014438)1.000000:0.08570418)0.997219:0.02033774)0.999999:0.04137739)1.000000:0.04137818)0.000000:0.00000001)1.000000:0.19653444)0.999999:0.09455009)0.818594:0.02354763)1.000000:0.05271429)1.000000:0.06429402)0.999999:0.05331948)0.999999:0.05329197)0.999998:0.04212617)1.000000:0.05238666); diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1-raxml.ascii new file mode 100644 index 0000000..c1ccc3b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-1 + | + | /-A + | | + | | /-B-mutant-5 + /-| | /-| + | | | | | /-B-mutant-6 + | | | | \-| + | | | | | /-B-mutant-7 + | | | /-| \-| + | | | | | | /-B-mutant-9 + | \-| | | \-| + | | /-| | \-B-mutant-8 + | | | | | + | | | | \-B-mutant-4 + | | /-| | + | | | | \-B-mutant-3 + | | | | + | | /-| \-B-mutant-2 + | | | | + | | | | /-B + | \-| \-| +--| | \-B-mutant-1 + | | + | \-recombinant + | + | /-A-mutant-5 + | | + | /-| /-A-mutant-6 + | | | | + | | \-| /-A-mutant-8 + | | | /-| + |--| \-| \-A-mutant-9 + | | | + | | \-A-mutant-7 + | | + | | /-A-mutant-4 + | \-| + | \-A-mutant-3 + | + \-A-mutant-2 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1-raxml.newick new file mode 100644 index 0000000..1fff8d6 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1-raxml.newick @@ -0,0 +1 @@ +((A-mutant-1:0.000001,(A:0.031966,((((((B-mutant-5:0.000001,(B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-9:0.041021,B-mutant-8:0.000001):0.010082):0.010125):0.010133):0.085322,B-mutant-4:0.000001):0.020301,B-mutant-3:0.000001):0.041255,B-mutant-2:0.000001):0.041251,(B:0.052037,B-mutant-1:0.000001):0.000001):0.194677,recombinant:0.000001):0.093988):0.023457):0.052490,((A-mutant-5:0.000001,(A-mutant-6:0.000001,((A-mutant-8:0.000001,A-mutant-9:0.041310):0.052170,A-mutant-7:0.000001):0.041918):0.052987):0.053033,(A-mutant-4:0.000001,A-mutant-3:0.000001):0.000001):0.063937,A-mutant-2:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1.fasta new file mode 100644 index 0000000..2bcf577 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-70A1-B1.fasta @@ -0,0 +1,42 @@ +>A +AGTAATTTGAGCGAACGTCGCTACTCGTAAAATTATAGTATTCGGCACCAGCTAGGGAACATGGATATGCCTTTCTTCCCACCCTGTATGAGTAGATCCA +>A-mutant-1 +AGTAATTTGAGCGAACGTCGCCACTCGTAAAATTATAGTATTCGACACCAGCTAGGGAACATGGATATGCCTTTCTTCCGACCCTGCATCAGTAGATCCA +>A-mutant-2 +AGTAATTTGAGCGAACGTCGCCACTCGTAAAATTATAGTGTTCGACACCACCTAGGGAGCATGGATATGCCTTTCTTCCGACCCCTCATCAGTAGATCCA +>A-mutant-3 +AGTAATTTGAGCGAACGTCGCCACTCGTAAATTTATAGTGTTCGACACCACCTAGTGAGCATGGACATGCATTTCATCCGATCCCTCATCAGTAGATCCA +>A-mutant-4 +AGTAATTTGAGCGAACGTCGCCACTCGTAAATTTATAGTGTTCGACACCACCTAGTGAGCATGGACATGCATTTCATCCGATCCCTCATCAGTAGATCCA +>A-mutant-5 +AGTAATTTGAGCGTACGTCGCCACTCGTAAATTTATAGTGTTCAACACAATCTAGTGAGCATAGACATGCATTTCATCCGATCCCTCATCAGTAGATCCA +>A-mutant-6 +AGTAATTTGAGCGTACGTCGCCACTCGTAAATTTATAGTGTTCAACACAAGCTAGTGAGCATATACATGCATTTAATACGATCCCTCATCAGTATATCCA +>A-mutant-7 +AGTAATTTGAGCGTACGTCGCCACTCGTAAATGTATAGTGTTCAACAGAAGTTAGTGAGCATATACATGCATTTAATACGATCCCTCGTCAGTATATCCA +>A-mutant-8 +AGTAATTTGAGCGTACGTCGCCACTGGTAAAGGTATCGGGTTCAACAGAAGTTAGTGAGCATATACATGCATTTAATACGACCCCTCGTCAGTATATCCA +>A-mutant-9 +AGTAATTTGAGCGTACGTCGCCACTGGTAAAGGCATCGGGTTCAACAGAAGTTGGTGAGCATATACTTGCATTTAATACGACCCCTCGTCAGTATATCAA +>B +AGTTATCTAAGCGGAAGGCGCTACTCGTAAAATTGTCATTGCCGGCACCAGCTAGCTAACATCGATATGCCTTTCTTCCCAGCCGGGATTAGTATATCCA +>B-mutant-1 +AGTTATGTAAGCGGAAGGCGCTACTCGTAAAATTGTCATTGCCGGCACCAGCTAGCTAACATCGATATGCCATTCTTCCCAGCGGGGAGTAATATATCCA +>B-mutant-2 +AGTTATGTAAGCGGAAGGCGCTACTCGTAAAATTGTCATGGCCGGCCCCAGCTAGCTAACTTCGATATCCCATTCTTCCCAGCGGGGAGTAATATATCCA +>B-mutant-3 +AGTTATGTAAGCGGAAGGCGCCGCTCGTAAAATTGTCATGGCCGTCCCCAGCTAGCTAACTTCGATATCCCATTCTTCCCAGCGGGGAGTAAAATATCCA +>B-mutant-4 +AGTTATGTAAGCGGAAGGCGCCGCTCGTAAAATTGTAATGGCCGTCCCCAGCTAGCTAACTTCGATATCCCAGTCTTCCCAGCGGGGAGTAAAATATCCA +>B-mutant-5 +AGTTATGTAAGCGGAAGGCGCCGCACGTAAAATCGTAATGGCCGTCCCCAACAAGCTCACTTCGGTAGCCCAGTCTTCCAAGCGGGGAGTAAAATATCCA +>B-mutant-6 +AGTTATGTAAGCGGAAGGCGCCGCACGTAAAATCGTAATGGCCCTCCCCAACAAGCTCACTTCGGTAGCCCAGTCTTCCAAGCGGGGAGTAAAATATCCA +>B-mutant-7 +AGTTATGTAAGCGGAAGGCGCCGCACGTAAAATCGTAGTGGCCCTCCCCAACAAGCTCACTTCGGTAGCCCAGTCTTCCAAGCGGGGAGTAAAATATCCA +>B-mutant-8 +AGTTATGTAAGCGGAAGGCGCCGCACGTAAAATCGTAGTGGCCCTCCCCAAGAAGCTCACTTCGGTAGCCCAGTCTTCCAAGCGGGGAGTAAAATATCCA +>B-mutant-9 +AGTTATGTTAGCGGAAGGCGCCGCACGGAAAATCGTAGTGGCCCTCCCCAAGAAGCTCACTTCGGTAGCCCAGTCTTCCTAGCGGTGAGTAAAATATCCA +>recombinant +AGTAATTTGAGCGAACGTCGCCACTCGTAAAATTATAGTATTCGACACCAGCTAGGGAACATGGATATGCCATTCTTCCCAGCGGGGAGTAATATATCCA diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1-phyml.ascii new file mode 100644 index 0000000..b521de6 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-9 + | + |--B-mutant-8 +--| + | /-B-mutant-7 + | | + \-| /-B-mutant-6 + | | + \-| /-B-mutant-5 + | | + \-| /-B-mutant-4 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-1 + | | + \-| /-B + | | + | | /-A + \-| | + | | /-A-mutant-2 + | | /-| + | | | | /-A-mutant-3 + \-| | \-| + | | | /-A-mutant-4 + | | \-| + | | | /-A-mutant-5 + | | \-| + | | | /-A-mutant-6 + \-| \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-9 + | \-| + | \-A-mutant-8 + | + | /-A-mutant-1 + \-| + \-recombinant diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1-phyml.newick new file mode 100644 index 0000000..ebda0be --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.05095956,B-mutant-8:0.01441058,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00000000,(B-mutant-2:0.00000000,(B-mutant-1:0.01000522,(B:0.00000000,(A:0.00620301,((A-mutant-2:0.00986363,(A-mutant-3:0.00000000,(A-mutant-4:0.00000001,(A-mutant-5:0.00000000,(A-mutant-6:0.00000000,(A-mutant-7:0.00000001,(A-mutant-9:0.03011209,A-mutant-8:0.00000000)0.999999:0.04046229)1.000000:0.05201595)0.999999:0.04049440)0.999998:0.04030653)1.000000:0.06125759)1.000000:0.05165261)0.989750:0.02025432,(A-mutant-1:0.00000000,recombinant:0.02009766)0.000000:0.00000001)0.999896:0.05502015)1.000000:0.18411991)0.977734:0.02027535)1.000000:0.06318395)0.999905:0.03054100)0.999996:0.05179328)1.000000:0.07419865)1.000000:0.08521971)0.998824:0.03110483)0.999996:0.05107340); diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1-raxml.ascii new file mode 100644 index 0000000..33fe41c --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-8 + /-| + /-| \-A-mutant-9 + | | + | \-A-mutant-7 + | + | /-A-mutant-5 + | | + | | /-A-mutant-4 + | | | + | | | /-A-mutant-2 + | | | | + |--| | | /-A + | | | | | + | | | | | /-B-mutant-2 + | | | | | | + | | | | | | /-B-mutant-3 + | | | | | /-| | + | \-| /-| | | | | /-B-mutant-6 + | | | | /-| | | | | + | | | | | | | \-| /-| /-B-mutant-9 +--| | | | | | | | | | /-| + | | | | | | | | | \-| \-B-mutant-8 + | | | | | | /-| | /-| | + | | | | | | | | | | | \-B-mutant-7 + | | | | | | | | \-| | + | | | | | | | | | \-B-mutant-5 + | | | \-| \-| | | + | \-| | | | \-B-mutant-4 + | | | | | + | | | | \-B-mutant-1 + | | | | + | | | \-B + | | | + | | | /-recombinant + | | \-| + | | \-A-mutant-1 + | | + | \-A-mutant-3 + | + \-A-mutant-6 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1-raxml.newick new file mode 100644 index 0000000..377a23f --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1-raxml.newick @@ -0,0 +1 @@ +(((A-mutant-8:0.000001,A-mutant-9:0.030112):0.040467,A-mutant-7:0.000001):0.052025,(A-mutant-5:0.000001,(A-mutant-4:0.000001,((A-mutant-2:0.009862,((A:0.006160,(((B-mutant-2:0.000001,(B-mutant-3:0.000001,(((B-mutant-6:0.000001,((B-mutant-9:0.050977,B-mutant-8:0.014401):0.051095,B-mutant-7:0.000001):0.031109):0.085260,B-mutant-5:0.000001):0.074226,B-mutant-4:0.000001):0.051802):0.030545):0.063204,B-mutant-1:0.010001):0.020283,B:0.000001):0.184319):0.055068,(recombinant:0.020099,A-mutant-1:0.000001):0.000001):0.020257):0.051665,A-mutant-3:0.000001):0.061271):0.040310):0.040496,A-mutant-6:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1.fasta new file mode 100644 index 0000000..8dd4add --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-80A1-B1.fasta @@ -0,0 +1,42 @@ +>A +ATCAATTTTAGAACCCGCAGTAACTCCTAATTGTCTCTCAGATGCGCAGTGGCGCGCCAGAGTACCGGGCCCTTCCTCTGTGTCATCGACTCAGTGTGGA +>A-mutant-1 +ATCACTTTGAGAACCAGCAGTAATTCCTAATTGTCTCTCAGATGCGCAGTGGCGCGCCAGAGTAACGGGCCCTTCCTCTTTGTCATCGACTCAGTGTGGA +>A-mutant-2 +ATCACTTTGAGAACCACCAGTAATTCCTAATTGTCTTTAAGATGCGCAGTGGCGCGCCAGAGTAACGGGCCCTTCCTCTTTGTCATCGACTCAGTGTGGA +>A-mutant-3 +ATCACTTTCAGAACCACCACTAATTCCTAATTGTCTCTAAGATGCGCAGTCGCGCGCCAGAATAACGGGCCCTTCCTCTTTGTCATCGACCCAGTGTGGA +>A-mutant-4 +ATCACTTTCAGCACCACCACTTACTCCTAATTGTCTCGAAGATGCGCAGTCGCGAGCCAGAATAACGGGCCCTTCCTCTTTGTCATCGATCCAGTGTGGA +>A-mutant-5 +ATCACTTTCAGCACCACAAGTTACTCCTAATTGTCTCGAAGCTGCGCAGTCGCGAGCCAGAATAACGGGCCCTTCCTCTTTGTCATCGATCCAGTGTGGT +>A-mutant-6 +ATCACTTTCAGCACCACAAGTTACTCCTAATTGTCTCGAAGCTGCGCAGTCGCGAGCCAGAATAATGGGACCTTCCTCTTGGTCATCGATCTAGTGTGGT +>A-mutant-7 +ATCACTTTCAGCTCCTCAAGTTACTCCTAATTGTCACGAAGCTGCGCAGTCGCGTGCCAGAATAATGGGACCTTCCTCTTGGTCATCGATCTAGTGTCGT +>A-mutant-8 +ATCACTTTCAGCTCCTCAACTTACTCCTAATTGTCACCAAGCTGCGCAGTCGCGTGCCAGAACAATGGGACCTTCCTCTTGGTCATCGATCTCGTGTCGT +>A-mutant-9 +ATCACTTTCAGCTCCTCAACTTACTCCTAATTGTCACCAAGTTGCGCAGTCGCCTGCCAGAACAATGGTACCTTCCTCTTGGTCATCGATCTCGTGTCGT +>B +AGCAATTTTAGAACTCGCATTAATTCCTCCTTCTATCTCAAATGCGCATTGGCGCGCCACAGAACAGGCCCCTTCGTCTGTTTTATCGACTCAGTGTGGA +>B-mutant-1 +AGCAATTTTAGAACTCGCATTAATTCCTCCTTCCATCACAAATGCGGATTGGCGCGCCACAGAACAGGCCCCTTCGTCTGTTTTATCGACTCAGTGTGGA +>B-mutant-2 +AGCAATTTTAGAACTCGGATTAATTCCTCCTTCCATCTCAAATGCGGATTGGCGCACCGCCGAATAGTCCCCTTCGTCTGTTTTATCGACTCAGTGTGGA +>B-mutant-3 +AGCAATTTTAGAACTCGGATTAATTACTCCTTCCATCTCAAATGCGGATTGGCGCACCGCCGAATAGTCCCCTTTGTCTGTTTTCTCGACTCAGTGTGGA +>B-mutant-4 +AGCAATGTTAGAAATCGGATTAATTACTCCTTCCATCTGAAATGCGGATTGGCGCACGGCCGAATAGTCCCCTTTGTCCGTTTTCTCGACTCAGTGTGGA +>B-mutant-5 +AGCTATGTTAGAAGTCGGATTAATTACTCCTTCCACATGAAATGCGGATTGGCGCACGGCCGAATAGTACCCCTTGTCCATTTTCTCGACTCAGTGTGGA +>B-mutant-6 +AGCTATGTTAGAAGTCGGATTAATTTCTCATTCCACATGAAATGCGGATTGGTGCACGGCCGAATAGTATCCCTTGTCCACCTTATCGACTCGGTGTGGA +>B-mutant-7 +AGCTATGTTAGATGTCGGATTAATTTCTCATTCCACATGAAATGCGGATTGGTGCACGGCCGAATAGTATCCCTTGTTCACCTTATCGACTCTGTGTGGA +>B-mutant-8 +AGCTATGTTCGATGTCGGGTTAATGTCTCATTCCACATGAAATGCGGATTGGTCCACGGCCGAATAATATCTCTTGTTCACCTTATCGACTCTGTGTGGA +>B-mutant-9 +AGCTATGTTCGATGTCGGGTTAATGTCTCATTACACATGAAATCCGGATTGGTGCACGGCCGAATAATATCGCTTTTTCACCTTATCCACTCTGTGTGGA +>recombinant +ATCACTTTGAGAACCAGCAGTAATTCCTAATTGTCTCTCAGATGCGCAGTGGCGCGCCAGAGTAACGGGCCCTTCCTCTTTTTTATCGACTCAGTGTGGA diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1-phyml.ascii new file mode 100644 index 0000000..1ec178b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-9 + | +--|--B-mutant-8 + | + | /-B-mutant-7 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-1 + \-| + | /-B + \-| + | /-A + \-| + | /-recombinant + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1-phyml.newick new file mode 100644 index 0000000..b244373 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.03051432,B-mutant-8:0.00000000,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00000000,(B-mutant-2:0.00000001,(B-mutant-1:0.00000000,(B:0.00000001,(A:0.00000001,(recombinant:0.02050138,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000000,(A-mutant-4:0.00000000,(A-mutant-5:0.00000001,(A-mutant-6:0.00000001,(A-mutant-7:0.00000000,(A-mutant-9:0.04094288,A-mutant-8:0.00000001)0.945434:0.01003135)1.000000:0.07326081)0.999996:0.05168484)0.999999:0.04093388)0.999997:0.04087850)1.000000:0.07336496)1.000000:0.06271380)0.000000:0.00000001)0.998153:0.04148898)1.000000:0.18209511)0.878120:0.03088059)0.999995:0.06320703)1.000000:0.07511327)1.000000:0.07446552)0.999998:0.04157947)0.975929:0.01016580)0.999991:0.03083212)1.000000:0.04115313); diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1-raxml.ascii new file mode 100644 index 0000000..3cc3e05 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-9 + /-| + | \-B-mutant-8 + | + | /-A + | | + | | /-A-mutant-4 + | | | + | | | /-A-mutant-7 + | | /-| /-| + | | | | | | /-A-mutant-9 + | /-| | | /-| \-| + | | | | | | | \-A-mutant-8 + | | | /-| \-| | + | | | | | | \-A-mutant-6 + | | | | | | + | | | /-| | \-A-mutant-5 + | | | | | | + | /-| | | | \-A-mutant-3 + | | | \-| | +--| | | | \-A-mutant-2 + | | | | + | | | | /-recombinant + | /-| | \-| + | | | | \-A-mutant-1 + | | | | + | /-| | \-B + | | | | + | | | \-B-mutant-1 + | /-| | + | | | \-B-mutant-2 + | /-| | + | | | \-B-mutant-3 + | /-| | + | | | \-B-mutant-4 + |--| | + | | \-B-mutant-5 + | | + | \-B-mutant-6 + | + \-B-mutant-7 diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1-raxml.newick new file mode 100644 index 0000000..b75535a --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1-raxml.newick @@ -0,0 +1 @@ +((B-mutant-9:0.030496,B-mutant-8:0.000001):0.041133,((((((((A:0.000001,((((A-mutant-4:0.000001,(((A-mutant-7:0.000001,(A-mutant-9:0.040922,A-mutant-8:0.000001):0.010025):0.073229,A-mutant-6:0.000001):0.051659,A-mutant-5:0.000001):0.040913):0.040858,A-mutant-3:0.000001):0.073332,A-mutant-2:0.000001):0.062677,(recombinant:0.020488,A-mutant-1:0.000001):0.000001):0.041463):0.182093,B:0.000001):0.030865,B-mutant-1:0.000001):0.063173,B-mutant-2:0.000001):0.075085,B-mutant-3:0.000001):0.074431,B-mutant-4:0.000001):0.041561,B-mutant-5:0.000001):0.010159,B-mutant-6:0.000001):0.030813,B-mutant-7:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1.fasta new file mode 100644 index 0000000..79886a0 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out1/recombinant-90A1-B1.fasta @@ -0,0 +1,42 @@ +>A +ACAATCTTACTACCGAACTCGCATAATTTCACGAAAATATGACTACGCCTCCATAGGGGGACATAGCCACCGATATCTGACCGCTATCAATCGGCTTTTA +>A-mutant-1 +ACAATCTTACTACCGAACTCGCATAATTTCATGAAAATATGACTACCCCTCCATAGGGGGACATACCCACCGATATCTGACCGCTATTAATCGGCTTTTA +>A-mutant-2 +AGAATCTTACTACCGGACGCGCATAATTTCATGAAAATATGACTACCCCTCCATAGGGGGACATACCCACCGATATCTGACCGTTATTAATTGTCTTTTA +>A-mutant-3 +AGAAACTTACTACCGGACGCGCATGATTGCATGAGAATATGACTACCCCTCCATAGGGGGACATACCCACCGCGATCTGACCGTTATTAATTGTCTTTAA +>A-mutant-4 +AGAAACTTATTACCGGACGCGCATGATTGCATGAGAATATGACTACCCCTCCAAAGGGGGACATACTCACCGCGATCTGACAGTTATTAATTGTCTTTAA +>A-mutant-5 +AGTAACTTATTACCGGACGCGCATGATTGCCTGAGAATATGACTACCCCTCCAAAGGGGGACATACTCAACGCGATCTGACAGTCATTAATTGTCTTTAA +>A-mutant-6 +AGTAACTTAATACCGGACGCGCATGATTGCCTGAGAATATAACTACCACTCCAAAGGGGGACATACTCAACCCGGTCTGACAGTCATTAATTGTCTTTAA +>A-mutant-7 +AATAACTTAATACCGGTCGCGCATGATTGCCTGAGAACATTACTACCACTCCAATGGGGGACAAACTCAACCCGGTCTGACAGTTATTAATTGTCTTTAA +>A-mutant-8 +AATAACTTAATACCGGTCGCGCATGATTGCCTGAGAACATTACTACCACTCGAATGGGGGACAAACTCAACCCGGTCTGACAGTTATTAATTGTCTTTAA +>A-mutant-9 +AATAACTTAATACCGGTCGCCCATGATTGCCTGAGAACATTACTGCCACTCGAAGGGGGGACAAACTCAACCCGGTCTAACAGTTATTAATTGTCTTTAA +>B +ACCAGCCTACTACCGAACTCGCATAATTTCCCGCAAAGATGACCACTTCTGCAGAGGGTGACATTGCCACCGGTATCAGACCGCTATCAATCTGCTTTTA +>B-mutant-1 +ACCAGCCTACTACCGAACTCGCATAATTTCCCGCAAAGATGACCACTTCTGCAGAGGGAGACATTGCCACCGGTATCCGACCGCTATCAATCTGCTATTA +>B-mutant-2 +ACCAGCCTACTACCGAACTCGCACGATTTCCCGCAAAGATGACCACTTCTGCAGAGAGAGACATTGTCACCGGTACCCGACCCCTATCAATCTGCTATTA +>B-mutant-3 +ACCAGCCTACTACCGAACTCACACCATTTCCCGCAAAGATGACCACATCTGCAGAGTGAGAAATTGTCACCGGGACCGGACCCCTATCAATCTGCTATTA +>B-mutant-4 +ACCAGCCTACTACCGAACTCACACCGTTTCCCGCAAAGATGATCACATCTGCAGGGTGAGAAATTGTCACCGGGACCGGACTCCCACCAATCTGCTATTC +>B-mutant-5 +ACCAGCCTACTACCGAACTCACACCGTTTCCCGCAAAGATGATCCCATCTGCACGGTGAGAAATTGTCACCGGGACCGGATTCCCACCAATCTGCTGTTC +>B-mutant-6 +ACCAGCCTACTACCGAACTCACACCGTTTCCCGCAAAGATGATCCCATCTGCACGGTGAGAAATTGTCACCGGGACCGGATTCCCAACAATCTGCTGTTC +>B-mutant-7 +ACCAGCCTACTACCGAATTCAGACCGTTTCCCGCAAAGATGATCCCATCTGCACGGTGAGAAATTGTCACCGGGACCGGATTCCCAACCATCTGCTGTTC +>B-mutant-8 +ACCAGCCTACTATCGAATTCAGACCGTTTCCCTCAAAGATGATCGCATCTGCACGGTGCGAAATTGTCACCGGGACCGGATTCCCAACCATCTGCTGTTC +>B-mutant-9 +ACCAGCCTACTATCGAATTCAGACCGTTTCCCTCAAAGAGGAACGCATCTGCTCGGTGCGAAATTGTCACCGGGACCGGATTCCCAACCATCTGCTGTTC +>recombinant +ACAATCTTACTACCGAACTCGCATAATTTCATGAAAATATGACTACCCCTCCATAGGGGGACATACCCACCGATATCTGACCGCTATTAATCTGCTATTA diff --git a/recombinationgradients/recombinationgradient_A1B1/out1/recombinants_A1B1.png b/recombinationgradients/recombinationgradient_A1B1/out1/recombinants_A1B1.png new file mode 100644 index 0000000..5c7ca82 Binary files /dev/null and b/recombinationgradients/recombinationgradient_A1B1/out1/recombinants_A1B1.png differ diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/outtest b/recombinationgradients/recombinationgradient_A1B1/out2/outtest new file mode 100644 index 0000000..562c9d6 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/outtest @@ -0,0 +1,405 @@ +Analysing sample: recombinant-10A1-B1-raxml.newick + + /-recombinant + | + | /-B + | | + /-| | /-B-mutant-5 + | | | /-| + | | | | | /-B-mutant-6 + | | | | \-| + | | | | | /-B-mutant-7 + | \-| /-| \-| + | | | | | /-B-mutant-8 + | | | | \-| + | | /-| | \-B-mutant-9 + | | | | | +--| | | | \-B-mutant-4 + | | /-| | + | | | | \-B-mutant-3 + | \-| | + | | \-B-mutant-2 + | | + | \-B-mutant-1 + | + | /-A + | | + \-| /-A-mutant-1 + | | + \-| /-A-mutant-2 + | | + \-| /-A-mutant-3 + | | + \-| /-A-mutant-4 + | | + | | /-A-mutant-6 + \-| /-| + | | | /-A-mutant-7 + | | \-| + \-| | /-A-mutant-8 + | \-| + | \-A-mutant-9 + | + \-A-mutant-5 +Distance of A1 to recombinant is 0.293743 +Distance of B1 to recombinant is 0.040657 +Analysing sample: recombinant-20A1-B1-raxml.newick + + /-B + | + | /-B-mutant-1 + | /-| + | | \-B-mutant-2 + /-| | + | | | /-B-mutant-5 + | | | | + | | | | /-B-mutant-8 + | | | /-| /-| + | \-| | | /-| \-B-mutant-9 + | | | | | | + | | /-| \-| \-B-mutant-7 + | | | | | +--| | | | \-B-mutant-6 + | | /-| | + | | | | \-B-mutant-4 + | \-| | + | | \-B-mutant-3 + | | + | \-recombinant + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 +Distance of A1 to recombinant is 0.317409 +Distance of B1 to recombinant is 0.052432 +Analysing sample: recombinant-30A1-B1-raxml.newick + + /-A + | + | /-A-mutant-2 + | | + | | /-A-mutant-8 + | | /-| + /-| | /-| \-A-mutant-9 + | | | | | + | | /-| /-| \-A-mutant-7 + | | | | | | + | | | | /-| \-A-mutant-6 + | | | | | | + | | | | /-| \-A-mutant-5 + | \-| | | | +--| | \-| \-A-mutant-4 + | | | + | | \-A-mutant-3 + | | + | \-A-mutant-1 + | + | /-recombinant + | | + \-| /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-4 + | | + \-| /-B-mutant-5 + | | + \-| /-B-mutant-6 + | | + \-| /-B-mutant-9 + | /-| + \-| \-B-mutant-8 + | + \-B-mutant-7 +Distance of A1 to recombinant is 0.155197 +Distance of B1 to recombinant is 0.084547 +Analysing sample: recombinant-40A1-B1-raxml.newick + + /-A + | + | /-A-mutant-2 + | | + | | /-A-mutant-6 + | | | + /-| | /-| /-A-mutant-9 + | | /-| | | /-| + | | | | | \-| \-A-mutant-8 + | | | | /-| | + | | | | | | \-A-mutant-7 + | | | | /-| | + | \-| | | | \-A-mutant-5 + | | \-| | + | | | \-A-mutant-4 + | | | +--| | \-A-mutant-3 + | | + | \-A-mutant-1 + | + | /-recombinant + | | + | | /-B-mutant-2 + | | | + | | | /-B-mutant-4 + | | | | + \-| /-| /-| /-B-mutant-5 + | | | | | | + | | | | \-| /-B-mutant-7 + | | | | | /-| + | | | | | | | /-B-mutant-9 + | | \-| \-| \-| + \-| | | \-B-mutant-8 + | | | + | | \-B-mutant-6 + | | + | \-B-mutant-3 + | + | /-B-mutant-1 + \-| + \-B +Distance of A1 to recombinant is 0.258983 +Distance of B1 to recombinant is 0.051428 +Analysing sample: recombinant-50A1-B1-raxml.newick + + /-A-mutant-1 + | + /-| /-A-mutant-2 + | | | + | \-| /-A-mutant-3 + | | | + | \-| /-A-mutant-4 + | | | + | \-| /-A-mutant-5 + | | | + /-| \-| /-A-mutant-7 + | | | /-| + | | | | | /-A-mutant-8 + | | \-| \-| + | | | \-A-mutant-9 + | | | +--| | \-A-mutant-6 + | | + | \-A + | + | /-recombinant + | | + | | /-B-mutant-1 + \-| /-| + | | \-B + | | + \-| /-B-mutant-2 + | | + | | /-B-mutant-4 + | | | + \-| | /-B-mutant-6 + | /-| /-| + | | | | | /-B-mutant-7 + | | | | \-| + | | \-| | /-B-mutant-8 + \-| | \-| + | | \-B-mutant-9 + | | + | \-B-mutant-5 + | + \-B-mutant-3 +Distance of A1 to recombinant is 0.107240 +Distance of B1 to recombinant is 0.108297 +Analysing sample: recombinant-60A1-B1-raxml.newick + + /-B + | + | /-B-mutant-3 + | | + | /-| /-B-mutant-4 + | | | | + | | \-| /-B-mutant-5 + /-| | | | + | | | | | /-B-mutant-9 + | | | \-| /-| + | | /-| | /-| \-B-mutant-8 + | | | | | | | + | | | | \-| \-B-mutant-7 + | | | | | +--| \-| | \-B-mutant-6 + | | | + | | \-B-mutant-2 + | | + | \-B-mutant-1 + | + | /-recombinant + | | + \-| /-A + | | + \-| /-A-mutant-1 + | | + \-| /-A-mutant-2 + | | + \-| /-A-mutant-3 + | | + \-| /-A-mutant-4 + | | + | | /-A-mutant-7 + \-| /-| + | | | /-A-mutant-9 + | /-| \-| + | | | \-A-mutant-8 + \-| | + | \-A-mutant-6 + | + \-A-mutant-5 +Distance of A1 to recombinant is 0.117274 +Distance of B1 to recombinant is 0.201750 +Analysing sample: recombinant-70A1-B1-raxml.newick + + /-recombinant + | + | /-B + /-| | + | | | /-B-mutant-1 + | | | | + | \-| | /-B-mutant-4 + | | | | + | | | /-| /-B-mutant-5 + | | | | | | + | \-| | | | /-B-mutant-9 + | | | \-| /-| + | | | | /-| \-B-mutant-8 +--| | /-| | | | + | | | | \-| \-B-mutant-7 + | | | | | + | \-| | \-B-mutant-6 + | | | + | | \-B-mutant-3 + | | + | \-B-mutant-2 + | + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 +Distance of A1 to recombinant is 0.099553 +Distance of B1 to recombinant is 0.157438 +Analysing sample: recombinant-80A1-B1-raxml.newick + + /-A + /-| + | \-A-mutant-1 + | + | /-A-mutant-4 + | | + | | /-A-mutant-6 + /-| /-| /-| + | | | | | | /-A-mutant-7 + | | | | | \-| + | | | \-| | /-A-mutant-8 + | | /-| | \-| + | | | | | \-A-mutant-9 + /-| | | | | + | | \-| | \-A-mutant-5 + | | | | + | | | \-A-mutant-3 + | | | + | | \-A-mutant-2 + | | +--| \-recombinant + | + | /-B + | /-| + | | \-B-mutant-1 + | | + | | /-B-mutant-2 + \-| | + | | /-B-mutant-5 + | | | + | | /-| /-B-mutant-7 + \-| | | /-| + | | | | | /-B-mutant-9 + | | \-| \-| + | /-| | \-B-mutant-8 + | | | | + | | | \-B-mutant-6 + \-| | + | \-B-mutant-4 + | + \-B-mutant-3 +Distance of A1 to recombinant is 0.072425 +Distance of B1 to recombinant is 0.187824 +Analysing sample: recombinant-90A1-B1-raxml.newick + + /-A-mutant-4 + | + /-| /-A-mutant-5 + | | | + | \-| /-A-mutant-7 + | | /-| + | | | | /-A-mutant-9 + /-| \-| \-| + | | | \-A-mutant-8 + | | | + /-| | \-A-mutant-6 + | | | + | | \-A-mutant-3 + /-| | + | | \-A-mutant-2 + /-| | + | | \-A-mutant-1 + /-| | + | | \-recombinant + | | +--| \-A + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 +Distance of A1 to recombinant is 0.020830 +Distance of B1 to recombinant is 0.239771 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1-phyml.ascii new file mode 100644 index 0000000..813765d --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-9 + | +--|--B-mutant-8 + | + | /-B-mutant-7 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-1 + \-| + | /-B + \-| + | /-recombinant + \-| + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1-phyml.newick new file mode 100644 index 0000000..e5bb590 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.04191206,B-mutant-8:0.00000001,(B-mutant-7:0.00000001,(B-mutant-6:0.00000000,(B-mutant-5:0.00000000,(B-mutant-4:0.00000001,(B-mutant-3:0.00000001,(B-mutant-2:0.00000001,(B-mutant-1:0.00000000,(B:0.05172330,(recombinant:0.00000001,(A:0.00000001,(A-mutant-1:0.00000000,(A-mutant-2:0.00000001,(A-mutant-3:0.00000000,(A-mutant-4:0.01004516,(A-mutant-5:0.00000000,(A-mutant-6:0.00000001,(A-mutant-7:0.00000000,(A-mutant-9:0.04234699,A-mutant-8:0.00000001)0.999998:0.04231476)0.999995:0.05316541)0.999999:0.05352390)1.000000:0.05258367)0.839070:0.01016052)0.999965:0.05239464)1.000000:0.09796641)0.999316:0.04087028)1.000000:0.25331651)0.978091:0.04103262)0.000000:0.00000001)1.000000:0.06302660)0.999992:0.04134639)1.000000:0.09708689)1.000000:0.09857944)0.999608:0.03103733)1.000000:0.08613021)0.996436:0.02043342); diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1-raxml.ascii new file mode 100644 index 0000000..8b015e8 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-4 + | + | /-A-mutant-1 + | | + | | /-recombinant + | | | + | | | /-B + | | | | + | | /-| | /-B-mutant-5 + | /-| | | | /-| + | | | | | | | | /-B-mutant-6 + | | | | | | | \-| + /-| | | | | | | | /-B-mutant-7 + | | | | | \-| /-| \-| + | | | | | | | | | /-B-mutant-8 + | | | | | | | | \-| + | | | | | | /-| | \-B-mutant-9 + | | | \-| | | | | + | | /-| | | | | \-B-mutant-4 + | | | | | | /-| | + | | | | | | | | \-B-mutant-3 + | | | | | \-| | + | | | | | | \-B-mutant-2 + | | | | | | + | \-| | | \-B-mutant-1 + | | | | +--| | | \-A + | | | + | | \-A-mutant-2 + | | + | \-A-mutant-3 + | + | /-A-mutant-6 + |--| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-8 + | \-| + | \-A-mutant-9 + | + \-A-mutant-5 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1-raxml.newick new file mode 100644 index 0000000..976ac7d --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1-raxml.newick @@ -0,0 +1 @@ +((A-mutant-4:0.009922,(((A-mutant-1:0.000001,((recombinant:0.000001,(B:0.051366,(((((B-mutant-5:0.000001,(B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-8:0.000001,B-mutant-9:0.041496):0.020195):0.085468):0.030693):0.097903,B-mutant-4:0.000001):0.096108,B-mutant-3:0.000001):0.040876,B-mutant-2:0.000001):0.062483,B-mutant-1:0.000001):0.000001):0.040654):0.253301,A:0.000001):0.040440):0.097106,A-mutant-2:0.000001):0.052111,A-mutant-3:0.000001):0.010117):0.052269,(A-mutant-6:0.000001,(A-mutant-7:0.000001,(A-mutant-8:0.000001,A-mutant-9:0.042275):0.042137):0.053015):0.053408,A-mutant-5:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1.fasta new file mode 100644 index 0000000..5836edf --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-10A1-B1.fasta @@ -0,0 +1,42 @@ +>A +TCGCCTGCCCTGCTGTCGAAAGCAGCGACTTGTCTACTGCTGATGCTGCAGGCATTATCCCTCGGCTAGGATCGGGTTAGAGCGGTTTTCCCAATTCTAA +>A-mutant-1 +TCGCCTGCCCTGCTGTCGAAAGTAGCGACTTGTCTACTGCTGATGCGGCTGGCATTATCCCTCGGCTAGGATCGGGTTAGAGCGGTTTTCCCAATTCCAA +>A-mutant-2 +TCGCCTTCACTGCTGTCGAAAGTAGCGACTTGTCTACTTCTGATGCGGCTGGCATTATCCCTCGGATAGGATCGGGTGAAAACGGAGTTCCCAATTCCAA +>A-mutant-3 +TCGCCTTCACCGCTGTCGAAAGTAGTGACTTGTCTACTTCTGATGCGGCTGCCATTATCCCTCGGATAGGATCGGGTGAAAACGGACTACCCAATTCCAA +>A-mutant-4 +TCGCCTTCACCGCTGTCGAAAGTAGTGACTTGTCTCCTTCTGATTCGGCTGCCATTATCCCTCGGATAGGATCGGGTGAAAACGGACTACCCAATTCCAA +>A-mutant-5 +TCGCCTTCACCGCTGTCGAAAGTAGGGACTTGTCTCCTGCCGATGCGGCTGCCATTATCTCTCGGATAGGATCGGGGGAAAACGGACTACCCAATTCCAA +>A-mutant-6 +TCGCCTTCACCGCTGACGAAGGTAGGGAATTGTCTCCTGCCGATGCGGCTCCCATTATCTCTCGGATAGGAACGGGGGAAAACGGACTACCCAATTCCAA +>A-mutant-7 +TCGCCTTCACCGCTGACGAAGGTAGGGAATTGTCACCTGCCGATGAGGCTCCCATTATCTCTCGGATAGGACCGGGGTAAAACGGACTACCCAATGCCAA +>A-mutant-8 +TCGCCTTCACCGCTGACGAAGGTAGGGAATTGTCACCTGCCGATGAGCCTCCCATTATCTGTTGGATAGGACCGGGGTAAAACGGACTACTCAATGCCAA +>A-mutant-9 +TCGCCTTCACCGCTGACGAATGTAGGGAATTGTCACCTGCGGATGAGCCTCCCTTTATCTGTTGGATAGGACCGGGGTAAAACGGAATACTCAATGCCAA +>B +TGGGCTGTTCAGCTGTCGAAACCAGCGTTATGTCTATTGCTGATGATGCAGTTATTATCCCTCCGCTCTGATCGGGCAAGAGCTGTACACCCAATTCTCA +>B-mutant-1 +TGGGCTGTTCAGCTGTCGAAACCAGCGTTATGTCTATTGCTGATGATGCAGTTATTATCGATCCGCTCGGATCTGGCAAGAGCTGTCCACCCAATTCTCA +>B-mutant-2 +TGGGCTGTTCAGCTGCCGAAACCAGCGTTATGTCTATTGATGATGATGCAGTTCTTATCGATCCGCTCGGATCTGGCAAGAGCTGTCCTCCCGACTCTCA +>B-mutant-3 +TGGGCTGTTCAGCTGCCGAGACGAGCGTTATGTCTAGTCATGATGATGCAGTTCTTATCGATCCGCTCGGATCTGGCAAGAGCTGTCCTCCCGACTCTCA +>B-mutant-4 +TGGGCTGTTCAGCTGTCGAGCCGAGCGCCATGTCTAGTCATGATGATGCAGTTTTGATCGATCCGCTCGGATCTGGCAAGAGCAATCCTCCTGACTCTCA +>B-mutant-5 +TGGACTGCTCAGCTGTCGCGCGGAGGGGCATGCCTAGTCATGATGATGCAGTTTCGATCGATCCGCTCGGATCAGGCAAGAGCAATCCTCCTGACTCTCA +>B-mutant-6 +TGGACCGCTCAGCTGTTGCGCGGAGGGGCATGCCTAGTCATGATGATGCAGTTTCGATAGATCCGCTCGGATCAGGCAAGAGCAATCCTCCTGACTCTCA +>B-mutant-7 +TGGACCGCGCAGCTGTTGCGTTGAGTGGCATGCCCAGTCATGTTTATGCAGTTTCGATAGATCCGCTCGGATCAGGCAAGAGCAATCCTCCTGACGCTCA +>B-mutant-8 +TGGACCGCGCAGCTGTTGCGTTGAGTGGCATGCCCAGTCATGTGTATGCAGTTTCGATAGATCCGCTCGGATCAGGCAAGAGCAATCCTCCTCACGCTCA +>B-mutant-9 +TGGACCGCGCAGCTGTTGGGTTGAGTGGCATGCCAAGTCATGTGTATGCAGTTTCGATAGATCAGCTGGGATCAGGCAAGAGCAATCCTCCTCACGCTCA +>recombinant +TCGCCTGCCCAGCTGTCGAAACCAGCGTTATGTCTATTGCTGATGATGCAGTTATTATCGATCCGCTCGGATCTGGCAAGAGCTGTCCACCCAATTCTCA diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1-phyml.ascii new file mode 100644 index 0000000..73aefab --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1-phyml.ascii @@ -0,0 +1,40 @@ + + /-A-mutant-9 + | +--|--A-mutant-8 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-B + \-| + | /-recombinant + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1-phyml.newick new file mode 100644 index 0000000..6cd1309 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.06190172,A-mutant-8:0.00000001,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.01014595,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,(A:0.00000000,(B:0.00000001,(recombinant:0.05271337,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00000000,(B-mutant-5:0.00000001,(B-mutant-6:0.00000001,(B-mutant-7:0.00000001,(B-mutant-9:0.08418740,B-mutant-8:0.00000001)0.999979:0.04110977)0.922693:0.02028229)1.000000:0.09668717)0.999999:0.05265636)0.951427:0.01017517)1.000000:0.05257413)0.000000:0.00000001)0.997870:0.03119592)1.000000:0.14880028)1.000000:0.08814281)0.996159:0.02089125)1.000000:0.06595371)0.980502:0.02101934)1.000000:0.05239054)1.000000:0.07414709)1.000000:0.05181792)1.000000:0.09651402); diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1-raxml.ascii new file mode 100644 index 0000000..e8289e5 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-1 + | + /-| /-A + | | | + | | | /-B + | \-| | + | | | /-B-mutant-1 + | | | /-| + | | | | \-B-mutant-2 + | \-| | + | | | /-B-mutant-5 + | | | | + | | | | /-B-mutant-8 + | | | /-| /-| + /-| \-| | | /-| \-B-mutant-9 + | | | | | | | + | | | /-| \-| \-B-mutant-7 + | | | | | | + | | | | | \-B-mutant-6 + | | | /-| | + | | | | | \-B-mutant-4 + /-| | \-| | + | | | | \-B-mutant-3 + | | | | + | | | \-recombinant + | | | + | | \-A-mutant-2 +--| | + | \-A-mutant-3 + | + |--A-mutant-4 + | + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1-raxml.newick new file mode 100644 index 0000000..01a0248 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1-raxml.newick @@ -0,0 +1 @@ +((((A-mutant-1:0.000001,(A:0.000001,(B:0.000001,((B-mutant-1:0.000001,B-mutant-2:0.000001):0.000001,((((B-mutant-5:0.000001,(((B-mutant-8:0.000001,B-mutant-9:0.083787):0.041006,B-mutant-7:0.000001):0.020260,B-mutant-6:0.000001):0.096013):0.052393,B-mutant-4:0.000001):0.010159,B-mutant-3:0.000001):0.052316,recombinant:0.052429):0.000001):0.031076):0.146647):0.087255):0.020802,A-mutant-2:0.000001):0.065297,A-mutant-3:0.010130):0.020902,A-mutant-4:0.000001,(A-mutant-5:0.000001,(A-mutant-6:0.000001,(A-mutant-7:0.000001,(A-mutant-9:0.061678,A-mutant-8:0.000001):0.095773):0.051616):0.073684):0.052126):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1.fasta new file mode 100644 index 0000000..505e474 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-20A1-B1.fasta @@ -0,0 +1,42 @@ +>A +TAAGTTAGGCTTTTAACAGCCCCCCAGTCGCGGTGACCGAGGCAACGGCCGAGAGCAACAAACCTACACAGCGTCCCTGTATTCTCCCCGGCAAAGAGCG +>A-mutant-1 +CAAGTAAAGCTTTTAACAGCCCCCCAGTCGCGCTGACCGAGGCAACGGCCGAGAGCAACAAACGTACACAGCGTCGATGTATTCTCCCCGGTAAAGAGCG +>A-mutant-2 +CAAGTAAAGCTTTTAACAGCCCCCCAGTCGCGCTGACCGAGGCAACGGCCCAGAGCAACAAACGTACACAGCGTCGATGTATTCTCCTCGGTAAAGAGCG +>A-mutant-3 +CAAATAAAGCTTTTAACCGCCCGCCTGTCTCGCTGACCGAGGCAACGGCCCAGAGCAACAAACGTACACAGCGACGATGTATTCTCCTCGGTAAATAGCG +>A-mutant-4 +CAAATAAAGTTTTTAACCGCCCGCCTGTCTCGCTGACCGAGGCAACGGCCCAGAGCAACAAACGTACACAGCGACGATGTATTCTCTTCGGTAAAGAGCG +>A-mutant-5 +CAAATAAAGTTTTTAACCGCCCGCCTGTTTCGCTGAGTGAGGCAACGGCCCAGATCAGCAAACGTACACAGCGACGATGTATTCTCTTCGGTAAAGAGCG +>A-mutant-6 +CTAATAAAGTTTTTAAGCGCCCGCCTGTTTCGCTGAGTGAGGCATCGGCCGAGATCAGCAAACGTACTCAGCGAAGATGTATTCTCTTCGGTAAAAAGCG +>A-mutant-7 +CTAATAAAGTTTTTAAGCGCCCTCCTGTTTCGCTGAGTGCGGCATCGGGCGAGATCAGCAAACGTACTCAGCGAAGATGCATTCCCTTCGGTAAAAAGCG +>A-mutant-8 +CTAATAAAGTTTTTAAGCGCCCTGCTGTTTCGCTGAGTGCCGCATCGGGTCAGATTAGCGAACGTACTCAGCGAAGGTGCATTCCCTTCGGTCAAACGCG +>A-mutant-9 +CTAATAAGGTCTTTAAGCGCCCTGCTGATTCGTTGAGTGCCGCATCGGGTCAGATGAGCTAACGTACTCAGCGAAGGTGCATTCCCTTCGGTCAAACGCG +>B +TAAGATTGGCTTTTAACAGCCCCCCGGTCGCGGTGAGCTAGGCAAAGGCCGAGGGCAATAAGCCTACACAGCGTCCCAGTATTATTCCCGGCAAAGATCG +>B-mutant-1 +TAAGATTGGCTTTTAACAGCCCCCCGGTCGCGGTGAGCTGGGCAAAGGCCGAGGGCAATAAGCCTCCACAACGTCCCAGTATTATTCCCGGCAAAGATCG +>B-mutant-2 +TAAGATTGGCTTTTAACAGCCCCCCGGTCGCGGTGAGCTGGGCAAAGGCCGAGGGCAATAAGCCTCCACAACGTCCCAGTATTATTCCCGGCAAAGATCG +>B-mutant-3 +TAAGATTGGCTTGTAACAACCCCCCGGTCGCGGTGAGCTGGGCATAGGCCGAGGGCAATAAGCCTCCACAACGTCGCAGTATTATTCCCTGCAAAGATCG +>B-mutant-4 +TAAGATTGGCTTGTAACAACCCCCCGGTCGCGGTGAGCTGGGCATAGGCCGAGGGCAATAAGCCTCCACAACGACGCAGTATTATTCCCTGCAAAGATCG +>B-mutant-5 +TAAGATTGGCTTGTAACAACCCCCCGGTCGCGGTGAGCTGGGCATAGGTTGAGGGCAATAAGCCTCAACAACGACGCAGTATTAATGCCTGCAAAGATCG +>B-mutant-6 +TAAGAATGGCTTATAACAACCCCTTGGTCGCGGTGAGCTGGGCATAGGTTGAAGGCAATAACCCTTAACAACGACGCAGTATGAATGCCTGCAAATATCG +>B-mutant-7 +TAAGAATGGCTTATAACAACCCCTTGGTCGCGGTGAGCTGGGCATAGGTTGAAGGCAATAACCCTTAACAACGACGCAGTATGAATGCCTGCGGATATCG +>B-mutant-8 +TAAGGATGGCTTATAACAACCCCTTGGTCGCGGTGAGCTGGGCATAGGTTGAATGCAATAACCCTTAACAACGACGCAGTATTAATGCCTGCGTATATCG +>B-mutant-9 +TGAGGATGGCTTGTAACAACCCCTTGGGGGCGGTGAGCTGGGCATGGGTGGAATGCAAAAATCCTTAACAACGACGCAGTATTAATGCCTGCGTATATCG +>recombinant +CAAGTAAAGCTTTTAACAGCCCCCCGGTCGCGGTGAGCTGGGCAAAGGCCGAGGGCAATAAGCCTCCACAACGTCCCAGTATTATTCCCGGCAAAGATCG diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1-phyml.ascii new file mode 100644 index 0000000..813765d --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-9 + | +--|--B-mutant-8 + | + | /-B-mutant-7 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-1 + \-| + | /-B + \-| + | /-recombinant + \-| + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1-phyml.newick new file mode 100644 index 0000000..e9f40b5 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.03086613,B-mutant-8:0.00000001,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00000000,(B-mutant-2:0.00000000,(B-mutant-1:0.00000001,(B:0.02064647,(recombinant:0.00000001,(A:0.04283994,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000001,(A-mutant-4:0.00000001,(A-mutant-5:0.00000000,(A-mutant-6:0.00000000,(A-mutant-7:0.00000000,(A-mutant-9:0.04090993,A-mutant-8:0.00000000)0.999999:0.04081637)0.968541:0.00999466)0.998744:0.02020008)1.000000:0.07343004)0.997900:0.03058565)1.000000:0.05194527)0.999999:0.04128889)0.824119:0.01940821)1.000000:0.13574249)0.999896:0.07456344)0.754730:0.00997034)1.000000:0.04146567)0.999987:0.03082556)0.999990:0.04106184)1.000000:0.08535161)0.999848:0.03071114)1.000000:0.06299271)1.000000:0.05222209); diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1-raxml.ascii new file mode 100644 index 0000000..f0ba096 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-6 + | + | /-B-mutant-5 + | | + | | /-B-mutant-1 + | | | + | | | /-A + | | | | + /-| | | | /-A-mutant-2 + | | | | | | + | | | | | | /-A-mutant-8 + | | | | | | /-| + | | | | /-| | /-| \-A-mutant-9 + | | | /-| | | | | | + | | | | | | | /-| /-| \-A-mutant-7 + | | | | | | | | | | | + | \-| | | | | | | /-| \-A-mutant-6 + | | | | | | | | | | + | | | | | | | | /-| \-A-mutant-5 + | | | | /-| \-| | | | + | | | | | | | \-| \-A-mutant-4 + | | /-| | | | | | + | | | | | | | | \-A-mutant-3 + | | | | \-| | | +--| | | | | | \-A-mutant-1 + | | | | | | + | | /-| | | \-recombinant + | | | | | | + | | | | | \-B + | | | | | + | \-| | \-B-mutant-2 + | | | + | | \-B-mutant-3 + | | + | \-B-mutant-4 + | + | /-B-mutant-9 + |--| + | \-B-mutant-8 + | + \-B-mutant-7 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1-raxml.newick new file mode 100644 index 0000000..9bf13ff --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1-raxml.newick @@ -0,0 +1 @@ +((B-mutant-6:0.000001,(B-mutant-5:0.000001,((((B-mutant-1:0.000001,(((A:0.042848,((A-mutant-2:0.000001,((((((A-mutant-8:0.000001,A-mutant-9:0.040906):0.040813,A-mutant-7:0.000001):0.009995,A-mutant-6:0.000001):0.020201,A-mutant-5:0.000001):0.073449,A-mutant-4:0.000001):0.030598,A-mutant-3:0.000001):0.051964):0.041301,A-mutant-1:0.000001):0.019415):0.135780,recombinant:0.000001):0.074575,B:0.020653):0.009970):0.041467,B-mutant-2:0.000001):0.030826,B-mutant-3:0.000001):0.041061,B-mutant-4:0.000001):0.085354):0.030709):0.062987,(B-mutant-9:0.030862,B-mutant-8:0.000001):0.052219,B-mutant-7:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1.fasta new file mode 100644 index 0000000..626a196 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-30A1-B1.fasta @@ -0,0 +1,42 @@ +>A +CCGCGGACGCCGAAATAACTATAGCTGGCATCTTACAGGAGCGCTATCGTGGGCAGGGCCTAGGGACTGTGCAACCTATTGGTTATGACAATCCCGCTCC +>A-mutant-1 +CCGCGGACGCCGAAATATATATAGCCGGCATCTTACAGGAGCGCAATCGTGGGCAGGGCCTAGGGACTGTTCAACCTATTGGTTATGACAATCGCGCTCC +>A-mutant-2 +CCGCGGACGCCGAAATATATATAGCCGGCATTTCACAGGAGCCCAATCGTGGGCAGGGCCTAGGGACTGTTCAACCTATTGGTTACGACAATCGCGCTCC +>A-mutant-3 +CCGCGGACGCCGAAATATATATAGCCGGCATTTCACAGGAGCCGAATCGTGGGCTGGGCCGAGGGACTGTTTAACCTATTGGTTACGACGATCGCGCTCC +>A-mutant-4 +CCGCGGACGCCGAAATATATATAGCCGGCATTTCACAGGAGCTGAATCGTGGGCTGGGCCGATGGACTGTTTAACGTATTGGTTACGACGATCGCGCTCC +>A-mutant-5 +CCCCGTACGCCGAAATATATATAGCCGGCATTTCACAGGAGCTGAATCGTGGACTGTGCCGATGGACTGTTAAACTTATTGGTTACGAAGATCGCGCTCC +>A-mutant-6 +CCCCTTAAGCCGAAATATATATAGCCGGCATTTCACAGGAGCTGAATCGTGGACTGTGCCGATGGACTGTTAAACTTATTGGTTACGAAGATCGCGCTCC +>A-mutant-7 +CCCCTTAAGCCGAAATATATATAGCCGGCATTTCACACGAGCTGAATCGTGGACTGTGCCGATGGACTGTTAAACTTATTGGTTACGAAGATCGCGCTCC +>A-mutant-8 +CCCCTTAAGCCGAAAAAAATATAGCCGGCATTTCACACGAGCTGAATCGTGGACTGTGCCGATGGACTTTTAAACTTATTGGTTACGAAGATTGCGCTCC +>A-mutant-9 +CCCCTTAAGCCGAAAAAAATATAGCCGGCATTTCATACCCGCTGAATCGTGGACTGTGCCGATGGACTTTTAAGCTTATTGGTTACGAAGATTGCGCTCC +>B +CCGCGGGTGCCGAAATAAGTAAAGCTGGTATGTTACAGGAGCGCTAGGATGGGACGGACCTAGGAACCGTTCAACCTATTGGTTATGACAATGCCGCTCC +>B-mutant-1 +CCGCGGGTACCGAAATAAGTAAAGCTGGTATGTTACAGGACCGCTAGGATGAGACGGACCTAGGAACCGTTCAACCTATTGGTTATGACAATGCCGCTCC +>B-mutant-2 +CCGCGGGTACCGAAATAAGTAAAGCTGGTATGTTACAGGACCACTAGGATGAGACGGACCTAGGAACCGTTTAACCTATTGGTTATGACAATGCAGCTAC +>B-mutant-3 +CCGCGGGTACCGAAAGAAGTAAAGCTGGTATTTTACAGGACCACTCGGATGAGACGGACCTAGGAACCGTTTAACCTATTGGTTATGACAATGCAGCTAC +>B-mutant-4 +CCGCGGGTACCGAAAGAAGTAAAGCTGGTTTTTTACAGGACCACTCGGATGAGACGGTCCTAGGAACCGATTAACCTATTGGTAATGACAATGCAGCTAC +>B-mutant-5 +CCCCGGGTACCCAAAGAAGTAAAGCTGGTTTATGACAGGACCACTCGGATGAGACGGTCCTGTGAACCGATTAACCTATTGGTAATAACCATGCAGCTAC +>B-mutant-6 +CCCCGGGTACTCAAAGAAGTAAAGCTGGTTTATGACAGGACCACTCGGATGAGACGGTCCTGTGAACCGATTAACCTATTGGAAATAACCTTGCAGCTAC +>B-mutant-7 +CCCCGGGTGCTCAAAGAAGTAAAGCTGGTTTATGACAGGACAATTCGGATGAGACGGACCTGTGAACCGATTAACCAATCGGAAATAACCTTGCAGCTAC +>B-mutant-8 +CCCCGGGTGCTCAAAGAAGTAAAGCTGGTTTATGACATGACAATTCGGATTGGACGGACCTGTCAACCGATTAACCAATCGGAAATAACCTTGCAGCAAC +>B-mutant-9 +CCCCGGGTGCTCAAAGACGTAAAGCTGGTTTTTGACATGACAATTCGGATTGGACGCACCTGTCAACCGATTAACCAATCGGAAATAACCTTGCAGCAAC +>recombinant +CCGCGGACGCCGAAATATATATAGCCGGCATGTTACAGGACCGCTAGGATGAGACGGACCTAGGAACCGTTCAACCTATTGGTTATGACAATGCCGCTCC diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1-phyml.ascii new file mode 100644 index 0000000..353176b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-9 + | +--|--A-mutant-8 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-recombinant + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1-phyml.newick new file mode 100644 index 0000000..078813d --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.06269914,A-mutant-8:0.00000000,(A-mutant-7:0.00000001,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00000001,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,(A:0.00000000,(B:0.00000001,(B-mutant-1:0.00000001,(recombinant:0.04190571,(B-mutant-2:0.00000001,(B-mutant-3:0.00000000,(B-mutant-4:0.00000000,(B-mutant-5:0.00000001,(B-mutant-6:0.00000000,(B-mutant-7:0.00115602,(B-mutant-9:0.02038393,B-mutant-8:0.00000001)0.999993:0.04062706)0.950910:0.01940180)0.461941:0.00997704)1.000000:0.07257933)0.999958:0.03041212)0.998654:0.02018314)1.000000:0.06314113)0.448349:0.00934946)0.999384:0.06214694)1.000000:0.24873201)0.983654:0.02007905)1.000000:0.06189506)1.000000:0.07283715)0.996898:0.03030145)1.000000:0.06174919)0.999945:0.03025387)0.999988:0.03033816)0.999998:0.04075403); diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1-raxml.ascii new file mode 100644 index 0000000..c328a80 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A + | + | /-A-mutant-2 + | | + | | /-A-mutant-6 + | | | + /-| | /-| /-A-mutant-9 + | | /-| | | /-| + | | | | | \-| \-A-mutant-8 + | | | | /-| | + | | | | | | \-A-mutant-7 + | | | | /-| | + | \-| | | | \-A-mutant-5 + /-| | \-| | + | | | | \-A-mutant-4 + | | | | + | | | \-A-mutant-3 + | | | + | | \-A-mutant-1 + | | + | \-recombinant + | + | /-B-mutant-2 + | | + | | /-B-mutant-4 + | | | +--|--| /-| /-B-mutant-5 + | | | | | + | | | \-| /-B-mutant-7 + | | | | /-| + | | | | | | /-B-mutant-9 + | \-| \-| \-| + | | | \-B-mutant-8 + | | | + | | \-B-mutant-6 + | | + | \-B-mutant-3 + | + | /-B-mutant-1 + \-| + \-B diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1-raxml.newick new file mode 100644 index 0000000..5c85c85 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1-raxml.newick @@ -0,0 +1 @@ +(((A:0.009602,((A-mutant-2:0.000001,((((A-mutant-6:0.000001,((A-mutant-9:0.062730,A-mutant-8:0.000001):0.040629,A-mutant-7:0.000001):0.030330):0.030239,A-mutant-5:0.000001):0.061630,A-mutant-4:0.000001):0.030229,A-mutant-3:0.000017):0.072939):0.061792,A-mutant-1:0.000001):0.010357):0.248624,recombinant:0.000001):0.042140,(B-mutant-2:0.000001,((B-mutant-4:0.000001,(B-mutant-5:0.000001,((B-mutant-7:0.002266,(B-mutant-9:0.020381,B-mutant-8:0.000001):0.040018):0.019028,B-mutant-6:0.000001):0.009979):0.072606):0.030382,B-mutant-3:0.000001):0.020126):0.063074,(B-mutant-1:0.000001,B:0.061952):0.009286):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1.fasta new file mode 100644 index 0000000..62193c0 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-40A1-B1.fasta @@ -0,0 +1,42 @@ +>A +CTTGCTTCCTTGTATCCCAACAATCGTGACGGACGTTCAGTATGGCCCCGGCTGACACCTTGTGCACAATGGTGCTTGACTAAAAGGCATTAGGGCGAGG +>A-mutant-1 +CTTGCTTCCTAGTATCCCAACAATCGTGACGGACGTTCAGTATGGCCCCGGCTGACACCTTGTGCACAATGGCGCTTGACTAAAAGGCATTAGGGCGAGG +>A-mutant-2 +CTCGCTTCATAGTATCCCAACAATCGTGACGGTCGTTCAGTATCGCCCCGGCTGACACCTTGTGCACAATGGCGGTTGACTAAAAGGCATTAGGGTGAGG +>A-mutant-3 +CTCGGTTCATAGTATCCCAACAATCATGACGGTCGTTCAGTATCGCCCCGTCTGTCACCTTGTGCACCATGGCGGTTGACTAAAAGGCTTTAGGGAGAGG +>A-mutant-4 +CTCGGTTCATAGTATCCCAACAATCATGACGGCCGATCAGTATCGCCCCGACTGTCACCTTGTGCACCATGGCGGTTGACTAAAAGGCTTTAGGGAGAGG +>A-mutant-5 +CTCAGTTCATAGTGTCCCAACAATTATGACGGCCCATCATTATCGCCCCGACTATCACCTTGTGCACCATGGCGGTTGACTAAAAGGCTTTAGGGAGAGG +>A-mutant-6 +CTCAGTTCAAAGTGTCCCAACAGTTATGACGGCCCATCATTATCGCCCCGACTATCACCTTGTGCACCATGGCGGTTGACTAACAGGCTTTAGGGAGAGG +>A-mutant-7 +CTCAGTTCAAAGTGTCCCAACAGTTATGACGGCCCATCATTGTCGCCCCGACTATCACCTTGTGCACCATGGCGGTTGACTAACAGGCTATAGGTAGAGG +>A-mutant-8 +CTCACTCCAAAGTGTCCCAACAGTTATGACGGCCCTTCATTGTCGCCCCGACTATCACCTTATGCACCATGGCGGTTGACTAACAGGCTATAGGTAGAGG +>A-mutant-9 +GTCACTCCAAACTGTCCCAACAGTTATGACGGCCCTTCATTGTCGCCCCGACTATCACCCTATGCACCATGGCGGTTGACTACCAGGCTATATGTAGACG +>B +CTTGCTTCCTTGTCTCCCAACAATCGGGACGGAAGTTCAGTATGGCCTCTCCTGGCACCTGGTGAACAAGGGTTCGTATGTAAAGGGCCTTGGAGGGCGG +>B-mutant-1 +CTTGCTTCCTTGTCTCCCAACAATCGGGACGAAAGTTCAGTATGACCTCTCCTGGCACCTGGTGAACAACGATTCGTATGTAAAGGGCCTTGGAGGCTGG +>B-mutant-2 +CTTGCTTCCTAGTCTCCTATCAATCGGGACCAAAGTTCAGTATGACCTCTCCTAGCACCTGGTGAACTAAGATTCGTATGTAAAGGGCCTTGGAGGCTGG +>B-mutant-3 +CTTGCTTCCTAGTCTCTTATCAATCGGGACCAAAGTTCAGTATGACCTCTCCTAGCACCTGGTGAACTAAGGTTCGTATGTAAAGGGCCTTGGAGGCTGG +>B-mutant-4 +CTTGCATCCTAGTCTCTTATCAATCGGGACCAAAGTTCAGTATGACCTCTCCTAGCACTTGGTGAACTAAGGTTCGTATGTAAAGGGCCTTGGAGGATGG +>B-mutant-5 +CTTGCAACCTAGTCTCTTATCAATCGGGACCAAAGTTCAGTATGACCTCTCCTGGCCCTTGGTGAGCTAAGGTACGTAGGTAAAGGCCCTTGGAGGATGG +>B-mutant-6 +CTTGCACCCTAGTCTCTTATCAATCGGGACCAAAGTTCAGTATGACCTCTCCTGGCCCTTGGTGAGCTAAGGTACGTAGGTAAAGGCCCTTGGAGGATGG +>B-mutant-7 +CTTGCACCCTAGTCTCTTATCAATCGGGACCAACGTTCAGTATGACCTCTCCTGGCCCTTGGTGAGCTAAGGTACGTAGGTAAAGGCCCTTGGAGGATCG +>B-mutant-8 +CTTGCACCCTAGTCTCTTATCAATCGGGACCAAGGTTCAGTATGACCTCTCCTGACCCTTGGTGAGCTAAGGTACGTTGGTAAACGCCCTTGGAGGATCG +>B-mutant-9 +CTTGCACCCTAGTCTCTTATCAATCGGGACCAAGGTTCAGTATGACCTCTCCTGACCCTTGGTGAGCTAAGGTACGTTGGTAAACTTCCTTGGAGGATCG +>recombinant +CTTGCTTCCTAGTATCCCAACAATCGTGACGGACGTTCAGTATGACCTCTCCTGGCACCTGGTGAACAACGATTCGTATGTAAAGGGCCTTGGAGGCTGG diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1-phyml.ascii new file mode 100644 index 0000000..92ea7e5 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1-phyml.ascii @@ -0,0 +1,40 @@ + + /-B-mutant-8 + | +--|--B-mutant-9 + | + | /-B-mutant-7 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-1 + \-| + | /-recombinant + \-| + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1-phyml.newick new file mode 100644 index 0000000..aa173c7 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000001,B-mutant-9:0.04127940,(B-mutant-7:0.00000000,(B-mutant-6:0.00000001,(B-mutant-5:0.00000001,(B-mutant-4:0.00000000,(B-mutant-3:0.00962746,(B-mutant-2:0.00000000,(B-mutant-1:0.00000000,(recombinant:0.00000000,(A:0.05182408,(A-mutant-1:0.00000000,(A-mutant-2:0.00000001,(A-mutant-3:0.00000001,(A-mutant-4:0.00000000,(A-mutant-5:0.02012055,(A-mutant-6:0.00000001,(A-mutant-7:0.00000001,(A-mutant-9:0.04073191,A-mutant-8:0.00000000)0.999998:0.04050572)1.000000:0.05163765)0.999907:0.04150885)0.999999:0.05262305)1.000000:0.07319428)0.993994:0.03043336)1.000000:0.06236619)0.829734:0.02327194)0.999996:0.08483640)1.000000:0.10941719)0.999999:0.05310634)0.999996:0.04257285)0.999990:0.04195673)0.999998:0.04091834)0.999984:0.03046408)0.999999:0.04094868)1.000000:0.04131549); diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1-raxml.ascii new file mode 100644 index 0000000..951a3d3 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-1 + /-| + | \-B + | + | /-recombinant + /-| | + | | | /-A-mutant-1 + | | | | + | | | /-| /-A-mutant-2 + | | | | | | + | \-| | \-| /-A-mutant-3 + | | | | | + | | | \-| /-A-mutant-4 + | | | | | + | | | \-| /-A-mutant-5 + | | | | | + | \-| \-| /-A-mutant-7 + | | | /-| + | | | | | /-A-mutant-8 + | | \-| \-| +--| | | \-A-mutant-9 + | | | + | | \-A-mutant-6 + | | + | \-A + | + |--B-mutant-2 + | + | /-B-mutant-4 + | | + | | /-B-mutant-6 + | /-| /-| + | | | | | /-B-mutant-7 + | | | | \-| + | | \-| | /-B-mutant-8 + \-| | \-| + | | \-B-mutant-9 + | | + | \-B-mutant-5 + | + \-B-mutant-3 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1-raxml.newick new file mode 100644 index 0000000..643cb23 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1-raxml.newick @@ -0,0 +1 @@ +(((B-mutant-1:0.000001,B:0.000001):0.000001,(recombinant:0.000001,((A-mutant-1:0.000001,(A-mutant-2:0.000001,(A-mutant-3:0.000001,(A-mutant-4:0.000001,(A-mutant-5:0.020094,((A-mutant-7:0.000001,(A-mutant-8:0.000001,A-mutant-9:0.040637):0.040390):0.051371,A-mutant-6:0.000001):0.041256):0.052255):0.072769):0.030331):0.062008):0.023209,A:0.051367):0.084029):0.108294):0.052717,B-mutant-2:0.000001,((B-mutant-4:0.000001,((B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-8:0.000001,B-mutant-9:0.041091):0.041114):0.040775):0.030366,B-mutant-5:0.000001):0.040755):0.041678,B-mutant-3:0.009637):0.042228):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1.fasta new file mode 100644 index 0000000..f443aec --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-50A1-B1.fasta @@ -0,0 +1,42 @@ +>A +TCAGAACCATCGACCTAGCCCGTGGGGCCTATAGTAAATTTCCCGGCCATCCCTCATCGAGCAAGCTCCGGAAGATCTTCGCTCAGTTAACAATAAGCCC +>A-mutant-1 +TTAGAACAATCGACCTAGACAGTGGGGCCTATAGTAAATTTCCCGGCCATCCCTCATCGAGCAAGCTCCGAATGATCTTCGCTCAGTTAACAATAACCCC +>A-mutant-2 +TTAGAACAATGGACCTAGACAGTGGGGCCTAAAGTAAATTTCCCGGCCATCCCTCATCGGGCAAGCTCCGAATGATCTTAGCTCAGTTAACAATATCCTC +>A-mutant-3 +TTAGAACAATGGACCTAGACAGTGGGGCCTACAGTAAATTTCCCGGCCATCCCTCGTCGGGCAAGCTCCGAATGATCTTAGCTCAGTTAACACTATCCTC +>A-mutant-4 +TTAGAACAATGGACGTAGACAGTGGGGCAAACAGTAAATTTCCCGGCCATCCCACCTCGGGCAAGCTCCGAATGATCTTAGCTCAGTTAACACAATCCGC +>A-mutant-5 +TTCGAGCAATGGACGTAGACAATGGGGCAAACAGTATATTTCCCGGCCATCCCACCGCGGGCAAGTTCCGAATGATCTTAGCTCAGTTAACTCAATCCGC +>A-mutant-6 +TTCAAACAAAGGACGTAGACAATGGGGCAAACAGTATATTTCCCGGCCATCCCACCTCGGGCAATTTCCGAATGAACTTAGCTCAGTTAACTCAATCCGC +>A-mutant-7 +TTCAGACAAAGGGCGTAGACAATGGGGCAAACAGTATATTTCTCGGCCATTCCACCTCGGGCAATTTCCGAATGAACTTAGCTCAGTTAACTCAAGCCGC +>A-mutant-8 +TTCAGGCAAAGGGCGTAGACAATGGGGCAAACAGTAAATTTCTCGGCCGTTCCACCTCGGGCAATTTCCGAATGAACTTAGCTCAGTTAACTCTAGCCGC +>A-mutant-9 +TTCTGGCAAAGGGCGTAGGCAATGGGGCAAACAGTAAATTTCTCGGCCGTTCCACCTCGGGCAAGTTCCGAATGAACTTAGCTCGGTTAACTCTAGCCGC +>B +GCAGAACCAACGACCTAGCCCGTCGGGCCTTTACTAAATTTCCAGGCCATCCCTCATCGAGCAGGCTCCTTAAGATCTTATCTCAGATCACCATAAGCCC +>B-mutant-1 +GCAGAACCAACGACCTAGCCCGTCGGGCCTTTACTAAATTTCCAGGCCATCCCTCATCGAGCAGGCTCCTTAAGATCTTATCTCAGATCACCATAAGCCC +>B-mutant-2 +GCATAACCAACGACCGAGCCCGTCGGGCCTTGACTAAATTTCCAGGTCATCCCTCATCGAGCAGGCTCCTTAAGAACTTATCTCAGATCACCATAAGCCC +>B-mutant-3 +GCATAACCAAAGACCGAGCCCGTCGGGCCTTGACTAAAATTCCAGGTCATCCCTCATCGAGTAGGCTCCTTAAGAGCTTATGTCAGATCACCATAAGCCC +>B-mutant-4 +GCATAACCAAAGACCGAGCCCGTCGGGCCTTGACTAAAAATGCAGGTCATCCCTCATCGAGTAGGCTCCTTAAGAAGTTATGTCAGATCACCATGAGCCC +>B-mutant-5 +GCATAACCAAAGTCCGAGCCCGTCGGGCCTTGACTAAAAATGCAGGTCATCCATCATCGAGTAGGCTCCTTAAGAAGTTATGTCTGATCACCAGGAGCCC +>B-mutant-6 +GCATAACGAAAGTCCGAGCCCATCGGGCCTTGACTAAAAATGCAGGTCATCCATCATCGAGTACGCTCCTTAAGAAGTTATGTCTGATCACCAGGAGCCC +>B-mutant-7 +GCATAACGCATGTCCCAGCCCATCGGGCCATGACTAAAAATGCAGGTCATCCATCATCGAGTACGCTCCTTAAGAAGTTATGTCTGATCACCAGGAGCCC +>B-mutant-8 +GCATAAGGCATGTCCCAGCCCATCGGGCCATGACTAAAAATGCAGGCCATCCATCATCGAGTACGGTCCTTAAAAAGTTATGTCTGATCACCAGGAGCCC +>B-mutant-9 +GCATAAGGCATGTCCCCGCCTATCGGGCCATGACTAAAAATGCAGGCCATCCATCATCGAGTACGGTCCTTAAAAATTTATGTCTGATCACCAGGGGCCC +>recombinant +TTAGAACAATCGACCTAGACAGTGGGGCCTATAGTAAATTTCCCGGCCATCCCTCATCGAGCAGGCTCCTTAAGATCTTATCTCAGATCACCATAAGCCC diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1-phyml.ascii new file mode 100644 index 0000000..c3b31c1 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-8 + | +--|--B-mutant-9 + | + | /-B-mutant-7 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-1 + \-| + | /-B + \-| + | /-recombinant + \-| + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1-phyml.newick new file mode 100644 index 0000000..b9b9f97 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000000,B-mutant-9:0.01006455,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00992807,(B-mutant-2:0.00975302,(B-mutant-1:0.00000001,(B:0.00920576,(recombinant:0.00000001,(A:0.07551056,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000001,(A-mutant-4:0.00000000,(A-mutant-5:0.00000000,(A-mutant-6:0.00000000,(A-mutant-7:0.00000000,(A-mutant-9:0.07366964,A-mutant-8:0.00000000)0.999997:0.05170863)0.999978:0.03063239)0.999999:0.04109617)1.000000:0.04124429)0.999980:0.03057167)1.000000:0.05157568)1.000000:0.05151487)0.812656:0.01907069)0.999995:0.09811464)1.000000:0.16973986)0.994009:0.03175912)0.999998:0.04169088)0.999630:0.03155495)1.000000:0.05219427)1.000000:0.05176266)1.000000:0.05154914)0.999994:0.04101755)1.000000:0.09600188); diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1-raxml.ascii new file mode 100644 index 0000000..86c8369 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-7 + /-| + | | /-A-mutant-9 + /-| \-| + | | \-A-mutant-8 + | | + | \-A-mutant-6 + | + |--A-mutant-5 + | + | /-A-mutant-2 + | | + | | /-B + | | | + | | | /-B-mutant-3 + | | | | + | | | /-| /-B-mutant-4 + | | | | | | +--| | | | \-| /-B-mutant-5 + | | /-| | | | + | | | | | | | /-B-mutant-9 + | /-| | | | \-| /-| + | | | | | /-| | /-| \-B-mutant-8 + | | | | | | | | | | + | | | | | | | \-| \-B-mutant-7 + | | | /-| | | | | + | | | | | \-| | \-B-mutant-6 + | | | | | | | + | | | | | | \-B-mutant-2 + | /-| | /-| | | + | | | | | | | \-B-mutant-1 + | | | | | | | + | | | \-| | \-recombinant + | | | | | + \-| | | \-A + | | | + | | \-A-mutant-1 + | | + | \-A-mutant-3 + | + \-A-mutant-4 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1-raxml.newick new file mode 100644 index 0000000..0ec96c2 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1-raxml.newick @@ -0,0 +1 @@ +(((A-mutant-7:0.000001,(A-mutant-9:0.073684,A-mutant-8:0.000001):0.051720):0.030637,A-mutant-6:0.000001):0.041106,A-mutant-5:0.000001,(((A-mutant-2:0.000001,((((B:0.009180,(((B-mutant-3:0.009931,(B-mutant-4:0.000001,(B-mutant-5:0.000001,(((B-mutant-9:0.010065,B-mutant-8:0.000001):0.096043,B-mutant-7:0.000001):0.041029,B-mutant-6:0.000001):0.051564):0.051782):0.052212):0.031560,B-mutant-2:0.009758):0.041704,B-mutant-1:0.000001):0.031797):0.169951,recombinant:0.000001):0.098216,A:0.075581):0.019056,A-mutant-1:0.000001):0.051536):0.051596,A-mutant-3:0.000001):0.030579,A-mutant-4:0.000001):0.041255):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1.fasta new file mode 100644 index 0000000..b19a5ea --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-60A1-B1.fasta @@ -0,0 +1,42 @@ +>A +GCTCCGTCCGACCCGCACAGCCGCGCTCCCGAAGTATGACTATTCCTTCAGGAGGTGTTGGAGGTACTCCGTCCCTTTGATACAGATAGTGACGAATAAG +>A-mutant-1 +GCTCCGTCCGACCGGCACGGCAGCGCTCCCGAAGTATGCCTATTCCCTAAGGAGGTGTTGGAGGTACTCCGTCCCTTTGATACAGAGACTGACGGATAAG +>A-mutant-2 +GCTCCGTCCGACCGGCACGGCAGCGCTCCCGAAGTATGCCTACGCCCTAAGCAGGTGTCGGAGGTACTCCGTCCCTCTGATACAGAGACTGACGGATAAG +>A-mutant-3 +GCTCCGTGCGACCGGCACGGTAGCGCTGCCGAAGTATGCCTACGCCCTAAGCAGGTATCGGAGGTACTCCGTCCCTCTGATACAGAGACTTACGGATAAG +>A-mutant-4 +GCTCCGTGCGACCGGCACGGTAGCGCTGCCGAAGTATGCCTACGCCCTAAGCAGGTATCGGAGGTACTTCGTCCCGATGATACAGAGACTTACGGATAAG +>A-mutant-5 +GCTACGTGCGACCGGCACGGTAGCGCTGCCGAAGTATGCCTACGCCATAAGCAGGTATCGGAGGTACTTCGTCCCGATGATACAGAGACTTACGGAAATG +>A-mutant-6 +GCTACGTGCGACCGGCACGGTAGCGCTGCCGAAGTATGCCTACGCCATAAGCAGGTATCAGAGGTACTTCATCTCGATGCTACAGAGACTTACGGAAATG +>A-mutant-7 +GCTACGTGCGACCGGCACGGTAGCGCTGCCGAAGTATGCCTACGCCATAAGCAGGTACCAGAGGTACTTCATCTCGATGCTACAGAGACTTTCGAAAATG +>A-mutant-8 +GCTACGTGCGACCGGCCCGGTAGCGCTGCCGAAGTATGCCTACGTTAAAAGCAGGTACCAGAGGTATTTCATCTCGATGCTACAGAGACTTTCGAAAATG +>A-mutant-9 +GCTACGTGCGACCGGCCCGGTAGCATTGCCGAAGTATGCCTACGTTAAAAGCAGGTACCAGAGGTAATTAATCGCGAGGCTACAGAGACTTTCGAAAATA +>B +GGTGAGTCGGACCCGCACAGCTTGGCTCCCGAAGTATGACTAAGCCTTCAGGCGGTGTTGAGCGCACTTCGTCCCTTTGGTACAGAGAGTTGCGGACAAG +>B-mutant-1 +GGTGAGTCGGAGACGCACAGCTTGGCTCCCGAAGTTTGACTAAGCCTTCAGGCGGTGTTGAGCGCACTTCGTCCCTTTGGTACAGATAGTTGCGGACAAG +>B-mutant-2 +GGTGAGTCGGAGACGCACAGCTTGGCTCCCGAAGTTTGCCTAAGCGTTCAGGCGGTGTTGAGCGCACTTCGTCCTTTTGTTACAGATAATTGCGGACAAG +>B-mutant-3 +GGTGAGTCGGAGACGCACAGCTTGGCTCCCGAAGGTTGCCGAAGGGTTCAGGCGGTGTTGAGCGCACTTCCTCCCTTTGTTACAGATAATTGCGGACAAG +>B-mutant-4 +GGTGACTCGGAGACGCACAGCTTGGCTCCCGAAGGCTGCCTAAGGGTTCAGGCGGTGTTTAGCGCACTTCCTCCCTTTCTTACAGATAATTGTGGACAAG +>B-mutant-5 +GGTGACTCGGAGACGCACAGCTTGGCTCCCGATGGCTGCCTAAGGGTTCAAGCGGTGATTAGCGCACTTCCTCCCTTTCTTACAGCTAATAGTGGACAAG +>B-mutant-6 +GGTGACTCGAAGACGCACACTTTGGCTCACGATGGCTGCCTAAGGGTTCAAGCGGTGATTAGCGGACTTCCTCCCTTTCTTACAGCTAATAGTGGACAAG +>B-mutant-7 +GGTGGCTCGAAGACGCACACTTTGGCTCACGAGGGCTGCCTAAGTGTTCAAGCGGTGATTAGCGGACTTCCTCCCTTTCTTACAGCTGATAGTGGACAAG +>B-mutant-8 +GGTGGCTCAAAGACCCACACTTTGGGACAAGAGGGCAGCCTAAGTGTTCAAGCGGTGATTAGCGGACTTCCTCCCTTTCTTCCAGCGGATAGTGGACAAA +>B-mutant-9 +GGTGGCTCAAAGACCCACACTTTGGGACAAGAGCGCAGCCTAAGTGTTCAAGCGGTGATTAGCGGACTTCCTCCCTTTCTTCCAGCGGATAGTGGACAAA +>recombinant +GCTCCGTCCGACCGGCACGGCAGCGCTCCCGAAGTATGCCTATTCCCTAAGGAGGTGTTGAGCGCACTTCGTCCCTTTGGTACAGATAGTTGCGGACAAG diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1-phyml.ascii new file mode 100644 index 0000000..1d19981 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-9 + | +--|--A-mutant-8 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-recombinant + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1-phyml.newick new file mode 100644 index 0000000..dd34e98 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.05286627,A-mutant-8:0.00000000,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000001,(A-mutant-3:0.00939434,(A-mutant-2:0.00000001,(A-mutant-1:0.00000000,(A:0.04968372,(recombinant:0.00000001,(B:0.06387256,(B-mutant-1:0.00000000,(B-mutant-2:0.00000001,(B-mutant-3:0.00000001,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000001,(B-mutant-7:0.00000001,(B-mutant-9:0.04091862,B-mutant-8:0.00000001)0.998688:0.03020637)0.999427:0.02002495)0.999998:0.04079319)1.000000:0.06227597)1.000000:0.07385372)0.998538:0.02046704)0.999995:0.03084340)0.431372:0.00970574)1.000000:0.14881920)0.999997:0.07335539)0.942538:0.02661225)1.000000:0.09767954)1.000000:0.06516542)0.999996:0.05444394)0.999999:0.05343216)0.999998:0.04224267)1.000000:0.04220085)0.999955:0.03116302); diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1-raxml.ascii new file mode 100644 index 0000000..164e2ee --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-7 + | + /-| /-A-mutant-6 + | | | + | | | /-A-mutant-5 + | \-| | + | | | /-A-mutant-4 + | | | | + | | | | /-A-mutant-2 + | \-| | | + | | | /-| /-A-mutant-1 + | | | | | | + | | | | \-| /-A + | | | | | | + | \-| | \-| /-recombinant + | | | | | + | | | | | /-B + | | | \-| | + | | | | | /-B-mutant-1 + | | | | | | + | | | \-| | /-B-mutant-4 +--| | | | | | + | | | | | /-| /-B-mutant-5 + | \-| | | | | | + | | \-| | | | /-B-mutant-9 + | | | | \-| /-| + | | | | | /-| \-B-mutant-8 + | | | /-| | | | + | | | | | \-| \-B-mutant-7 + | | | | | | + | | \-| | \-B-mutant-6 + | | | | + | | | \-B-mutant-3 + | | | + | | \-B-mutant-2 + | | + | \-A-mutant-3 + | + |--A-mutant-9 + | + \-A-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1-raxml.newick new file mode 100644 index 0000000..f338c6c --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1-raxml.newick @@ -0,0 +1 @@ +((A-mutant-7:0.000001,(A-mutant-6:0.000001,(A-mutant-5:0.000001,(A-mutant-4:0.000001,((A-mutant-2:0.000001,(A-mutant-1:0.000001,(A:0.049475,(recombinant:0.000001,(B:0.063572,(B-mutant-1:0.000001,(((B-mutant-4:0.000001,(B-mutant-5:0.000001,(((B-mutant-9:0.040881,B-mutant-8:0.000001):0.030215,B-mutant-7:0.000001):0.020043,B-mutant-6:0.000001):0.040797):0.062207):0.073711,B-mutant-3:0.000001):0.020465,B-mutant-2:0.000001):0.030825):0.009861):0.147575):0.072950):0.026601):0.097193):0.064814,A-mutant-3:0.009478):0.054165):0.053260):0.042135):0.042108):0.031136,A-mutant-9:0.052759,A-mutant-8:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1.fasta new file mode 100644 index 0000000..c716f88 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-70A1-B1.fasta @@ -0,0 +1,42 @@ +>A +TCTTTGTATGGCAAGAGGGCGTCACTAAGGCATACGACCACAGCCTATCAGACGAACCCGCTTTGGATGACGGCGACACGCATATTACTAGATGCGGCTG +>A-mutant-1 +TCTTGGTATGGCAAGAGGGCGTCACTAAGGCAAACGACCACAGCCTATCAGACGAACCCGCTCTGGATGACGGCGACACTAATAATACTAGAAGCGGCTG +>A-mutant-2 +TCTTGGTATGGCAAGAGAGCGTCAGTAAGGCAAACGACCACATCCTATCAGACGAGTTCGCCCTGGATGACGGTGACACTAATAATACTAGCAGCGGCTG +>A-mutant-3 +TCTTGGAATTGCAAGAGAGCGTCAGTAAGGCAAACGACGACATCCTATCAGACGAGTACGCCCTGGATGACGATGACAATAATAATATTAGCAGCGGCTG +>A-mutant-4 +TCTTAGTATTGCAAGAGCGCGTCAGTAAGGCAAACGACGACAACCTAACAGACGAGTACGCCCTGGATGACGATGATAATAATAATATTAGCAGCGGCTG +>A-mutant-5 +TCTTAGTATTGCAAGAGCGCGTCAGTAAGGCAAACGACGATAGCCTAACAGACGAGTAGGACCTGGATGACGATGATAATAATAATATTAGCAGCGGCTA +>A-mutant-6 +TCTTAGTATTCCAAGAGCGCGTCAGTAAGGCAAACGACGATAGCCTAACAGACGAGTTGCACCTGGATGACGATGATAATAATAATAGTAGCAGCGGCTA +>A-mutant-7 +TCTTAGTATTCCAAGACCGCGTCAGTAAGTCAAACGACGATAGCCTAACCGACGAGTTGCACCTGAATGACGATGATAATAATAATAGTAGCAGCGGCTA +>A-mutant-8 +TCTTAGTATTCCAAGACCGCGTCAGCAAGTCAAACGACGATAGCCTAACCGACGTGTTGCACCCGAATGACGATGATAATAATAATAGTAGCAGCGGCTA +>A-mutant-9 +TCTTAGTATTCCAAGACCGCGTCAGCAAGTCAAAGGACTATAGCCTAACCGACTTGTTGCAACCGAATGACGATGATAATAATCATAGTAGCAGCGGCTA +>B +TCTTCGTATGGCATTACGGTGTCACTAAGGTATACCACCATAGCCTATCTGATGAACCAGCTTTGGGTTAGGGAGACACGTATATTACTAGAAGCGGTTT +>B-mutant-1 +TCTGCGTATGGCAATACGGTGTCACTAAGGTATACCACCATAGCCTATCGGATGAACCAGCTCTGGGTTAAGGAGACACGTATATAACTAGAAGCGTTTT +>B-mutant-2 +CCTGCGTATGGCAATACGGTGTCACAAAGGTATACCACCATAGCCTATCGGATGAACCAGCTCTGGGTTAAGGAGACACGTATATAACTAAAAGCGTTTT +>B-mutant-3 +CCTGCGTATGGCAATACGGTGTCACAAAGGTATACCACCATAGCCTATCGGATGAACCCGCTCTGGGTTAAGGAGACACGTATATAACTAAAACCGTTTT +>B-mutant-4 +CCTGCGTATGGCATTACGGTGTCACAAAGGTATACCACCATAGCCTAACGGATGAACCCGCTCTGGGTTACTCGGACACGTATATATCTAAAACCGTTTT +>B-mutant-5 +CCTCCCTATGGCATTACGGTGCCACAAAGGTATACCAGCATAGCCTAACGGACGAAGCCGCTCTGGGTTACTCGGACACGTATATATCTAAAACCGTTTT +>B-mutant-6 +CCTCCCTATGGCATTACGGTGCCACGAAGGTATACCAGCATAGCCTAACGGACGAAGCCGTTCTGGGTTACTCGGTCACGTATATATCTAAAACCTTTTT +>B-mutant-7 +CCTCCCTATGGCATTACGGTGCCACGAAGGTATACCAGCATAGCCTAACGGACGAGGCCGTTCTGGGTTACTCGGTCAGGTATATATCTAAAACCTTTTT +>B-mutant-8 +CCTCCCTATGGCATTACGGTGCCACGAAGGTATACCAGCATAGCCTAACGGACGAGGCCGGTCTGGGTTATTCGGGCAGGTATATATCTAAAACCTTTTT +>B-mutant-9 +CCTCCCTATGGCATTACGGTGACACGAAGGTATAACAGCATGGCCTAACGGACGAGGCCGGTCTGGGTTATTCGGCCAGGTATATATCTAAAACCTTTTT +>recombinant +TCTTGGTATGGCAAGAGGGCGTCACTAAGGCAAACGACCACAGCCTATCAGACGAACCCGCTCTGGATGAAGGAGACACGTATATAACTAGAAGCGTTTT diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1-phyml.ascii new file mode 100644 index 0000000..f1c8f9d --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-9 + | + |--B-mutant-8 +--| + | /-B-mutant-7 + | | + \-| /-B-mutant-6 + | | + \-| /-B-mutant-5 + | | + \-| /-B-mutant-4 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-1 + | /-| + | | \-B + \-| + | /-recombinant + \-| + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1-phyml.newick new file mode 100644 index 0000000..7f6dfab --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.04106541,B-mutant-8:0.00000000,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000001,(B-mutant-4:0.00000000,(B-mutant-3:0.00000000,(B-mutant-2:0.00000000,((B-mutant-1:0.00000001,B:0.03059627)0.807724:0.01931213,(recombinant:0.00000001,(A:0.03011773,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000001,(A-mutant-4:0.00000000,(A-mutant-5:0.00000001,(A-mutant-6:0.00000000,(A-mutant-7:0.00000000,(A-mutant-9:0.05210258,A-mutant-8:0.00000000)0.999948:0.03083996)1.000000:0.06274815)0.999987:0.04086736)1.000000:0.05135240)0.999967:0.03028045)0.999999:0.04082219)1.000000:0.06152859)0.000000:0.00000001)1.000000:0.07241973)1.000000:0.16840984)0.998686:0.04245577)1.000000:0.05156116)0.998854:0.02026796)1.000000:0.05182584)0.999975:0.03049669)0.969179:0.01002375)0.999978:0.03051130); diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1-raxml.ascii new file mode 100644 index 0000000..cdb8fc7 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-2 + | + | /-A + | /-| + | | \-A-mutant-1 + | | + | | /-A-mutant-4 + | | | + | | | /-A-mutant-6 + | /-| /-| /-| + /-| | | | | | | /-A-mutant-7 + | | | | | | | \-| + | | | | | \-| | /-A-mutant-8 + | | | | /-| | \-| + | | | | | | | \-A-mutant-9 + | | /-| | | | | + | | | | \-| | \-A-mutant-5 + | | | | | | + | | | | | \-A-mutant-3 + | | | | | + | \-| | \-A-mutant-2 + | | | + | | \-recombinant + | | + | | /-B +--| \-| + | \-B-mutant-1 + | + | /-B-mutant-5 + | | + | /-| /-B-mutant-7 + | | | /-| + | | | | | /-B-mutant-9 + | | \-| \-| + |--| | \-B-mutant-8 + | | | + | | \-B-mutant-6 + | | + | \-B-mutant-4 + | + \-B-mutant-3 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1-raxml.newick new file mode 100644 index 0000000..295d4e1 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1-raxml.newick @@ -0,0 +1 @@ +((B-mutant-2:0.000001,((((A:0.030111,A-mutant-1:0.000001):0.000001,(((A-mutant-4:0.000001,((A-mutant-6:0.000001,(A-mutant-7:0.000001,(A-mutant-8:0.000001,A-mutant-9:0.052106):0.030843):0.062761):0.040865,A-mutant-5:0.000001):0.051351):0.030275,A-mutant-3:0.000001):0.040818,A-mutant-2:0.000001):0.061524):0.072422,recombinant:0.000001):0.168529,(B:0.030595,B-mutant-1:0.000001):0.019293):0.042474):0.051558,((B-mutant-5:0.000001,((B-mutant-7:0.000001,(B-mutant-9:0.041064,B-mutant-8:0.000001):0.030508):0.010022,B-mutant-6:0.000001):0.030494):0.051832,B-mutant-4:0.000001):0.020266,B-mutant-3:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1.fasta new file mode 100644 index 0000000..3991e6e --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-80A1-B1.fasta @@ -0,0 +1,42 @@ +>A +CTTATTTGCTTACTCGCAGATCCAACCTCACATAGCTGTGTTCGGGTACTCCGGACACTAACTCTCGGCCTGCCGGAACACCCGCGGGGAAATACGACAA +>A-mutant-1 +CTTATTTGCTTCCTCGCAGATCCAACCTCACATAGCTGTGTTCGGGTAGTCCGCACACTAACTCTCGGCCTGCCGGAACACCCGCGGGGAAATACGACAA +>A-mutant-2 +CTTTTGTGCTTCCTCGCAGATCCAAGCTGACATAGCTGCGTTCGGGTAGTCCGCACACTAACTCGCGGCCTGCCGGAACACCCGCGGGGAAATACGACAA +>A-mutant-3 +CTTTTGAGCTTCCTCGTAAATCCAAGCTGACATAGCTGCGTTCGGGTAGTCCGCACACTAACTCGCGGCCTGCCGGGACACCCGCGGGGAAATACGACAA +>A-mutant-4 +CTTCTGAGCTTCCTCGTAAATCCAAGCTGACATAGCTGCTTTCGGGTAGTCCGCACACTAACTCGCGGCCTGCCGGGACACCCGAGGGGAAATACGACAA +>A-mutant-5 +CTTCTAAGCTTCTTCGTAAATCCAAGCTGACATAGCTGCTTTCGGGTAGTCCGCCCACTAACTCGTGGACTGCCGGGACACCCGAGGGGAAATACGACAA +>A-mutant-6 +CTTCTAAGCTTCTTCGTAAATCCAAGCTGATATAACTGCTTTCGGGTAGTCCGCGCACTAACTCGTGGACTGACGGGACACCCGAGGGGAAATACGACAA +>A-mutant-7 +ATTCAAAGCTTCTTCGAAAATCCAAGCTGATATAACTGCTTTCGGGTAGCCCGCGCACTAACTCGTGGACAGAGGGGACACCCGAGGGGAAATACGACAA +>A-mutant-8 +ATTCAAAGCTTCTTCGAAAATCCAAGCTGATATAACTGCTTGCTGGTAGCCCGCCCACTAACTCGTGGACAGAGGGGACACCCGAGGGGAAATACGACAA +>A-mutant-9 +ATTCAAAGGTTCTTCGAAAAGCCAAGCTGGTATAACTGCTTGCTGGTAGCCCGCCCACTAACTCGTGGACAGAGGTGACACCCGAGGGGACATACGACAA +>B +TATAGTTGCTTCCTCGGAGATCCAACAGAATATAGCTTTGTTCGGGTACTCCGGCCACAAACTATCGACCGGGCGGAACACGTGTGGGGTAAAACGACAA +>B-mutant-1 +TATAGTTGCTTCCTCGGAGATCCAACAGAATATAGCTTTGTTCGGGTACTCCGGCCACAAACTATCGACCGGGCGGAACACTTGTGAGGTAAAACGCCAA +>B-mutant-2 +TTTAGTTGCTTCATCGGGGATCCAACAGAATCTAGCTTTGTTCGCGTAGTCCGGCCACAAACTATCGACCGGGCGGAACACTTGTGAGGTAAAACGCCAA +>B-mutant-3 +TTCAGTTGCTTCATCGGGGATCCAACAGAATCTAGATTTGTTCGCGTAGTCCGGCCACAAACTATCGAACGCGCGGAACACTTGTGAGATAAAACGCCAA +>B-mutant-4 +TTCAGTTGCTTCATCGGGGATCCAACAGAATCTAGATTTGTGCGCGTAGTCCGGCCACAAACTATCGAACGCGCGGAACACTTGTGAGACAAAACGCCAA +>B-mutant-5 +TTCAGTTGCTTCATCGAGCATCCAACAGAATCTAGATTTGTGCGCGTAGTGCGGCCTCAAACTATCGAACGCGCGGAACACTTGTGAGACAAAACGCCTA +>B-mutant-6 +TTCAGTTGCCTCATCGAGCATCCAACAGAATCTAGATTTGGGCGCGTAGTGCGGCCTCTAACTATCGAACGCGCGGAACACTTGTGAGACAAAACGCCTA +>B-mutant-7 +TTCAGTTGCCTCATCGAGCATCCAACAGAATCTAGATTTGGGCGCGTAGTGCGGCCTCTAACTAGCGAACGCGCGGAACACTTGTGAGACAAAACGCCTA +>B-mutant-8 +TTCAGTTGCCGCATCGAGCATCCAACAGAATCTAGATTTGGGCGCGTATTGAGGCCTCTAACTAGCGAACGCGCGGAACACTTGTGAGACAAAACGCCTA +>B-mutant-9 +TTCAGTTGCCGCATCGAGCATTCAAGAGAATCTAGATTTGGGCGCGTATTGAGGCCTCTAAGTAGCGAACGCGCGGAACACTTGTGTGACAAAACGCCTA +>recombinant +CTTATTTGCTTCCTCGCAGATCCAACCTCACATAGCTGTGTTCGGGTAGTCCGCACACTAACTCTCGGCCTGCCGGAACACTTGTGAGGTAAAACGCCAA diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1-phyml.ascii new file mode 100644 index 0000000..5fd1c86 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-8 + | +--|--A-mutant-9 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-recombinant + \-| + | /-A + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1-phyml.newick new file mode 100644 index 0000000..de22555 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000000,A-mutant-9:0.07414684,(A-mutant-7:0.00000000,(A-mutant-6:0.00000001,(A-mutant-5:0.00950739,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,(recombinant:0.02084516,(A:0.00000000,(B:0.00000000,(B-mutant-1:0.00000000,(B-mutant-2:0.00000001,(B-mutant-3:0.00000000,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000000,(B-mutant-7:0.00000001,(B-mutant-8:0.00000001,B-mutant-9:0.04084275)0.998442:0.02004995)1.000000:0.05119456)0.999999:0.04088274)0.999998:0.04121031)1.000000:0.05225513)1.000000:0.06357842)1.000000:0.07561827)1.000000:0.07497490)1.000000:0.11257217)0.998432:0.03152721)0.000000:0.00000001)0.962088:0.01034797)1.000000:0.05320657)0.999913:0.03112794)0.999994:0.04301959)0.999999:0.05380519)1.000000:0.06401330)1.000000:0.06397262); diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1-raxml.ascii new file mode 100644 index 0000000..2f3efc6 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-4 + | + | /-A-mutant-4 + | | + | /-| /-A-mutant-5 + | | | | + | | \-| /-A-mutant-7 + | | | /-| + | | | | | /-A-mutant-9 + | /-| \-| \-| + | | | | \-A-mutant-8 + | | | | + | /-| | \-A-mutant-6 + /-| | | | + | | | | \-A-mutant-3 + | | /-| | + | | | | \-A-mutant-2 + | | /-| | + | | | | \-A-mutant-1 + | | /-| | + | | | | \-recombinant + | | /-| | + /-| | | | \-A + | | | /-| | + | | | | | \-B + | | | /-| | + | | | | | \-B-mutant-1 + | | \-| | + /-| | | \-B-mutant-2 + | | | | + | | | \-B-mutant-3 + | | | + | | \-B-mutant-5 +--| | + | \-B-mutant-6 + | + |--B-mutant-7 + | + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1-raxml.newick new file mode 100644 index 0000000..bdfdcef --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1-raxml.newick @@ -0,0 +1 @@ +((((B-mutant-4:0.000001,((((((((((A-mutant-4:0.000001,(A-mutant-5:0.009393,((A-mutant-7:0.000001,(A-mutant-9:0.074124,A-mutant-8:0.000001):0.064010):0.064062,A-mutant-6:0.000001):0.053935):0.043148):0.031083,A-mutant-3:0.000001):0.053103,A-mutant-2:0.000001):0.010335,A-mutant-1:0.000001):0.000001,recombinant:0.020828):0.031481,A:0.000001):0.112521,B:0.000001):0.074940,B-mutant-1:0.000001):0.075589,B-mutant-2:0.000001):0.063579,B-mutant-3:0.000001):0.052180):0.041080,B-mutant-5:0.000001):0.040786,B-mutant-6:0.000001):0.051050,B-mutant-7:0.000001,(B-mutant-9:0.040801,B-mutant-8:0.000001):0.020019):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1.fasta new file mode 100644 index 0000000..ecec652 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out2/recombinant-90A1-B1.fasta @@ -0,0 +1,42 @@ +>A +ATAACTAGTAGAAATGGTCAGTTAAAGAACCACTAGAGCAGCCACCCACAGTGCGCCATCGAAGGTGCTCACGAGGGCGACACGCCGCTCAACTTGAACC +>A-mutant-1 +ATAACTAGTAGAAATGGTCAGTTAAAGAACCACTAGAGCAGCCACCCAAAGTGCGCCATCGAAGGTGCTCACTATGGCGACACGCCGCTCAACTTGAACC +>A-mutant-2 +ATAACTAGTAGAAATGGTCAGTTAAGGAACCACTAGAGCAGCCACCCAAAGTGCGCCATCGAAGGTGCTCACTATGGCGACACGCCGCTCAACTTGAACC +>A-mutant-3 +ATAACTAGTAGAGATGGTCAGTTAAGGAACCACTAGCGAAGCCAGCCAAAGTGCGCCATCGAAGGTGCTCACTCTGGCGACACGCCGCTCAACTTGAACC +>A-mutant-4 +ATAACTCGTAGAGATGGGCAGTTAAGGAACCACGAGCGAAGCCAGCCAAAGTGCGCCATCGAAGGTGCTCACTCTGGCGACACGCCGCTCAACTTGAACC +>A-mutant-5 +ATAACTCGTAGAGACGGGTAGTTAAGGATCCACGAGCGAAGCCAGCCAAAGTGCGCCATCGAAGGTGCTTACTCTGGCGACACGCCGCTTAACTTGAACC +>A-mutant-6 +ATAACTCCTAGCGACGGGCAGCTAAGGATCCACGTGCGAAGCCAGCCAAGGTGCGCCATCGAAGGTGCTTACTCTGGCGACACGCCGCTTAACTTGAACC +>A-mutant-7 +ATAACTCCTAGCCACGGGCAGCTAAGGATCCCCGCGCGAAGCCAGCCAAGGTTCGCCATCGAAAGTGCTTACTCTGGCGACACGCCGATTAACTTGAACC +>A-mutant-8 +ATAACTCCTAGCCACGGGCAAATAAGGATCCCCGCGCGAAGTCAGCCAAGTTTCGCCTTCGAAAGTGCTTACTCTGGCGACACGCCGATTAACTTGTACC +>A-mutant-9 +ATAACTCCTAGCCACGGGCAAATAGTGATCCCCGCGCGAAGTCAGGCAAGTATCGCCTTCGAAAGTGCTTACTCTGGCGACACGCCGATTAACGGGTACA +>B +ATAACTAGTAGAACTGGAATGTTAAAGAACCACTAGAGCTGCCACCCACAGTGCGCCATGGAAGGTGCTCAGGAGGGCGACACGCCGTTAAACTGGAACC +>B-mutant-1 +ATAGCTAGAAGAACGGGAATGTTAAAGAACCACTCGAGCTGCCACCCACAGTGCGCCATGGAAGTTGCTCAGGAGGGCGACACGGCGTTAAACTGGGACC +>B-mutant-2 +TTAGCTAGAAGAACGGGAATGTTAAAGAACGACCCGAGCTGCCACCCACAGTGCGCCATTGAACTTGCTCAGGAGGACGACACGGCGTTAAACCGGGACC +>B-mutant-3 +TTAGCTAGAAGAACGGGAATGTGATAGAACGACCTGAGCTGCCACCCACAGTGCGCCAGTGAACTTGCTCAAGAGGACGACACGGCGTTAAACCTGGACC +>B-mutant-4 +TTAGCTAGAAGGACCGGAGTGTGATAGAACGACCTGAGCTGCCACCCACATTGCGCCAGTGAACTTGCTCAAGAGGACGACACTGCGTTAAACCTGGACC +>B-mutant-5 +TTAGCTAGAAGGACCAGAGTGTGATAGAACGTCCTGAGCTGCCACCCACATTGCGCCAGTGAACTTTCTCAAGAGGACGACACTGCGTTAAACCTGGCCC +>B-mutant-6 +TTAGCTAGAAGGACCATAGTGTGATAGAGCGTCCTGAGCTGCCACCCATATTGCGCCAGTGAACTTTCTCAAGAAGACGACACTGCGTTAAACCTGGCCC +>B-mutant-7 +TTAGCTAGAAGGACCATAGTGTGATAAAGCGTCAGGAGCTTCCACCCATATTGCGCCAGTGAACTTTCTCAAGAAGACGAGACTGCGTTAAACCTGGCCC +>B-mutant-8 +TTATCTAGAAGGACCATAGTGTGATAAACCGTCAGGAGCTTCCACCCATATTGCGCCAGTGAACTTTCTCAAGAAGACGAGACTGCGTTAAACCTGGCCC +>B-mutant-9 +TTATCTATAAGGACCATAGTGTGATAAACCCTCAGTAGCTTCCACCCATATTGCGCCAGTGAACTTTCTCAAGAAGACGAGACCGCGTTAAACCTGGCCC +>recombinant +ATAACTAGTAGAAATGGTCAGTTAAAGAACCACTAGAGCAGCCACCCAAAGTGCGCCATCGAAGGTGCTCACTATGGCGACACGCCGCTCAACTGGGACC diff --git a/recombinationgradients/recombinationgradient_A1B1/out2/recombinants_A1B1.png b/recombinationgradients/recombinationgradient_A1B1/out2/recombinants_A1B1.png new file mode 100644 index 0000000..5519301 Binary files /dev/null and b/recombinationgradients/recombinationgradient_A1B1/out2/recombinants_A1B1.png differ diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/outtest b/recombinationgradients/recombinationgradient_A1B1/out3/outtest new file mode 100644 index 0000000..f4a2e52 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/outtest @@ -0,0 +1,405 @@ +Analysing sample: recombinant-10A1-B1-raxml.newick + + /-B + | + | /-B-mutant-2 + | | + | | /-B-mutant-4 + | | | + | | | /-B-mutant-8 + | /-| | /-| + /-| | | /-| /-| \-B-mutant-9 + | | | | | | | | + | | | | | | /-| \-B-mutant-7 + | | | | | | | | + | | /-| \-| \-| \-B-mutant-6 + | | | | | | + | | | | | \-B-mutant-5 + | | | | | +--| \-| | \-B-mutant-3 + | | | + | | \-B-mutant-1 + | | + | \-recombinant + | + | /-A + | | + \-| /-A-mutant-1 + | | + \-| /-A-mutant-2 + | | + \-| /-A-mutant-3 + | | + \-| /-A-mutant-4 + | | + \-| /-A-mutant-5 + | | + \-| /-A-mutant-6 + | | + \-| /-A-mutant-8 + | /-| + \-| \-A-mutant-9 + | + \-A-mutant-7 +Distance of A1 to recombinant is 0.302884 +Distance of B1 to recombinant is 0.020171 +Analysing sample: recombinant-20A1-B1-raxml.newick + + /-B + | + | /-B-mutant-2 + | /-| + | | | /-B-mutant-3 + /-| | \-| + | | | | /-B-mutant-4 + | | | \-| + | | | | /-B-mutant-5 + | | | \-| + | \-| | /-B-mutant-6 + | | \-| + /-| | | /-B-mutant-7 + | | | \-| + | | | | /-B-mutant-9 + | | | \-| + | | | \-B-mutant-8 + | | | + | | \-B-mutant-1 + | | + | \-recombinant + | + | /-A-mutant-3 +--| | + | | /-A-mutant-6 + | | | + | /-| /-| /-A-mutant-8 + | | | | | /-| + | | | | \-| \-A-mutant-9 + | | | /-| | + | | | | | \-A-mutant-7 + | /-| \-| | + | | | | \-A-mutant-5 + | | | | + | | | \-A-mutant-4 + \-| | + | \-A-mutant-2 + | + | /-A + \-| + \-A-mutant-1 +Distance of A1 to recombinant is 0.177544 +Distance of B1 to recombinant is 0.040502 +Analysing sample: recombinant-30A1-B1-raxml.newick + + /-recombinant + | + | /-B-mutant-5 + | | + | | /-B-mutant-8 + | /-| /-| + | | | /-| \-B-mutant-9 + | | | | | + /-| /-| \-| \-B-mutant-7 + | | | | | + | | | | \-B-mutant-6 + | | /-| | + | | | | \-B-mutant-4 + | | /-| | + | | | | \-B-mutant-3 + | | /-| | +--| | | | \-B-mutant-2 + | \-| | + | | \-B-mutant-1 + | | + | \-B + | + | /-A + | | + \-| /-A-mutant-1 + | | + \-| /-A-mutant-2 + | | + \-| /-A-mutant-3 + | | + \-| /-A-mutant-4 + | | + \-| /-A-mutant-5 + | | + | | /-A-mutant-9 + \-| /-| + | /-| \-A-mutant-8 + | | | + \-| \-A-mutant-7 + | + \-A-mutant-6 +Distance of A1 to recombinant is 0.201567 +Distance of B1 to recombinant is 0.129376 +Analysing sample: recombinant-40A1-B1-raxml.newick + + /-A + | + | /-A-mutant-2 + | | + | | /-A-mutant-5 + | | | + /-| | /-| /-A-mutant-6 + | | /-| | | | + | | | | | \-| /-A-mutant-9 + | | | | | | /-| + | | | | /-| \-| \-A-mutant-8 + | | | | | | | + | \-| | | | \-A-mutant-7 + | | \-| | + | | | \-A-mutant-4 +--| | | + | | \-A-mutant-3 + | | + | \-A-mutant-1 + | + | /-recombinant + | | + | | /-B + | | | + \-| | /-B-mutant-2 + | | | + | | | /-B-mutant-4 + | | | | + \-| /-| /-| /-B-mutant-5 + | | | | | | + | | | | | | /-B-mutant-9 + | | | | \-| /-| + | | | | | /-| \-B-mutant-8 + | | \-| | | | + \-| | \-| \-B-mutant-7 + | | | + | | \-B-mutant-6 + | | + | \-B-mutant-3 + | + \-B-mutant-1 +Distance of A1 to recombinant is 0.188469 +Distance of B1 to recombinant is 0.106554 +Analysing sample: recombinant-50A1-B1-raxml.newick + + /-recombinant + | + | /-A-mutant-1 + | | + | | /-A-mutant-2 + | /-| | + /-| | | | /-A-mutant-4 + | | | | | | + | | | \-| /-| /-A-mutant-5 + | | | | | | | + | | | | | \-| /-A-mutant-6 + | | | | | | | + | \-| | | \-| /-A-mutant-8 + | | \-| | /-| +--| | | \-| \-A-mutant-9 + | | | | + | | | \-A-mutant-7 + | | | + | | \-A-mutant-3 + | | + | \-A + | + | /-B-mutant-1 + \-| + | /-B + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 +Distance of A1 to recombinant is 0.118068 +Distance of B1 to recombinant is 0.118828 +Analysing sample: recombinant-60A1-B1-raxml.newick + + /-A + | + | /-A-mutant-1 + | | + /-| | /-A-mutant-4 + | | | | + | | | | /-A-mutant-6 + | | | /-| | + | \-| | | /-| /-A-mutant-8 + | | | | | | /-| + | | | | | \-| \-A-mutant-9 + | | /-| \-| | + | | | | | \-A-mutant-7 +--| | | | | + | \-| | \-A-mutant-5 + | | | + | | \-A-mutant-3 + | | + | \-A-mutant-2 + | + | /-B + | | + \-| /-recombinant + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-4 + | | + \-| /-B-mutant-5 + | | + \-| /-B-mutant-6 + | | + \-| /-B-mutant-8 + | /-| + \-| \-B-mutant-9 + | + \-B-mutant-7 +Distance of A1 to recombinant is 0.275976 +Distance of B1 to recombinant is 0.094269 +Analysing sample: recombinant-70A1-B1-raxml.newick + + /-recombinant + | + | /-A-mutant-1 + | | + | /-| /-A-mutant-2 + | | | | + /-| | | | /-A-mutant-3 + | | | \-| | + | | | | | /-A-mutant-6 + | | | | | | + | | | \-| /-| /-A-mutant-9 + | | | | | | /-| + | \-| | | \-| \-A-mutant-8 + | | | /-| | + | | | | | \-A-mutant-7 + | | \-| | + | | | \-A-mutant-5 + | | | + | | \-A-mutant-4 + | | + | \-A +--| + | /-B-mutant-3 + | | + | | /-B-mutant-5 + | /-| /-| + | | | | | /-B-mutant-6 + | | | | \-| + | | | | | /-B-mutant-7 + | | \-| \-| + | /-| | | /-B-mutant-9 + | | | | \-| + | | | | \-B-mutant-8 + | | | | + | /-| | \-B-mutant-4 + | | | | + | | | \-B-mutant-2 + \-| | + | \-B-mutant-1 + | + \-B +Distance of A1 to recombinant is 0.083300 +Distance of B1 to recombinant is 0.237818 +Analysing sample: recombinant-80A1-B1-raxml.newick + + /-recombinant + | + | /-A + | | + /-| | /-A-mutant-3 + | | | | + | | | /-| /-A-mutant-4 + | | | | | | + | | | | \-| /-A-mutant-5 + | \-| | | | + | | | | | /-A-mutant-9 + | | | \-| /-| + | | /-| | /-| \-A-mutant-8 + | | | | | | | +--| | | | \-| \-A-mutant-7 + | | | | | + | \-| | \-A-mutant-6 + | | | + | | \-A-mutant-2 + | | + | \-A-mutant-1 + | + | /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + | | /-B-mutant-3 + \-| | + | | /-B-mutant-6 + | | /-| + \-| | | /-B-mutant-7 + | | \-| + | /-| | /-B-mutant-8 + | | | \-| + | | | \-B-mutant-9 + \-| | + | \-B-mutant-5 + | + \-B-mutant-4 +Distance of A1 to recombinant is 0.073512 +Distance of B1 to recombinant is 0.239193 +Analysing sample: recombinant-90A1-B1-raxml.newick + + /-A + | + | /-A-mutant-4 + | | + | /-| /-A-mutant-5 + | | | | + | | \-| /-A-mutant-6 + /-| | | | + | | | \-| /-A-mutant-9 + | | /-| | /-| + | | | | \-| \-A-mutant-8 + | | | | | + | | | | \-A-mutant-7 + | | | | + | \-| | /-A-mutant-3 +--| | \-| + | | \-A-mutant-2 + | | + | | /-recombinant + | \-| + | \-A-mutant-1 + | + | /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-4 + | | + \-| /-B-mutant-5 + | | + | | /-B-mutant-8 + \-| /-| + | /-| \-B-mutant-9 + | | | + \-| \-B-mutant-7 + | + \-B-mutant-6 +Distance of A1 to recombinant is 0.030461 +Distance of B1 to recombinant is 0.291567 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1-phyml.ascii new file mode 100644 index 0000000..d17db3d --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-9 + | +--|--A-mutant-8 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-B + \-| + | /-recombinant + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1-phyml.newick new file mode 100644 index 0000000..ba22aef --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.05275070,A-mutant-8:0.00000001,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000001,(A-mutant-1:0.00000001,(A:0.01153031,(B:0.00000000,(recombinant:0.01009677,(B-mutant-1:0.00000000,(B-mutant-2:0.00000001,(B-mutant-3:0.00000001,(B-mutant-4:0.00000001,(B-mutant-5:0.00000000,(B-mutant-6:0.00000001,(B-mutant-7:0.00000001,(B-mutant-9:0.08373758,B-mutant-8:0.01124197)0.999837:0.05122960)1.000000:0.05119032)1.000000:0.05144096)0.999999:0.04118060)0.999985:0.03070316)0.999940:0.04095367)1.000000:0.05171705)0.918089:0.01007093)0.989692:0.03065950)1.000000:0.22212962)0.987746:0.03964261)1.000000:0.08366862)0.999997:0.04079473)1.000000:0.08413416)1.000000:0.06237729)1.000000:0.07417757)1.000000:0.07478861)1.000000:0.06354057); diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1-raxml.ascii new file mode 100644 index 0000000..72423b1 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-5 + | + | /-A-mutant-3 + | | + | | /-A-mutant-1 + | | | + | | | /-B + | | | | + | | | | /-B-mutant-2 + | | | | | + /-| | | | | /-B-mutant-4 + | | /-| | | | | + | | | | /-| | | | /-B-mutant-8 + | | | | | | | /-| | /-| + | | | | | | /-| | | /-| /-| \-B-mutant-9 + | | | | | | | | | | | | | | + | | | | | | | | | | | | /-| \-B-mutant-7 + | | | | | | | | | | | | | | + | | | | | | | | /-| \-| \-| \-B-mutant-6 + | | | | | | | | | | | | + | | | | | | | | | | | \-B-mutant-5 + | \-| \-| \-| | | | | + /-| | | | \-| | \-B-mutant-3 + | | | | | | | + | | | | | | \-B-mutant-1 + | | | | | | + | | | | | \-recombinant + | | | | | + | | | | \-A + | | | | + | | | \-A-mutant-2 +--| | | + | | \-A-mutant-4 + | | + | \-A-mutant-6 + | + | /-A-mutant-8 + |--| + | \-A-mutant-9 + | + \-A-mutant-7 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1-raxml.newick new file mode 100644 index 0000000..33f5a61 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1-raxml.newick @@ -0,0 +1 @@ +(((A-mutant-5:0.000001,((A-mutant-3:0.000001,((A-mutant-1:0.000001,((B:0.000001,(((B-mutant-2:0.000001,((B-mutant-4:0.000001,((((B-mutant-8:0.011201,B-mutant-9:0.083828):0.051280,B-mutant-7:0.000001):0.051211,B-mutant-6:0.000001):0.051451,B-mutant-5:0.000001):0.041187):0.030710,B-mutant-3:0.000001):0.040962):0.051730,B-mutant-1:0.000001):0.010073,recombinant:0.010097):0.030668):0.222368,A:0.011479):0.039750):0.083691,A-mutant-2:0.000001):0.040798):0.084177,A-mutant-4:0.000001):0.062412):0.074210,A-mutant-6:0.000001):0.074825,(A-mutant-8:0.000001,A-mutant-9:0.052761):0.063555,A-mutant-7:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1.fasta new file mode 100644 index 0000000..7004304 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-10A1-B1.fasta @@ -0,0 +1,42 @@ +>A +GAGGGGCCACCCAAGGTTGCTGCGGGGAAGCCCAAGAGGCCCACCTAAATTCATCTACAAGAAATTGCAAGAATACTTATCTGCGCCTACATGCGAATTG +>A-mutant-1 +GGGGGGCCACCCAAGGTTACTGCGGGGAAGCCCAAGAGGCCCACTTAAATTCTTCTACAAGAAATTGCAAGAATACTTATCTGCGCCTACAAGCGAATTG +>A-mutant-2 +GGGGGGCCACCCTAGGTTACTGCGGGGAAGCCCAGTACGCCCAATTAAATTCTTCCACAAGAAATGGCAAGAATACTTAACTGCGCCTACAAGCGAATTG +>A-mutant-3 +GGGGGGCCACCCTAGGTTGCTGCGGGGAAGCCCAGTACGCCCAATTAAATTCTTCCACAAGAAATGCCAAGAATACTTAACTGCGCCTATAAGCGGATTG +>A-mutant-4 +GGGGGGCCACCCCAGGTTGCTGCGCGGAAGCCCAGGACGCCCTATTAAATTTTTCCACAAGAAATGCCAGGAATACTTAACTGCCCCTATGAGCGGATTG +>A-mutant-5 +GGGGGGCCACCCCAGGTTGCAGCGCGTAAGCCCAGGACGCCCTATTAATTTTTTCCACAAGAAATGCCAGGAATACTTAGCTGCCCCGATGAGCGGACTG +>A-mutant-6 +AGGGGGCCACCCCAGGAGGCAGCGCGTAAGCCCCGGACGCCCTATTAATTTTTTCCACAAGAAATGCCAGGAATACGTAGCTGCCAGGATGAGCGGACTG +>A-mutant-7 +AGGGGGCCACCCCAGGAGGCAGCGCGTAAGCACCGGACGCCCTGTTAATTATTTCCACAAGAAATACCAGGAATACGTAGTTGCCAGGATGAGCGCACCG +>A-mutant-8 +AGGGGGCCACCCCAGGAGGCAGCGCGTAAGCACCGGACGCGCTGTTAATTATTTCCACAAGAATTACCAGGAAGAGGTACTTGCCAGGAAGAGCGCACCG +>A-mutant-9 +AGGGGGCCACCCCAGGAGGCAGCGCGTAAGCACCGGACGCGCTGTTAATTATTTCCACTAGAATTACCAGGAAGAGGTACTTGCGAGGAAGAACGAAACG +>B +GGGGGCCCACAGAAGGTCGCTGCGGAGACGCCCAAGAGGATCACCTCAAATCCTCTCCATGAAATGGCAAGATTGCTTATCTGCGCTAACCTGCGAATTG +>B-mutant-1 +GGGGGCACACAGAAGGTCGCTGCGGAGACGCCCAACTGGATCACCTCAAATCCGCTCCATGAAATGGCAAGATTGCTTATCTGCGCTAACCTGCGAATTG +>B-mutant-2 +GGGGGCACACAGAAGGTCGCTGCGGAGAAGCGCAACTGGATCACCTCAAATCCGGTCCATGAAAAGGCACGATTGCTTATCTGCGCTAACCTGCGAATTG +>B-mutant-3 +GGGCGCACACAGTAGGTCGCTGCGGAGATGCGCAACTGGATCACCTCAAATCCGGTCCATGAAAAGGCACGATTGCTTATCTGCGCTAACCTGCGAAATG +>B-mutant-4 +GGGCGCACACAGTAGGTCGCTGCGGAGATGCGCAACGGGATCATCTCAAATCCGGTCCATGAAAAGGCACGATTGCTTATCCGCGCTAACCTGCGAAATG +>B-mutant-5 +GGGCGAACACAGTAGGTCGCTGCGGAGATGCGCACCGGGATCATCTCAAATCCGGTCCATGAAATGACACGATTGCTTATCCGCGCTAACCTGCGAAATG +>B-mutant-6 +GGGCGAACACAGTAGGTCGCTCCGGAGGTGCGCACCGGGATCATCTCAAATCCGGTCCATGTAATGATACGATTGCTTATCCGCGCTAATCTGCGAAATG +>B-mutant-7 +GGGCGCACACAGTAGGTCGCTCCGGAGGTGCGTACCGGGATCATCTCAAATCCGGGGCATTTAATGATACGATTGCTTATCCGCGCTAATCTGCGAAATG +>B-mutant-8 +GGGCGCACACAGTAGGTCGCTACGAAGGTGCGTACCGGGATCATCTCAACTCCGTGGCATTTAATGATACGATTGCTTATGCGCTCTAATCTGCGAAATG +>B-mutant-9 +GGGCGCACACAGTAGGTCGCTACGTAGGTGCGCACCGGGATCAGCTCAACTCCGTGGCATGTAAAGATACGATTGCTTATGCGCGCTAGTCTGCGATGTG +>recombinant +GGGGGGCCACAGAAGGTCGCTGCGGAGACGCCCAACTGGATCACCTCAAATCCGCTCCATGAAATGGCAAGATTGCTTATCTGCGCTAACCTGCGAATTG diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1-phyml.ascii new file mode 100644 index 0000000..d4e8f56 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-9 + | + |--B-mutant-8 +--| + | /-B-mutant-7 + | | + \-| /-B-mutant-6 + | | + \-| /-B-mutant-5 + | | + \-| /-B-mutant-4 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-1 + | | + \-| /-B + | | + | | /-recombinant + \-| | + | | /-A-mutant-2 + | | /-| + | | | | /-A-mutant-3 + \-| | \-| + | | | /-A-mutant-4 + | | \-| + | | | /-A-mutant-5 + | | \-| + | | | /-A-mutant-6 + \-| \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-9 + | \-| + | \-A-mutant-8 + | + | /-A-mutant-1 + \-| + \-A diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1-phyml.newick new file mode 100644 index 0000000..6dececf --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.04121345,B-mutant-8:0.00000001,(B-mutant-7:0.00000001,(B-mutant-6:0.00000000,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00000000,(B-mutant-2:0.00000000,(B-mutant-1:0.00000000,(B:0.00000000,(recombinant:0.00000000,((A-mutant-2:0.00000000,(A-mutant-3:0.00000000,(A-mutant-4:0.00000000,(A-mutant-5:0.00000001,(A-mutant-6:0.00000001,(A-mutant-7:0.00000001,(A-mutant-9:0.04108756,A-mutant-8:0.00000001)0.999027:0.03066840)1.000000:0.05180035)1.000000:0.07397511)0.999947:0.03072912)1.000000:0.06284832)1.000000:0.07348590)0.961631:0.02101057,(A-mutant-1:0.00000001,A:0.04084492)0.477707:0.00944128)1.000000:0.16792835)0.999155:0.03046258)0.943198:0.01002694)1.000000:0.06255627)0.999986:0.04090666)1.000000:0.10678492)1.000000:0.05178937)0.999999:0.05168259)0.999981:0.04128280)1.000000:0.05174702); diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1-raxml.ascii new file mode 100644 index 0000000..08af128 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B + | + | /-B-mutant-2 + | /-| + | | | /-B-mutant-3 + /-| | \-| + | | | | /-B-mutant-4 + | | | \-| + | | | | /-B-mutant-5 + | | | \-| + | \-| | /-B-mutant-6 + | | \-| + /-| | | /-B-mutant-7 + | | | \-| + | | | | /-B-mutant-9 + | | | \-| + | | | \-B-mutant-8 + | | | + | | \-B-mutant-1 + | | + | \-recombinant + | + | /-A-mutant-3 + | | + | | /-A-mutant-6 +--| | | + | /-| /-| /-A-mutant-8 + | | | | | /-| + | | | | \-| \-A-mutant-9 + | | | /-| | + | | | | | \-A-mutant-7 + |--| \-| | + | | | \-A-mutant-5 + | | | + | | \-A-mutant-4 + | | + | \-A-mutant-2 + | + | /-A + \-| + \-A-mutant-1 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1-raxml.newick new file mode 100644 index 0000000..8d7fbaa --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1-raxml.newick @@ -0,0 +1 @@ +(((B:0.000001,((B-mutant-2:0.000001,(B-mutant-3:0.000001,(B-mutant-4:0.000001,(B-mutant-5:0.000001,(B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-9:0.041223,B-mutant-8:0.000001):0.051764):0.041292):0.051692):0.051807):0.106850):0.040919):0.062585,B-mutant-1:0.000001):0.010029):0.030471,recombinant:0.000001):0.168106,((A-mutant-3:0.000001,(((A-mutant-6:0.000001,((A-mutant-8:0.000001,A-mutant-9:0.041094):0.030673,A-mutant-7:0.000001):0.051819):0.073995,A-mutant-5:0.000001):0.030732,A-mutant-4:0.000001):0.062874):0.073520,A-mutant-2:0.000001):0.021023,(A:0.040866,A-mutant-1:0.000001):0.009436):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1.fasta new file mode 100644 index 0000000..e3fcd91 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-20A1-B1.fasta @@ -0,0 +1,42 @@ +>A +CAGTACGACTTACATAGAGTTCTCTCTATAATTGGGCCTTGCTGGCTTGACGCTACTTCGTAGACAAGCCTTGACCGCAAACGGATGTTACTTTCCGGAG +>A-mutant-1 +CAGTATGACTTACATAGAGTCCTCTCTATAATTGGGCCTTGCTGGCTTGGCGCTACTTCGTAGACAAGCCTTGACCGCAAACGGATGTTACTTTCCAGAG +>A-mutant-2 +CAGTAAGACTGACATAGAGTCCCCTCTATAATTGGGCCTTGCTGGCTTGGCGCTACTTCGTAGACAAGCCTTGACCGCAAACGGATGTTACTTTCCAGAG +>A-mutant-3 +CAGTAAGACTGACAGAGAGTCCCCGCTATAATTGGGCCTTGCTGGCTTAGCGCTACTTCGTAGACAAGCCTTGACCGCAAACGAATGATAGTTTCCAGAT +>A-mutant-4 +CAATAAGACTGACAGAGAGTCCCCGCTATAATTGGGTGTTGCTGGCTTAGCGCTACTACGTAGACAAGCCTTGACAGCAAACGAATGATAGTTTCAAGAT +>A-mutant-5 +CAATAAGACTGACAGAGAGTCCCCGCTATAATTGGGTGTGGCTGGCCTAGCGCTACTACTTAGACAAGCCTTGACAGCAAACGAATGATAGTTTCAAGAT +>A-mutant-6 +CAATAAGAGTGACAGAGAGTCCCCGCTATAATTTGGTGCGGCTGGCCTGGCGCTACTACTGAGACAAGCCTTGACAGAAAACGAATGATATTTTCAAGAT +>A-mutant-7 +CAATAGGAGCGACAGAGAGTCCCCGCTATAATTTGGTGCGGCTGGCCTGCCGCTACTACTGAGACAAGCCTTGACTGAAAACGAATGAGATTTTCAAGAT +>A-mutant-8 +CAATAGGAGCGTCAGAGAGTCCCCGCTATAATTTGGGGCGGCTGGCCTGCCGCTACTACTGAGACAAGCCTTGACTGAAAACGAATGAAATTTTCAAGAT +>A-mutant-9 +CAATAGGAGGGTCAGAGAGTCCCCACTATAATTTGGGGCGGCTGGCCTGCCACTACTACTGAGAGAAGCCTTGACTGAAAACGAATGAAATTTTCAAGAT +>B +CAGTATGGCATACGTAGAGTCCCCTCTAGAAGTGGGCCTTGGTGACTAGCCGCTATTTCGTGGACAAGCCATGGCGGCATTCGGAAGTTACTTTCCGGAG +>B-mutant-1 +CGGTATGGCATACGTAGAGTCCCCTCTAGAAGTGGGCCTTGGTGACTAGCCGCTATTTCGTGGACAAGCCATGGCGGCATTCGGAAGTTACTTTCCGGAG +>B-mutant-2 +TGGTATGGCATACGTAGAGTCTCCTCTAGAAGTGGGCGTTGGCGACTAGCCGCTATTTCGTGGACACGCCATGGCGGCATTAGGAAGTTACTTTCCGGAG +>B-mutant-3 +TGGTATGGCATACGTAGAGTCTCCTCTAGAAGTCGGCGTTGGCGACTAGCCGCTATTTCGTGGACACACCATGCCGGCATTAGGAAGTTACTATCCGGAG +>B-mutant-4 +TGGAATGGCATACGTAGAGTCCGCTCTAGAAGACGGCGTTGGCGACTAGCCGCTATTTCGTGGAGTCAGCATGCTGGCATTGGGAAGTTACTATCCTGAG +>B-mutant-5 +TGGAAGGGCATACGTAGAGTCCGCTCTAGAAGACGGTGATGGCGACTAGCCGCTATTTACTGGAGTCAGCATGCTGGCATTGGGAAGTTACTATCCTGAG +>B-mutant-6 +TGGAAGGGCATACGTAGAGTCCGCTCTAGAAGACGGTGATAGAGACTAGCCGCCATTTACTGGAGTCAGCATGCTGGCATTGGCAAGTTGCTATCCTGAG +>B-mutant-7 +TGGACGGGCATACGTAGTGTCCGCTCTAGAAGACGGTGATAGAGACTAGCCGCAATTTACTGGAGTCAGCATGCTGGCATTGGCAAGTCGCTATCCTGAG +>B-mutant-8 +TGGACGGGCATACGTAGTGTCTGCTCTAGAAGACGGTGCTAGAGGCTAGCCGCAATTTACTGGAGTCAGCATGCTGGCAGTGGCAAGTCGCTATCCTAAG +>B-mutant-9 +TGCACGGGCATACGTAGAGTCTTATCTAGAAGACGGTGCTAGAGGCTAGCCGCAATTTACTGGAGTCAGCATGCTGGCAGTGGCAAGTCGCTATCCTAAG +>recombinant +CAGTATGACTTACATAGAGTCCCCTCTAGAAGTGGGCCTTGGTGACTAGCCGCTATTTCGTGGACAAGCCATGGCGGCATTCGGAAGTTACTTTCCGGAG diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1-phyml.ascii new file mode 100644 index 0000000..b8b77e5 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-8 + | +--|--A-mutant-9 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-recombinant + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1-phyml.newick new file mode 100644 index 0000000..ce52f95 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000000,A-mutant-9:0.04106791,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00000001,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,(A:0.00837866,(recombinant:0.00000000,(B:0.00961093,(B-mutant-1:0.00000001,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000001,(B-mutant-7:0.01020902,(B-mutant-9:0.04134751,B-mutant-8:0.00000000)0.995075:0.02057224)0.999999:0.04184432)0.998854:0.02040744)0.999961:0.03072875)1.000000:0.05214617)1.000000:0.06258937)1.000000:0.05187673)0.967940:0.02077242)1.000000:0.10856321)1.000000:0.15826828)0.998677:0.04315624)0.999837:0.03047659)0.999999:0.04077538)1.000000:0.04108432)1.000000:0.04113560)0.999994:0.03061503)0.997239:0.02031884)1.000000:0.06281288); diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1-raxml.ascii new file mode 100644 index 0000000..716e6f1 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-9 + /-| + /-| \-A-mutant-8 + | | + | \-A-mutant-7 + | + |--A-mutant-6 + | + | /-A-mutant-5 + | | +--| | /-A-mutant-3 + | | | + | | | /-recombinant + | | | | + | | | | /-B-mutant-5 + | | | | | + | | | | | /-B-mutant-8 + | | | | /-| /-| + | | | | | | /-| \-B-mutant-9 + \-| | | | | | | + | | /-| /-| \-| \-B-mutant-7 + | | | | | | | + | /-| | | | | \-B-mutant-6 + | | | | | /-| | + | | | | | | | \-B-mutant-4 + | | | | | /-| | + | | | | | | | \-B-mutant-3 + | | | /-| | /-| | + | | | | | | | | \-B-mutant-2 + | | | | | \-| | + | | | | | | \-B-mutant-1 + \-| | /-| | | + | | | | | \-B + | | | | | + | \-| | \-A + | | | + | | \-A-mutant-1 + | | + | \-A-mutant-2 + | + \-A-mutant-4 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1-raxml.newick new file mode 100644 index 0000000..69ce5d5 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1-raxml.newick @@ -0,0 +1 @@ +(((A-mutant-9:0.041064,A-mutant-8:0.000001):0.062815,A-mutant-7:0.000001):0.020319,A-mutant-6:0.000001,(A-mutant-5:0.000001,((A-mutant-3:0.000001,((((recombinant:0.000001,((((((B-mutant-5:0.000001,(((B-mutant-8:0.000001,B-mutant-9:0.041362):0.020577,B-mutant-7:0.010212):0.041867,B-mutant-6:0.000001):0.020411):0.030734,B-mutant-4:0.000001):0.052156,B-mutant-3:0.000001):0.062589,B-mutant-2:0.000001):0.051872,B-mutant-1:0.000001):0.020785,B:0.009591):0.108589):0.158352,A:0.008334):0.043213,A-mutant-1:0.000001):0.030468,A-mutant-2:0.000001):0.040764):0.041077,A-mutant-4:0.000001):0.041129):0.030614):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1.fasta new file mode 100644 index 0000000..a5ac58c --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-30A1-B1.fasta @@ -0,0 +1,42 @@ +>A +CTGCTCTTGATATCAGCTAGCATGAACTCCTAAGTCCGGTTAGTCGATTCACATTTTATGCATATGCTCACATGGAATGTATAAGTCTGTACGACATTTG +>A-mutant-1 +CTGCTCTTGATATCAGCTAGCATGAACTCGTAAGTCAGGTTAGTCGATGCACATTTTATGCAGATGCGCACATGGAATGTATAAGTCTGTACGACATTTG +>A-mutant-2 +CTGCTCTTGATATCAGCTAGCATGAACCCGTAAGTCAGGTTAGTCGATGCACATTTGATGCAGATGCGCACATGGAATGTATAAGGCTGTACGACATTTG +>A-mutant-3 +ATGCGCTTGATAGCAGCTAGCATGAACCCGTAAGTCAGGTTAGTCGATGCACATTTGATGCAGATGCGCACATGTAATGTATAAGGCTGTACGACATTTG +>A-mutant-4 +ATGCGCTTGATAGCAGCTAGCATGAACCCGTAAGTCAGGTTAGTCGATGCACATTTGATGCAGATGCGAACATGTAATGTATAAGGCTGAACAACAATTG +>A-mutant-5 +ATGGGCTTGATAGCAGCTAGCATGAACCCGTGAGTCAGGTTAGTCGATGCACATTTGATGCAGATGCGAACATGAAATGTCTAAGGCTGAACAACAATTG +>A-mutant-6 +ATGGGCTTGATTGCAGCTAGAATGAACCCGTGAGTCAGGTTAGTCGATGCACATTTGATGCAGATGAGAACATGAAATGTCTAAGGCTGAACAACAATTG +>A-mutant-7 +ATGGGCTTGATTGCAGCTATAATGAACCCGTGAGTCAGGTTAGTCGATGCACATTTGATGTAGATGAGAACATGAAATGTCTAAGGCTGAACAACAATTG +>A-mutant-8 +ATCGGCTTGATTGCAGCTATAATGAACCCGTGAGTCCGGTTACTCGATGCACATTTGATGTAGATGAGATCAAGAAATGTCTAAGGCTGAACAACAATCG +>A-mutant-9 +ATCGGCTTGATTGCAGCAATAATGAACCCGTGAGTCCGGTTACTCGATGCACATTTGATGTAGATGTGATCTAGAATTGTCTAAGGCTGAACAACAATCG +>B +TTCATCCAGGAATGAGCTAGCAGGAACTCTTAAGTCCCGTGAGGCGATTCACGGTTTATGCATATGCTTACATCGCATGTATGTGTCTGTATTACATTTT +>B-mutant-1 +TTCATCCAGGAATGAGCTAGTAGGAACGCTTAAGTCCCGTGAGGCGATTCACGGTTTATGCATATGCTTACATCGCATGTATGTGGCTGTATTACATTTT +>B-mutant-2 +TTCATCTAGGAATGAGCTAGTAGCAACGCTTAAGTCCCGTGAGGCGATTCACGGTTTATGCATATGCTTACATCGCATGCATGTGACTGTATTATATTTT +>B-mutant-3 +TTCATCTAGGTATGAGCTAGTAGCAACGCTTAAGTCCCCTGTGGCGATTCACGGTTTATGCAGATTCTTACATAGCATGCATGTGACTGTATTATATTTT +>B-mutant-4 +TTGATCTAGGTATAAGCTAGTAGCAACGCTTAAGTCCCCTGTGGCGATTCACGGTTTATGCAGATTATTACTTAGCATGCATGTGACTGTATTATGTTTT +>B-mutant-5 +TTGATCTAGGTATAAGCTAGTAGCAACGCTTAAGTCCGCTGTGGCGATTCACGGTTTATGCAGATTATTACTTAGCATGCATGTGACTGTATTATGGATT +>B-mutant-6 +TTGATCTAGGTATAAGCTAGTAGCAACGTTTAAGTCCGCTGTGGCGATTCACGGTTTATGTAGATTATTACTTAGCATGCATGTGACTGTATTATGGATT +>B-mutant-7 +TTGATCTAGGTATAAGCTAGTAGCTACGTTTAAGTCCACTGTGGCGATTCACGGTTTATGTAGATTGTTATTTAGCATGCATGTTACTGTATTATGGATT +>B-mutant-8 +TTGATCTAGGTATAAGCTAGTAGCTACGTTTATGTCCACCGTGGCGATTCACGGTTTATGTAGATTGTTACTTAGCATGCATGTTACTGTATTATGGATT +>B-mutant-9 +TTGATCTAGGTATAAGCTAGTAGCTGCGTTTGTGTCCACCGTGGCGATTCACGGTTTATGTAGATGGTTACTTAGCGTGCATGTTACTGTATTATGGATT +>recombinant +CTGCTCTTGATATCAGCTAGCATGAACTCGTAAGTCCCGTGAGGCGATTCACGGTTTATGCATATGCTTACATCGCATGTATGTGGCTGTATTACATTTT diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1-phyml.ascii new file mode 100644 index 0000000..1d19981 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-9 + | +--|--A-mutant-8 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-recombinant + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1-phyml.newick new file mode 100644 index 0000000..036c8be --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.03010712,A-mutant-8:0.00000001,(A-mutant-7:0.00953704,(A-mutant-6:0.00000000,(A-mutant-5:0.01012202,(A-mutant-4:0.00000001,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,(A:0.03101271,(recombinant:0.00000001,(B:0.05369749,(B-mutant-1:0.00000000,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00000001,(B-mutant-5:0.00000001,(B-mutant-6:0.00000000,(B-mutant-7:0.00000001,(B-mutant-9:0.04144734,B-mutant-8:0.00000001)1.000000:0.06270150)0.999066:0.02039973)0.999978:0.04134965)1.000000:0.06246759)0.995695:0.03029027)0.999987:0.03027521)1.000000:0.05133028)0.501264:0.00842464)0.987647:0.09817704)1.000000:0.14645521)0.997191:0.04212937)0.999999:0.04119999)0.997685:0.02008317)1.000000:0.08391628)1.000000:0.07345649)1.000000:0.07430007)0.999999:0.05249556)1.000000:0.07407218); diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1-raxml.ascii new file mode 100644 index 0000000..92732e6 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A + | + | /-A-mutant-2 + | | + | | /-A-mutant-5 + | | | + /-| | /-| /-A-mutant-6 + | | /-| | | | + | | | | | \-| /-A-mutant-9 + | | | | | | /-| + | | | | /-| \-| \-A-mutant-8 + | | | | | | | + | \-| | | | \-A-mutant-7 + /-| | \-| | + | | | | \-A-mutant-4 + | | | | + | | | \-A-mutant-3 + | | | + | | \-A-mutant-1 + | | + | \-recombinant + | + |--B +--| + | /-B-mutant-2 + | | + | | /-B-mutant-4 + | | | + | /-| /-| /-B-mutant-5 + | | | | | | + | | | | | | /-B-mutant-9 + | | | | \-| /-| + | | | | | /-| \-B-mutant-8 + | | \-| | | | + \-| | \-| \-B-mutant-7 + | | | + | | \-B-mutant-6 + | | + | \-B-mutant-3 + | + \-B-mutant-1 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1-raxml.newick new file mode 100644 index 0000000..7381617 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1-raxml.newick @@ -0,0 +1 @@ +(((A:0.031013,((A-mutant-2:0.000001,(((A-mutant-5:0.010115,(A-mutant-6:0.000001,((A-mutant-9:0.030108,A-mutant-8:0.000001):0.074048,A-mutant-7:0.009533):0.052485):0.074273):0.073438,A-mutant-4:0.000001):0.083889,A-mutant-3:0.000001):0.020083):0.041194,A-mutant-1:0.000001):0.042115):0.146352,recombinant:0.000001):0.098097,B:0.053654,((B-mutant-2:0.000001,((B-mutant-4:0.000001,(B-mutant-5:0.000001,(((B-mutant-9:0.041431,B-mutant-8:0.000001):0.062671,B-mutant-7:0.000001):0.020394,B-mutant-6:0.000001):0.041336):0.062439):0.030284,B-mutant-3:0.000001):0.030272):0.051320,B-mutant-1:0.000001):0.008455):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1.fasta new file mode 100644 index 0000000..eac7303 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-40A1-B1.fasta @@ -0,0 +1,42 @@ +>A +CTGATGTGAAGACGAAGCCGTCATGCCACACGGTATCGACATCCATATAAAAGAGGAAGGCTGGCTGCGCTGGCAAACTCTTCCCCGGACGTTGATGGAG +>A-mutant-1 +CTTATGTGAAGACGAAGCCTTCATGCCACACGGAATCGACATCCAGATAAAAAAGGAAGGTTGGCTGCGCTGGCAAACTCTTCCCCGGACGTTGATGCAG +>A-mutant-2 +CTTATGTGAAGACGAAGCCTTCATGCCACACGGAATCGACATCCAGATAAACAAGGAATGTTGGCTGCGCTGCCAAACTCTTCCCCGAACGTTGATGCAG +>A-mutant-3 +CTTATGTGAAGACGAAGCCTTCATGCCACACGGAATCGACATCCAGATAAACAAGGAATGTTGGTTGCGCTGCCTAACTCTTCCCCGAACGTTGATGCAG +>A-mutant-4 +CTTATGCGAAGACGAATCCTTCGTGCCACACGGAATCGACATCCAGATCAACAAGGATTGTGGGTTGCGCTGCGTGACTCTTCCCCGAACGTTGATGCAG +>A-mutant-5 +CTTATGCGAAGACGAACCCTTCGTGCCACACGGAATCGATTTCCAGATCAACACGGATTGCGGGTTGTGCTGCGAGACTCTTCCCCGAACGTTGAAGCAG +>A-mutant-6 +CTTACGAGAAGACGAACCCTTCGTACCACACGGAATCGATTTCCAGTTCAACACGGATTGTGGGTTGAGCTGCGAGACTCTTCCCCGAACGGTGCAGCAG +>A-mutant-7 +CTTGCGAGGAGACGAACCCTTCGTACCACACGGAATCGATTTCCAGTTCAACACGGATGGTGTGTTGAGCTGCGAGACTCTTCCCTGAACGGTGCAGAAG +>A-mutant-8 +CTTACGAGGAGATGAACCCTTCGTACGCCACGGAATCAATTTCCAGTTCCACACGAATGGTGTGTTGAGCTGCGAGACTCTTCCCTGAACGGTGCAGAAT +>A-mutant-9 +CTTACGAGGAGATGAACCCTTCCTACGCGACGGAATCAATTTCCAGTTCCACACGAATGGTGTGATGAGCTGCGAGACTCTTCCCTGAACGGTGCAGAAT +>B +CTGATCTGAAGACGAAGCCGTCATGTCATTCGGCAGCCACATCCATATAAAAGAGGACCGCTCGCTGCGCTGGCAAACCCTTGCCCCGACGTTGGCGGAG +>B-mutant-1 +CTGATCTGAAGACGATGCCGTCATGTCATTCGGCAGCCACCTCTATATAAAAGAGGACCGCTCGCTGCGCTGGGAAACCCTTGCCCCGAGGTTGGCGGTG +>B-mutant-2 +CTGATCTGAAGACGATGACGTCATGTCATGCGGCAGCTACCTCTATATAAAAGAGGACCGTTCGCTGCGCTGGGAAACCCTTGCCCCGAGGTTTGCGGTG +>B-mutant-3 +CTGATCTGAAGACGATGACGTCATGTCATGCGGCGGCTACCTCTATATAAAAGGGGACCGTTCCCTGCGCTGGGAAACCCTTGCCCCGAGGTTTGCGGTG +>B-mutant-4 +CTGATCTGAAGACGATGACGGCACGTCATGCGGCGGCTACCTCTATATAAAAGGGGACCGTTCCCTGCGGTGGGAAACCCTTGCCCCGAGGTTTGCGGTG +>B-mutant-5 +CTGTTCTGAAGACGATGACGACACGTCATGCGGCGGCTACCTCTATATAAAAGGGGACCGTTCCCCGGGGGGGGAAACCCTAGCCCCGAGGTTTGCGGTG +>B-mutant-6 +CTGGTCTGAAGACGATGACGACACGTCATGCGGCGGCTACCTGTATATAAAAGCGGACCGTTCCCCGGGGGGGGAGACCCTAGCCCCGAGGTTTGCGGTG +>B-mutant-7 +CTGGTCTGTAGACGATGACGACACGTCATGCGGCGGCTACCTGTATATAAAAGCGGAACGTTCCCCGGGGGGGGAGACCCTAGCCCCGAGGTTTGCGGTG +>B-mutant-8 +CCGGCCTGTAGACGATGACGACACGTCATGCCGCGGCTACCTGTAAATAAATGCGGAACGTTCCCCGGGGGGGGACACCCTAGCCCCGAGGTTTGCGGTG +>B-mutant-9 +CCGGGCTGTAGACGATGACGACACGTAATGCCGCGGCTACCTGTAAATAAATGCGGAACGTTCGCCCGGGGGGGACACCCTAGCCCCGAGGTTTGCGGTG +>recombinant +CTTATGTGAAGACGAAGCCTTCATGCCACACGGAATCGACCTCTATATAAAAGAGGACCGCTCGCTGCGCTGGGAAACCCTTGCCCCGAGGTTGGCGGTG diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1-phyml.ascii new file mode 100644 index 0000000..1e854fc --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-9 + | +--|--B-mutant-8 + | + | /-B-mutant-7 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-2 + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-recombinant + \-| + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1-phyml.newick new file mode 100644 index 0000000..87a33b0 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.03059867,B-mutant-8:0.00000000,(B-mutant-7:0.00000000,(B-mutant-6:0.00000001,(B-mutant-5:0.00000001,(B-mutant-4:0.01077081,(B-mutant-3:0.00000000,(B-mutant-2:0.00000001,(B:0.03871894,(B-mutant-1:0.00000001,(recombinant:0.00000001,(A:0.04288205,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00932837,(A-mutant-4:0.00000000,(A-mutant-5:0.00000001,(A-mutant-6:0.00000001,(A-mutant-7:0.00000001,(A-mutant-9:0.08781134,A-mutant-8:0.00000001)1.000000:0.08820798)0.993638:0.02086201)1.000000:0.05338092)0.999996:0.04183203)1.000000:0.07610581)0.998587:0.03180510)0.999998:0.04120115)0.854815:0.01954162)1.000000:0.09871576)1.000000:0.11893723)0.659979:0.01273399)1.000000:0.07293916)1.000000:0.08418873)1.000000:0.07400958)0.999997:0.06247415)1.000000:0.13106284)0.999962:0.04094075)0.966724:0.01002025); diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1-raxml.ascii new file mode 100644 index 0000000..5f62d10 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-7 + | + /-| /-B-mutant-6 + | | | + | \-| /-B-mutant-5 + | | | + | \-| /-B-mutant-4 + | | | + | \-| /-B-mutant-3 + | | | + | | | /-B-mutant-2 + | \-| | + | | | /-B + | | | | + | | | | /-recombinant + | \-| | | + | | | | /-A-mutant-1 + | | | | | + | | | | | /-A-mutant-2 + | | | | /-| | + | \-| /-| | | | /-A-mutant-4 +--| | | | | | | | + | | | | | \-| /-| /-A-mutant-5 + | | | | | | | | | + | | | | | | | \-| /-A-mutant-6 + | | | | | | | | | + | | | \-| | | \-| /-A-mutant-8 + | | | | \-| | /-| + | \-| | | \-| \-A-mutant-9 + | | | | | + | | | | \-A-mutant-7 + | | | | + | | | \-A-mutant-3 + | | | + | | \-A + | | + | \-B-mutant-1 + | + |--B-mutant-9 + | + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1-raxml.newick new file mode 100644 index 0000000..d8dd7c7 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1-raxml.newick @@ -0,0 +1 @@ +((B-mutant-7:0.000001,(B-mutant-6:0.000001,(B-mutant-5:0.000001,(B-mutant-4:0.010788,(B-mutant-3:0.000001,(B-mutant-2:0.000001,(B:0.038629,((recombinant:0.000001,((A-mutant-1:0.000001,(A-mutant-2:0.000001,((A-mutant-4:0.000001,(A-mutant-5:0.000001,(A-mutant-6:0.000001,((A-mutant-8:0.000001,A-mutant-9:0.087425):0.087817,A-mutant-7:0.000001):0.020707):0.053127):0.041567):0.075276,A-mutant-3:0.009470):0.031351):0.040990):0.019542,A:0.042611):0.098524):0.118826,B-mutant-1:0.000001):0.012664):0.072990):0.084105):0.073861):0.062269):0.131621):0.040916):0.010001,B-mutant-9:0.030553,B-mutant-8:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1.fasta new file mode 100644 index 0000000..e094901 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-50A1-B1.fasta @@ -0,0 +1,42 @@ +>A +ATCACCTATGAACAACTTCTCTTAGTTGTCCGTGGACTGGCAGGATAAATCGGTCGGGCCCGTTCAGGACCGTAACCTACAACCGAACTTAATGACAGGG +>A-mutant-1 +TTCACCTATGAACAACTTCTCTTGGTTGTCCGTGGACTGGCAGGATAAATCGGTCGGGCCCCTTCAGGTCCATAACCTAAAACCGAACTTAATGACAGGG +>A-mutant-2 +TTCACCTATGAACAACTTGTCTTGGTTGTCCGTGGACTGGCAGGATAAATCGGTCGGGCCCCTTCAGGTGCATATCCTAAAATCGAACTTAATGACAGGG +>A-mutant-3 +TTCACCTATGAACGACTTGTCTTGGTTGTCCGTGGACTGGCAGGATAAATCGGTCGGGCCCCTTCAGGTGCATATCCTAAAATCGCTCCTAATGACAGGG +>A-mutant-4 +TTCACCTATGAACGACTTGTCTTGGGTGTCCGTGGAATGGCAGGATAAATCCGTCGGGCCCTATCAGGTGCATATCCTAAAACCGATCCTAATGACGGGG +>A-mutant-5 +TTCACCTAGGAACGACCTGTCTTGGGTGTCCGTGGAATGGCAGGATAAATCCGTCGGGCCCTATCAGGTGCATATCCTAAAACCGATCCTAACGAGGGGG +>A-mutant-6 +TTCACCGAGGAACGACCTGTGTTGGGTGTCCGTGGAATGGCAGGATAAATGCGTCGGGCCCTATCAGGTGCATACCCTAAAACCGATCCAAACGAGGGGG +>A-mutant-7 +TTCACCGAGGAACGACCTGTGTTGGGTGTCCGTGGAATGGCAGGATAAATGCGTCGGGCCCTATCAGGTGCATACCCTATACCCGATCCAAACGAGGGGG +>A-mutant-8 +GTCACCGAGGAAGGACTTGTCTTGGGTGTCCGCTGAATGGCAGGATAAATGCGTCGGGCCCTATCAGGTGCATACCCTATACCAGATCCAAATGAGGGGG +>A-mutant-9 +GTAACCGAGGAAGGCCTTGCCTTGGGTGTCCGCTGAATGGCAGGATACATGCGTCGGGCCCTTTCAGGTACATAACCTATACAAGATCCAAATGAGGGGG +>B +CTAACCAATTAACAACTTCCCATAGTTCACCGTGGCCTGACAGGATAAATCGGTCAGGCCCGTTCAGGACCATACCCTACCACCGAACTTAATGTAAGGA +>B-mutant-1 +CTAACCAATTAACAACTTCCCATAGTTCACCGTGGCCTGACAGGATAAATCGGTCAGGCCCGTTCACGTCCATACCGTTCCACCGAACTTAATGTTAGGA +>B-mutant-2 +ATAACCAATCAACAACTTCCGATAGTTCACCGTGGCCTGACAGGATAAATCGATCCGGCCCGTTCACGGCCAAACCCTTCCACCGAACTTAATGTTAGGA +>B-mutant-3 +ATAACCAATCAACAACTTCCGATAATTCACCGTGTGCTGACAGGATAAATCGATCCGGCCCGTTCACGGCCAAAACCTTCGACTGAACCTAATGTTCGGA +>B-mutant-4 +ATGACCAATCAACTACTTCCGATAATTCAACGTGTGCTGACAGTATAAATCGATCCTGCCCGTTCACGGCCATAACCTTCGACTGAATCTAACGTTCGGA +>B-mutant-5 +ATGACCCATCAACTACTTCCGAGAATTCAACGTGTGCTGACTATCTAAATCGATCCTGCCCGTTCACGGCCAAAACCTTCGACTGAATCTAAAGTTCGGA +>B-mutant-6 +ATGACCCATGAACTACTTCAGGGAATTCACCGAGTGCTGGTTATCTAAATCGATCCTGCCCGTTCACGGCCAAAACCCTCTAATGAATCTAAGGTCCGGA +>B-mutant-7 +ATGACCCATGAACTACTTCAGGGAATTCACCGAGGGCTGGTTATCTAAATTGACCCTGCCCGTTCACGGCCAAAACCCTCTAATGAATCAAAGGTCCGGA +>B-mutant-8 +ATGACCCATGAACTAGTTCAGGGAATTCACCGAGGGCTGGTTATCTAAATTGACCCTGCCCGTTCACGGCCAAAACCCTCTAATGAATCAAAGGTCCGGA +>B-mutant-9 +ATGACTCATGAACTAGTTCAGGGAATTCACCGAGGGCTGGTTATCTAAATTGACCCCGCCCGTTCACGGCCAAAACACTCTAATGAATCAAAGGTCCGGA +>recombinant +TTCACCTATGAACAACTTCTCTTGGTTGTCCGTGGACTGGCAGGATAAATCGGTCAGGCCCGTTCACGTCCATACCGTTCCACCGAACTTAATGTTAGGA diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1-phyml.ascii new file mode 100644 index 0000000..2701955 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-7 + | + | /-A-mutant-9 +--|--| + | \-A-mutant-8 + | + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-B + \-| + | /-recombinant + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1-phyml.newick new file mode 100644 index 0000000..21ef6f5 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-7:0.00000001,(A-mutant-9:0.04135218,A-mutant-8:0.00000000)0.996575:0.02040233,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000001,(A-mutant-1:0.00000000,(A:0.00000001,(B:0.01041740,(recombinant:0.06167047,(B-mutant-1:0.00000001,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00000001,(B-mutant-5:0.00000000,(B-mutant-6:0.00000000,(B-mutant-7:0.00000000,(B-mutant-9:0.05197281,B-mutant-8:0.00000001)1.000000:0.05209419)0.998868:0.02041901)0.999994:0.04140077)1.000000:0.09618165)0.999856:0.04105474)0.999985:0.03057408)1.000000:0.05156569)0.991780:0.03265840)0.999607:0.06584959)1.000000:0.09652243)0.999998:0.05210091)1.000000:0.07352667)0.997661:0.03051898)1.000000:0.07348610)0.999898:0.03061353)1.000000:0.06263587)1.000000:0.09646224); diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1-raxml.ascii new file mode 100644 index 0000000..e063595 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-8 + /-| + | \-B-mutant-9 + | + | /-B-mutant-6 + | | + | | /-B-mutant-1 + | | | + | | | /-recombinant + | | | | + | | /-| | /-A + | | | | | | + | | | | | | /-A-mutant-1 + | | | | | | | + | | | | | /-| | /-A-mutant-4 + | | | \-| | | | | + | | | | | | | | /-A-mutant-6 + | | | | | | | /-| | + | | | | | \-| | | /-| /-A-mutant-8 + |--| | | | | | | | | /-| +--| | | | | | | | | \-| \-A-mutant-9 + | | /-| | | | /-| \-| | + | | | | \-| | | | | \-A-mutant-7 + | | | | | | | | | + | | | | | \-| | \-A-mutant-5 + | | | | | | | + | | | | | | \-A-mutant-3 + | | /-| | | | + | | | | | | \-A-mutant-2 + | | | | | | + | | | | | \-B + | | /-| | | + | | | | | \-B-mutant-2 + | | | | | + | \-| | \-B-mutant-3 + | | | + | | \-B-mutant-4 + | | + | \-B-mutant-5 + | + \-B-mutant-7 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1-raxml.newick new file mode 100644 index 0000000..6d4c922 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1-raxml.newick @@ -0,0 +1 @@ +((B-mutant-8:0.000001,B-mutant-9:0.051923):0.052047,(B-mutant-6:0.000001,(((((B-mutant-1:0.000001,(recombinant:0.061629,((A:0.000001,(A-mutant-1:0.000001,(((A-mutant-4:0.000001,((A-mutant-6:0.000001,((A-mutant-8:0.000001,A-mutant-9:0.041313):0.020382,A-mutant-7:0.000001):0.096347):0.062578,A-mutant-5:0.000001):0.030588):0.073427,A-mutant-3:0.000001):0.030502,A-mutant-2:0.000001):0.073473):0.052068):0.096460,B:0.010410):0.065818):0.032639):0.051528,B-mutant-2:0.000001):0.030552,B-mutant-3:0.000001):0.041026,B-mutant-4:0.000001):0.096085,B-mutant-5:0.000001):0.041358):0.020399,B-mutant-7:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1.fasta new file mode 100644 index 0000000..586b5a3 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-60A1-B1.fasta @@ -0,0 +1,42 @@ +>A +ACGACCAACGAACATCGCCGCGCACAATACCATTTCCGGTGTCCGATTGACTTGCGAATCTCGTCAAGCACGACCCGCCCACGTCGCTGATTCCGAGAGG +>A-mutant-1 +ACGACCAACGAAGGTCGCCGCGCACAATACCATTTCCGGTGTCCGATTGACTTGCGAATCTCGTCAAGCTCGACCCGCTCACGTCGCTGATTCCGATAGG +>A-mutant-2 +ACGACCAACGAAGGTCGCTGGGCACACTACCATTTCCGGTGTCTGATTGACTTGCGAATCTCGTCAAGCTCGACCTGCTCACGACGCTGATTCCGGTAGG +>A-mutant-3 +ACGACCAACGAAGGTCGCTGGTCACACTACCATTTCCGGTGTCTGATTGACTTGCGAATCTCGTCAAGCCCGACCTGCTCACGGCGCTGATTCCGGTAGG +>A-mutant-4 +ACGGCCAACGAAGGTCGCTGGTCACCTTACCATTCCCGGTGTCTTGTTGACTTGCCAATCTCGTCAAGCCCGACCTGCTCACGGCGCTGATTCCGGTAGG +>A-mutant-5 +ACGGCCAACGAAGGGCGCTGGTCATCTTACCATTCCCGGTGTCTTGTTGACTTGGCAATCTCGTCAAGCCCGACCTGCTCACGGCGCTGATTCCGGTAGG +>A-mutant-6 +ACGGCCATCGAAAGGCGCTGGTCATCTTACCATCCCCGGTGTCTTGCTGACTTGGCAATCTCGTCAAGCCCGACCTGCTCACGGCGCTGCTTCCGGTATG +>A-mutant-7 +AAGGCCATCGAAAGGTGCTGGTCATCTCACCATCCCCGCTGTCTTGCTAACTTCGTAATCTCGTCAATCCCGACCTGCTCACGGCGCTGCTTCCCGTATG +>A-mutant-8 +AAGACCATCGAAAGGTGCTGGTCATCTCACCATCCCCGCTGTCTTGCTAACTTCGTAATCTCGTCAATCCCGACCTGCGCACGGCGCTGCTTCCCGTATG +>A-mutant-9 +AAGACGATCGAAAGGTGCTGGTGATCCCACCATCCCCGCTGTCTTGCTAACTTCGTAATCTCGTCAATCCCGACCTGCGCACGGCGATGCTTCCCGTATG +>B +ACGACCAACGAACATCGACGCGCACAATACCATTTCCGGTGGCCGATTGATTTGCGATTCTAGTGAAGCACGACCCGCCTAAGTCTGTGATTCCGAGAGG +>B-mutant-1 +ACGACCAACGAACATCGACGCGCACAATGCCATTTCCGGTGGCCGATTGATTTTCGTTTCCAGTGATGGTCGGCCCACCTAAGTCTCTGATTCCGAGAGG +>B-mutant-2 +ACGACCTACGAACATCGACTCGCACAATGCCATTTCCGGTGGCCTATTGATTTTCGTTTCCAGTGATGGTCGGCCCACCGAAGTCTCTGATTCCGCGAGG +>B-mutant-3 +ACGACCTACGACCATCGACTCGCACAATGCCATTTCCGGTGGCCTATTGATTTTGGTTTCCAGTGATGGACGGCCCACCGAAGTCTCTGATTCCGCGAGG +>B-mutant-4 +ACGACCTACGACCATCGACTCGCACAATGCCATTTCCGATGGCCTATTGATTTTGGTTTCCAGTGATGGACGGCCCTCCGACGGCTCTGATTCCGCGAGG +>B-mutant-5 +AAAACCTACGACCATCGACTCGCACAATCCCATTTCCGCTGGTCTATTGTTTCTGGTCTCCCGTGATGGACGGCCCTCCGACGGCTCTGATTCCGCGAGG +>B-mutant-6 +AAAACCTACGACCATCGACTCGCACAATCCGATTGCCGCTGGTCTATTGTTTCTGGTCTCCCCTGATGGACGGCCCTCCGACCGCTCTGATTCCGCGAGG +>B-mutant-7 +AAAACCTACGACCATCAACTCGCACAATCCGATTGCCGCTGGTCTATTGTTTCTGGCCTCCCCTGATGGACGGCCCTCCGACCGCTCTGATTCCGCGAGG +>B-mutant-8 +AAAACTTACGACCATCAACTCACACAATCCGATTGCCGCTGGTCTATTGTTTCTGGCCTCCCCTGATGGACGGCCCTCGTACCTCTCTGATTCCGCGAGG +>B-mutant-9 +AAAACTTTGGACCATCAACTCACACAATCCGATTGCCGCTGGTCTATTGTTGCTGGCCTCCACTGATGGACGGCCCTCGTACATCTCTGATTCCGCGAGG +>recombinant +ACGACCAACGAAGGTCGCCGCGCACAATACCATTTCCGGTGTCCGATTGACTTGCGAATCCAGTGATGGTCGGCCCACCTAAGTCTCTGATTCCGAGAGG diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1-phyml.ascii new file mode 100644 index 0000000..06b5180 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-9 + | +--|--A-mutant-8 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-recombinant + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1-phyml.newick new file mode 100644 index 0000000..d2aaf6b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.03091496,A-mutant-8:0.00000000,(A-mutant-7:0.00000000,(A-mutant-6:0.00202989,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,(A:0.05229343,(recombinant:0.00923892,(B:0.00000000,(B-mutant-1:0.00942173,(B-mutant-2:0.00000001,(B-mutant-3:0.00000001,(B-mutant-4:0.00000001,(B-mutant-5:0.00000000,(B-mutant-6:0.00000000,(B-mutant-7:0.00000001,(B-mutant-8:0.00000001,B-mutant-9:0.06289060)0.999998:0.05225174)1.000000:0.07383590)1.000000:0.06258848)0.998962:0.03044231)1.000000:0.05167731)1.000000:0.07323155)0.999979:0.04184686)0.999562:0.05334095)1.000000:0.18805650)0.797450:0.04427053)0.993899:0.03175776)0.952187:0.01001875)1.000000:0.05184369)1.000000:0.06272846)1.000000:0.05135095)0.999622:0.02988806)0.962395:0.01875966)1.000000:0.08528284); diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1-raxml.ascii new file mode 100644 index 0000000..08fa639 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-3 + | + | /-B-mutant-5 + /-| /-| + | | | | /-B-mutant-6 + | | | \-| + | | | | /-B-mutant-7 + | \-| \-| + /-| | | /-B-mutant-9 + | | | \-| + | | | \-B-mutant-8 + | | | + /-| | \-B-mutant-4 + | | | + | | \-B-mutant-2 + | | + | \-B-mutant-1 + | + | /-recombinant + | | + | | /-A-mutant-1 + | | | + | | /-| /-A-mutant-2 + | | | | | + |--| | | | /-A-mutant-3 + | | | \-| | +--| | | | | /-A-mutant-6 + | | | | | | + | | | \-| /-| /-A-mutant-9 + | | | | | | /-| + | \-| | | \-| \-A-mutant-8 + | | | /-| | + | | | | | \-A-mutant-7 + | | \-| | + | | | \-A-mutant-5 + | | | + | | \-A-mutant-4 + | | + | \-A + | + \-B diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1-raxml.newick new file mode 100644 index 0000000..63f9e7b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1-raxml.newick @@ -0,0 +1 @@ +((((B-mutant-3:0.000001,((B-mutant-5:0.000001,(B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-9:0.062410,B-mutant-8:0.000001):0.051879):0.073229):0.062155):0.030304,B-mutant-4:0.000001):0.051348):0.072678,B-mutant-2:0.000001):0.041413,B-mutant-1:0.009586):0.043673,(recombinant:0.000001,((A-mutant-1:0.000001,(A-mutant-2:0.000001,(A-mutant-3:0.000001,(((A-mutant-6:0.002035,((A-mutant-9:0.030748,A-mutant-8:0.000001):0.084548,A-mutant-7:0.000001):0.018680):0.029738,A-mutant-5:0.000001):0.051091,A-mutant-4:0.000001):0.062293):0.051539):0.009993):0.030553,A:0.052875):0.052745):0.184558,B:0.008679):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1.fasta new file mode 100644 index 0000000..74105f7 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-70A1-B1.fasta @@ -0,0 +1,42 @@ +>A +GTAAGTATAAGACGATGCCTTTAAGCCCCGACGTACGGGACGTTACTGCATATCTTGATCGACACGGAGCCGGCATTTATCAAGCGGCGCCGCCACTCCG +>A-mutant-1 +GGAAGTATAAGACGATGCCTTTATGCCCCCACGTACGGGACGTTACTGCATATCTGGATCGACACGGAGTCGGCATGTATCTAGCGGCGCCGCCATTCCG +>A-mutant-2 +GGAAGTATAAGACGATGCCTTTATGCCCCCACGTACGGGACGTTACTGCATATCTGGATCGACACGGAGTCGGCATGTATCTAGCGGCGCCGCCATCCCG +>A-mutant-3 +GGAAGTATAAGACGACGCCTTTATGCCCCAACGTACGGGACGTTTTTGCATATCTGGATCGACACGGAGTCGGCATGTATCTAGCAGCGCCGCCATCCCG +>A-mutant-4 +GGAAGTATAAGACGTCGCCTTTATGCACTAACGTCCGGGACGTTTTTGCGTATCTGGAACGACACGGAGTCGGCATGTATCTAGCAGCGCCGCCATCCCG +>A-mutant-5 +GGAAGGATAAGACGTCGCCTTTATGCACTAACGTCCGGTACGTTTTTGCGTATCTGGAACGACACGGAGTCAGCAGGTATCTAGCAGCGCCGCCATACCG +>A-mutant-6 +GGAAGGATAAGACGTCGCCTTTATGCACTAACGTCCGGTACGTTTTTGCCTATCTGGAACGACACGGAGTCAGCAGGTATCTATCAGCGCCGCCATACAG +>A-mutant-7 +GGAAGGATAAGACGTCGCCTTTATGCACTAACGTCCGGTACGTTTTTGCCTATCTGGAACGACACGGTGTCAGCAGGTATCTATCAGCGCCGCCATACTG +>A-mutant-8 +GGAAGGATGAGACGTCGCCTTTATCCACTAACCGCCGGTACGTTTTTGCCGATCTGCAACCACACGGTGTCAGCAAGTATCTATCAGCGCCGCCATACTG +>A-mutant-9 +GGAAAGATGAGACTTCGCCTTTATCCACTAAACGCCGGTACGTTTTTGCCGATCTGCAACCACACGGTGTCAGCAAGTATCTATCAGCGCCGCCATACTG +>B +GTCAGTATAAGATAATCCCTTTCGGGCCCGACGTACGTGACGTTACTGCATATCTTGATCTCCACGCCGACGGCATTCAGCAAGCGGCGCCGCAACTTCG +>B-mutant-1 +GTCAGTATAAGATATTCCCTTTCGGGCCCGACGTACATGACGTTACTGCATTTCTTGGTCTCTACGCCGACGGCATTCAGCAAGCGGGGCCGCAACTTCG +>B-mutant-2 +GTCAGTATAAGATATTCCTTTTCGGGCCCGACGTACATGACGTTACTGCATTTCTTGATCTCTACGCCGACGTCATTTAGCAAGCGGGGCCGCTACTTCG +>B-mutant-3 +GTCAGTATAAGATATACCTTTTCGGGCCCGACGTACATGACGTTACTACATTTCTTCAGCTCTTCGCCGACGTCATTTAGCAAGCGGGGCCGCTACTGTG +>B-mutant-4 +GTCAGTATAAGATATACCTTTTCGGGCCAGACGTACGTGACGTTACTACAATTCTTCAGCTCTTCGCCGACGTCATTTAGCAAGCAGGGCCGCTAATGTG +>B-mutant-5 +GTCAGTATAAGATATACCTTTTCGGGCCAGGCGTACGTGACGTTACTACAATTCTTCAGCACTTCGCCGACGTCATTTAGCAAGCAGGGCCGCTAATGCG +>B-mutant-6 +GTCAGTATAAGATATACCTTCTCGTACCAGTCGTACGTGGCGTTACTACAATTCTTCACCACTTCGCCGACGTCATTTAGCAAGCAGGGCCGCTAATGCG +>B-mutant-7 +GTCAGTATAATATATACCTTCTCGTACCAGTCGTACATGGCGTTACTACAATTCTTCACCACCTCGCCGACGTCATTTAGCAAATAGGGCTGCGAATGCG +>B-mutant-8 +GTCAGTATAATATATACCTTCTGGTACCAGTCGTACATGCCGTTACTACAATTCCTCACCACCTCGCCGACGTCATTTAGCAAATGGGGCTGCGAGTGCG +>B-mutant-9 +GTCAGCATAATATATGCCTTCTTGTACCAGTCTTACATGCCGTTACTACAAATCCTCACCACCTCGCCGATGTCATTTAGCAAATGGGGCTGCGAGTGCG +>recombinant +GGAAGTATAAGACGATGCCTTTATGCCCCCACGTACGGGACGTTACTGCATATCTGGATCGACACGGAGTCGGCATTCAGCAAGCGGGGCCGCAACTTCG diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1-phyml.ascii new file mode 100644 index 0000000..813765d --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-9 + | +--|--B-mutant-8 + | + | /-B-mutant-7 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-1 + \-| + | /-B + \-| + | /-recombinant + \-| + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-9 + \-| + \-A-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1-phyml.newick new file mode 100644 index 0000000..3c0d6e5 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.05153951,B-mutant-8:0.00000000,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00919575,(B-mutant-4:0.00000000,(B-mutant-3:0.00000001,(B-mutant-2:0.00000000,(B-mutant-1:0.01658907,(B:0.02478054,(recombinant:0.00000001,(A:0.04237931,(A-mutant-1:0.00000000,(A-mutant-2:0.00000001,(A-mutant-3:0.00000001,(A-mutant-4:0.00000001,(A-mutant-5:0.00000000,(A-mutant-6:0.00000000,(A-mutant-7:0.00000000,(A-mutant-9:0.05291534,A-mutant-8:0.00000001)0.999999:0.04195885)0.999998:0.04164943)1.000000:0.05224096)1.000000:0.08597837)1.000000:0.06408635)1.000000:0.08571305)0.995898:0.02031553)0.630574:0.00952945)0.982209:0.06451311)1.000000:0.18619122)0.958254:0.03768756)0.856553:0.01522682)1.000000:0.06240525)0.996421:0.03048345)0.999990:0.04220841)1.000000:0.05311244)1.000000:0.06265846)0.999961:0.03074125); diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1-raxml.ascii new file mode 100644 index 0000000..4750c3b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-3 + | + | /-B-mutant-1 + | | + | | /-recombinant + | | | + | | | /-A + | | | | + | | /-| | /-A-mutant-3 + /-| /-| | | | | + | | | | | | | /-| /-A-mutant-4 + | | | | | | | | | | + | | | | | | | | \-| /-A-mutant-5 + | | | | | \-| | | | + | | | | | | | | | /-A-mutant-9 + | | | | | | | \-| /-| + | | | | | | /-| | /-| \-A-mutant-8 + | | | \-| | | | | | | + | \-| | | | | \-| \-A-mutant-7 + | | | | | | | + | | | \-| | \-A-mutant-6 + | | | | | + | | | | \-A-mutant-2 + | | | | +--| | | \-A-mutant-1 + | | | + | | \-B + | | + | \-B-mutant-2 + | + | /-B-mutant-6 + | /-| + | | | /-B-mutant-7 + | | \-| + |--| | /-B-mutant-8 + | | \-| + | | \-B-mutant-9 + | | + | \-B-mutant-5 + | + \-B-mutant-4 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1-raxml.newick new file mode 100644 index 0000000..f652d59 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1-raxml.newick @@ -0,0 +1 @@ +((B-mutant-3:0.000001,((B-mutant-1:0.016393,((recombinant:0.000001,(A:0.042086,(((A-mutant-3:0.000001,(A-mutant-4:0.000001,(A-mutant-5:0.000001,(((A-mutant-9:0.052568,A-mutant-8:0.000001):0.041678,A-mutant-7:0.000001):0.041373,A-mutant-6:0.000001):0.051876):0.085409):0.063654):0.085080,A-mutant-2:0.000001):0.020138,A-mutant-1:0.000001):0.009436):0.064074):0.185240,B:0.024527):0.037559):0.015138,B-mutant-2:0.000001):0.061909):0.030248,((B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-8:0.000001,B-mutant-9:0.051161):0.030501):0.062168):0.052812,B-mutant-5:0.009024):0.041991,B-mutant-4:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1.fasta new file mode 100644 index 0000000..52e4a67 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-80A1-B1.fasta @@ -0,0 +1,42 @@ +>A +TCAATCATCAGAATCCAATCGCAAGTTTGTCTCCGTGAAAGCGATCAAACAAGACCTAAATTGCACTCCAGAATTGAATTAATCTCGTGTCATCGGTCTC +>A-mutant-1 +TCAATCATCAGAATCCAATCGCATGTTTGTCTCCGCGAAAGCGATCATACAAGACCTTAATTGCACTCCAGAATTGAATTACTCTCGTGTCATCGGTCTC +>A-mutant-2 +TCAATCATCAGAATCCAATCGCATGTTTGTCTCCGCGAAAGCGATCATACAAGACCTTAATAGCACTCCAGAATTGAATTACTCTCGTGTCATCGGTCCC +>A-mutant-3 +TCAATCATCAGAATCCAATCGCTGGTTTGTCTCAGTGAAAGCGAACATATAAGAGCTTAATAGGACTCCAGAATTGAATTACTCTCGTGTCATCGGTCCC +>A-mutant-4 +TCCATCATCAGAATCCAATCACTGGTTTGTCTCAGTGAAAGCGAACATATCAGAGCTTAATAGGACTCCAGAATTGAGTTACTCTCGTGTCATCGCTACC +>A-mutant-5 +TCCATCATCAGAATCCAATCACTGCTTTGTCTCCGTGACAGCGAACATATCAGAGCTTAATAGGACTCCAGAATTGAGTTTGTTTCATGGCATCGCTACC +>A-mutant-6 +TCCATCAGCAGAATCCAATCACTGCTTTGTCTCCGTGACAGCGAAGATATCAGAGCTTAATAGGACTCAAGAATTGAGTTTGTTTCATGGCATCGTTAGC +>A-mutant-7 +TCCATAAGCAGAATCCAACCACTGCTTTGTCACCGTGACAGCGAAGATATCAGAGCTCAATAGGACTCAAGAATTGAGTTTGTTTCATGGCATCGTTAGC +>A-mutant-8 +TCCATAAGCAGAATCCAACCAATGCTTTGGCACCGTGACAGCGAAGATATCATAGCTCAATAGGACTCAAGAATTGAGTTTGTTTGATGGCATCGTTAGC +>A-mutant-9 +TCCAGAAGCAGAATCCAACCAATGCTTTGGCACCGTGACAGCGACCATATTATAGCTCAATAGGACTCAAGAATGGAGTTTGTTTGATGGCATCGTTAGC +>B +TCAGTCATCAGAAACCATTCTCAAGTTTGTTTCCGTAAAAGCGATCAATCTAGTCCTAAATTGCACTCCAGTAGTGGACTCATCTGCCGGCATCGGTCTC +>B-mutant-1 +TCAGTCATCAGAATCCATTCTCAGGTTTGTTTCCGTAAAAGCGACCAATCTACTCCTAAATTGCACTCCAGTAATTGACTCATCTGCCGGCATCGGTATC +>B-mutant-2 +TCAGTCATCAGAATCCATTCTCAGGTTTGTTTCCGTAAAAGCGACCAATCTATTCCTAAATTGCACCCCAGTAGTTGACTCATCTGCCGGCATCGGTATC +>B-mutant-3 +TCAGCCATCAGAATCCATTCTCAGGTTTGTTATCGTAAAAGTGCCCAATCTATTGCTAAATTGCACCCCAGTAGTTGACTCATCTGCCGGCATCGGTATC +>B-mutant-4 +TCAGCCATCAGAATCCATTCTCAGGTTTGTTATCGTAAAAGTGCCCAATCTATTTCTAAATTGCACCCCAGTAGTCGACTCATTTGCCGGCATCGGTATC +>B-mutant-5 +TCAGCCATCAGAATCCCTTCTCAGGTTTGTTATCGTAAAAGTGCCCAAGCTAGTTCTAAATTGCACCCCAGTAGTCGACCCATTTGTCGGCATCGGTATC +>B-mutant-6 +TCAGCCATCAGAATCCCTACTCAGGTTTGTTATCGTAAAAGTTCCCACGCTAGTTCAAAATTGCACCCCAGTAGTCGACCCATTTGCCGGCATAGGTATC +>B-mutant-7 +ACATCCATCAGAATCCCTACTCAGGTTTGTTATCGTAAAAGTTCCCACGCTAGATCAAAATTGCACCCCTGTAGTCGTCCCATTTGCCGGGATAGGTATC +>B-mutant-8 +ACATCCATCAGCATCCCTGCTCAGGTTTGTTATCGTAAAAGTTCCCACGCTAGATCAAAATTGCACCTCTGTAGTCGTCCCATTTGCCGGGATAGGTATC +>B-mutant-9 +ATATCCATCAGCACCCCTGCTCAGGTTTGTTATCGTAAAAGTTCCCTCGCTAGATCAAAATTGCACCTCTGTAGTCGTCCCATTTGTCGGGATAGGTAAC +>recombinant +TCAATCATCAGAATCCAATCGCATGTTTGTCTCCGCGAAAGCGATCATACAAGACCTTAATTGCACTCCAGAATTGAATTCATCTGCCGGCATCGGTATC diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1-phyml.ascii new file mode 100644 index 0000000..6248808 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1-phyml.ascii @@ -0,0 +1,40 @@ + + /-A-mutant-9 + | +--|--A-mutant-8 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-1 + \-| + | /-recombinant + \-| + | /-A + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + \-B-mutant-9 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1-phyml.newick new file mode 100644 index 0000000..be11b1c --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.09595255,A-mutant-8:0.00000000,(A-mutant-7:0.00000000,(A-mutant-6:0.00388580,(A-mutant-5:0.01008873,(A-mutant-4:0.00000000,(A-mutant-3:0.00000001,(A-mutant-1:0.00000000,(recombinant:0.03048323,(A:0.00000001,(B:0.00000001,(B-mutant-1:0.00000001,(B-mutant-2:0.00000001,(B-mutant-3:0.00000000,(B-mutant-4:0.00994899,(B-mutant-5:0.00000000,(B-mutant-6:0.00000001,(B-mutant-7:0.00000000,(B-mutant-8:0.00000000,B-mutant-9:0.04151907)1.000000:0.05227310)1.000000:0.05143876)0.999998:0.04077595)0.996041:0.02033434)0.999950:0.03067526)1.000000:0.05138634)0.999999:0.04091657)0.999979:0.05105486)1.000000:0.17988105)0.977427:0.03027218)0.000000:0.00000001)1.000000:0.06196515)1.000000:0.09687093)0.997584:0.02054548)0.932929:0.01739170)0.999679:0.02986741)0.999993:0.04137156); diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1-raxml.ascii new file mode 100644 index 0000000..61ef0a2 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-8 + /-| + /-| \-B-mutant-9 + | | + | \-B-mutant-7 + | + |--B-mutant-6 + | +--| /-B-mutant-5 + | | + | | /-B-mutant-4 + | | | + | | | /-A + | | | | + | | | | /-A-mutant-4 + \-| | | | + | | | /-| /-A-mutant-5 + | | | | | | + | | | | \-| /-A-mutant-6 + | | /-| | | | + | | | | | \-| /-A-mutant-9 + | | | | /-| | /-| + | | | | | | \-| \-A-mutant-8 + \-| | | | | | + | | | | | \-A-mutant-7 + | | | | | + | /-| \-| | /-A-mutant-3 + | | | | \-| + | | | | \-A-mutant-2 + | | | | + | | | | /-recombinant + | /-| | \-| + | | | | \-A-mutant-1 + | | | | + | /-| | \-B + | | | | + | | | \-B-mutant-1 + \-| | + | \-B-mutant-2 + | + \-B-mutant-3 diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1-raxml.newick new file mode 100644 index 0000000..658ef1b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1-raxml.newick @@ -0,0 +1 @@ +(((B-mutant-8:0.000001,B-mutant-9:0.041483):0.052234,B-mutant-7:0.000001):0.051392,B-mutant-6:0.000001,(B-mutant-5:0.000001,(B-mutant-4:0.009940,(((((A:0.000001,(((A-mutant-4:0.000001,(A-mutant-5:0.010081,(A-mutant-6:0.003941,((A-mutant-9:0.095898,A-mutant-8:0.000001):0.041343,A-mutant-7:0.000001):0.029837):0.017271):0.020527):0.096831,(A-mutant-3:0.000001,A-mutant-2:0.000001):0.000001):0.061922,(recombinant:0.030460,A-mutant-1:0.000001):0.000001):0.030247):0.179843,B:0.000001):0.051015,B-mutant-1:0.000001):0.040885,B-mutant-2:0.000001):0.051347,B-mutant-3:0.000001):0.030647):0.020313):0.040736):0.0; diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1.fasta b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1.fasta new file mode 100644 index 0000000..63ca669 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/out3/recombinant-90A1-B1.fasta @@ -0,0 +1,42 @@ +>A +ATTCCGGATTTCAAAAGTGACCTGATCACGTGCGTGCCCGGTCACATAAGTGACCGGATAAGGCGCGTCCATGAATAGTTGTTTACTTAGAGACCAGCTT +>A-mutant-1 +ATTCCGGATTTAAAAAGTGACCTGATCACGTGCGTGCCCGGTCACATAAGTGACCGGATAAGGCGCGTCCATGAATGTTTGTTTACTTAGAGACCAGCTT +>A-mutant-2 +ATTCCGGATTTAAAAAGTGACCTGATCACGTGCGTGCCCGGTCGCATAAGCGACCGGATAAGGCTCGTCCATGAATGTTTGTAGACTTATAGACCAGCTT +>A-mutant-3 +ATTCCGGATTTAAAAAGTGACCTGATCACGTGCGTGCCCGGTCGCATAAGCGACCGGATAAGGCTCGTCCATGAATGTTTGTAGACTTATAGACCAGCTT +>A-mutant-4 +ATTCCGGTTTTAAAACGTGGCCTGATCACGTGCGTGCCCAGTCGCATAAGCGACCGGTTACGGCTCGTCCATGAATCTTAGTAGACTTATAGGCCAGCTT +>A-mutant-5 +TTTCCGGTTTTAAAACGTGGCCTGATCACGTGCGTGCCCAGTCGCATAAGCGACCGGTTACGGCTCGTCCATGAGTCTTAGTAGGCTTATAGGCCAGCTT +>A-mutant-6 +TTTCCGGTTTCAAAACGTGGCCTGATCACGTGCGTGCCCAGTCGCATAAGCGACCGGTTACGGCTCGTCCATGAATCTTAGCAGGCTTATAGGCCAGCTT +>A-mutant-7 +TTTCCGGTTGCAAAACGTGGCCTGATCACGTGCGTGCCCAGTCGCATAAGCGACCGGTTACGGCTCGCCCATGAATCTTAGGAGGCTTATAGGCCAGCTT +>A-mutant-8 +TTTCCGATTGCAAAACGTGGCCTGATCACGTGCGTGCCCAGTCCCATAAGCGACCGGTTCCGGCTCGCCCATGAATCTTAGGGGGCTTATAGGCCAGCTT +>A-mutant-9 +ATTCCGATTGCAAACCGTGGCCGGATCACGTGCGTGCCCAGTCCCATAAGCGACCGGTTCCGTTTCGCCTATGAATCTGAAGGGGCTCATAGGCCAGCTT +>B +ATTCCGGATTTCAAAACTTATCTTATCACGTGCGAGCCCAGTCAGATAAGGTCCCGGACAAGGCGAGTCAATGAATAGTTGTTTATTTAGTGACCCGCTT +>B-mutant-1 +ATTTCGGGTTTCAAAACTTATCTTATCCCATGCGAGCCCAGTCAGATAAGGTCCCGGACAAGGCGAGTCAATGAATAGTTGTTTATTTAGTGACCCACTT +>B-mutant-2 +ATGTCGGGTTTCAAAAGTTATCTTATCCCATGCGAGCCCAGTCAGGTAAGGTCCCGGACAAGGCGATTCAATGAATAGTTGTTTATTTAGTGACCCACTT +>B-mutant-3 +ATGTCAGGTTTCAAAAGTTATCTTATCCCATGCGAGCCCAGTCAGGTAAGGTCCCGGATAAGGCGATTCAATGAATTGTTGTTTATTGAGTGACCCGCTT +>B-mutant-4 +ATGTTAGGTTTCAAAAGTTATCTTATTCCATGCGAGCCCAGTCAGGTAAGGTCCCGGATAAGGCGATTCAATGAATTGTTGTTTATTGAGTGCCCCGCTG +>B-mutant-5 +ATGTTAGGTTTCAAAAGTTATCTGATTCCATGCGAGCCCAGTCAGGTAAGGTCCCGGATAAGGCGATTCAATGAATTGTTGGTTATTGAGTGCCCCGCTT +>B-mutant-6 +ATGTTAGGTTTCACAAGTTATCTGATTCCATGCGAGCCTAGTCAGGTAAGTTCCCGGCTAAGGCGATTCAATGAATTGTTGGTTATTGAGTGCCCCGCTT +>B-mutant-7 +ATGCTAGGTTTCACAAATTATCTGATCCCCTGCGAGCCTAGTCAGGTAAGTTCCCGGCTAAGGCGATTCAATGAATTGTTTGTTATTGAGTGCCCCGCTT +>B-mutant-8 +ATGCTAGGTTTCACAAATTATCTGATCGCCTGAGAGCCTAGTCAGCTAAGTTCCCGGCTAAGGCGCTTCGATGAATTGTTTGTTATTGAGTGCCCCGCTT +>B-mutant-9 +ATGCAAGGCTTCACAAATTATCTGATCGCCTGAGACCCTAGTCAGCTAAGTTCCCGGCTAAGGTGCTTCGATGAATTGTTTGTTATTGAGTGCCCCGCTT +>recombinant +ATTCCGGATTTAAAAAGTGACCTGATCACGTGCGTGCCCGGTCACATAAGTGACCGGATAAGGCGCGTCCATGAATGTTTGTTTACTTAGTGACCCACTT diff --git a/recombinationgradients/recombinationgradient_A1B1/out3/recombinants_A1B1.png b/recombinationgradients/recombinationgradient_A1B1/out3/recombinants_A1B1.png new file mode 100644 index 0000000..40de701 Binary files /dev/null and b/recombinationgradients/recombinationgradient_A1B1/out3/recombinants_A1B1.png differ diff --git a/recombinationgradients/recombinationgradient_A1B1/recombinant-10A1-B1.json b/recombinationgradients/recombinationgradient_A1B1/recombinant-10A1-B1.json new file mode 100644 index 0000000..107e04d --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/recombinant-10A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 10 + }, + { + "from id": "B-mutant-1", + "start": 11, + "length": 90 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B1/recombinant-20A1-B1.json b/recombinationgradients/recombinationgradient_A1B1/recombinant-20A1-B1.json new file mode 100644 index 0000000..81d544a --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/recombinant-20A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 20 + }, + { + "from id": "B-mutant-1", + "start": 21, + "length": 80 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B1/recombinant-30A1-B1.json b/recombinationgradients/recombinationgradient_A1B1/recombinant-30A1-B1.json new file mode 100644 index 0000000..247ad18 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/recombinant-30A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 30 + }, + { + "from id": "B-mutant-1", + "start": 31, + "length": 70 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B1/recombinant-40A1-B1.json b/recombinationgradients/recombinationgradient_A1B1/recombinant-40A1-B1.json new file mode 100644 index 0000000..e079956 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/recombinant-40A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 40 + }, + { + "from id": "B-mutant-1", + "start": 41, + "length": 60 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B1/recombinant-50A1-B1.json b/recombinationgradients/recombinationgradient_A1B1/recombinant-50A1-B1.json new file mode 100644 index 0000000..0912d8e --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/recombinant-50A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 50 + }, + { + "from id": "B-mutant-1", + "start": 51, + "length": 50 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B1/recombinant-60A1-B1.json b/recombinationgradients/recombinationgradient_A1B1/recombinant-60A1-B1.json new file mode 100644 index 0000000..338e835 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/recombinant-60A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 60 + }, + { + "from id": "B-mutant-1", + "start": 61, + "length": 40 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B1/recombinant-70A1-B1.json b/recombinationgradients/recombinationgradient_A1B1/recombinant-70A1-B1.json new file mode 100644 index 0000000..e12a82e --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/recombinant-70A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 70 + }, + { + "from id": "B-mutant-1", + "start": 71, + "length": 30 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B1/recombinant-80A1-B1.json b/recombinationgradients/recombinationgradient_A1B1/recombinant-80A1-B1.json new file mode 100644 index 0000000..928b5c5 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/recombinant-80A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 80 + }, + { + "from id": "B-mutant-1", + "start": 81, + "length": 20 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B1/recombinant-90A1-B1.json b/recombinationgradients/recombinationgradient_A1B1/recombinant-90A1-B1.json new file mode 100644 index 0000000..09ddf18 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/recombinant-90A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 90 + }, + { + "from id": "B-mutant-1", + "start": 91, + "length": 10 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B1/recombinant_gradient.py b/recombinationgradients/recombinationgradient_A1B1/recombinant_gradient.py new file mode 100755 index 0000000..bc9e918 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B1/recombinant_gradient.py @@ -0,0 +1,54 @@ +#!/usr/bin/env python + +from ete3 import Tree +from argparse import ArgumentParser +import matplotlib.pyplot as plt +import seaborn + +def rec_parentdistance(newickfile): + + with open(newickfile) as f: + name = f.name + print('Analysing sample:', name) + treedata = f.read() + treedata = treedata.strip() + t = Tree(treedata) + + # Reroot the tree through midpoint rooting. + midpoint = t.get_midpoint_outgroup() + t.set_outgroup(midpoint) + print(t) + + # Find distance from recombinant to A1 + A1distance = t.get_distance("recombinant", "A-mutant-1") + print("Distance of A1 to recombinant is %f" %(A1distance)) + B1distance = t.get_distance("recombinant", "B-mutant-1") + print("Distance of B1 to recombinant is %f" %(B1distance)) + + return(A1distance, B1distance) + + print('\n') + +parser = ArgumentParser() +parser.add_argument('fname', nargs='+', action='append', metavar='FILE', help='Newick file to analyse.') +args = parser.parse_args() + +A1_distances = [] +B1_distances = [] +filenames = args.fname +for filename in filenames[0]: + recdistances = rec_parentdistance(filename) + A1_distances.append(recdistances[0]) + B1_distances.append(recdistances[1]) + +listemitxwerten = [10, 20, 30, 40, 50, 60, 70, 80, 90] +plt.figure() +plt.plot(listemitxwerten, A1_distances, label="A1") +plt.plot(listemitxwerten, B1_distances, label="B1") +plt.title("Recombinant from A1 and B1 (a gradient of percentages)") +plt.xlabel("Percentage of recombinant from A1 (from B1=100-A1)", fontsize=14) +plt.ylabel('Distance to recombinant', fontsize=14) +plt.legend(fontsize=12) +plt.tight_layout() +plotpath = 'recombinants_A1B1.png' +plt.savefig(plotpath, dpi=300) \ No newline at end of file diff --git a/recombinationgradients/recombinationgradient_A1B9/Makefile b/recombinationgradients/recombinationgradient_A1B9/Makefile new file mode 100644 index 0000000..fc2618b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B9/Makefile @@ -0,0 +1,52 @@ +OUTGROUP := root +OUTDIR := out + +.PRECIOUS: $(OUTDIR)/%.fasta $(OUTDIR)/%.newick + +JSON := $(wildcard *.json) + +PHY := $(patsubst %.json, $(OUTDIR)/%.phy, $(JSON)) +FASTA := $(patsubst %.json, $(OUTDIR)/%.fasta, $(JSON)) +PHYML_ASCII := $(patsubst %.json, $(OUTDIR)/%-phyml.ascii, $(JSON)) +RAXML_ASCII := $(patsubst %.json, $(OUTDIR)/%-raxml.ascii, $(JSON)) +PHYML_NEWICK := $(patsubst %.json, $(OUTDIR)/%-phyml.newick, $(JSON)) +RAXML_NEWICK := $(patsubst %.json, $(OUTDIR)/%-raxml.newick, $(JSON)) + +ASCII := $(PHYML_ASCII) $(RAXML_ASCII) +NEWICK := $(PHYML_NEWICK) $(RAXML_NEWICK) + +all: $(OUTDIR) $(ASCII) $(NEWICK) + +out: + test -d $(OUTDIR) || mkdir $(OUTDIR) + +$(OUTDIR)/%.fasta : %.json + seq-gen.py --specification $< > $@ + +$(OUTDIR)/%.phy: $(OUTDIR)/%.fasta + fasta-to-phylip.py < $< > $@ + +$(OUTDIR)/%-phyml.newick: $(OUTDIR)/%.phy + phyml -m GTR -q -i $< -o tlr -f m -v e --run_id xxxxx >/dev/null + mv $(OUTDIR)/*_tree_xxxxx.txt $@ + rm -f $(OUTDIR)/*.phy_phyml_*_xxxxx* + +$(OUTDIR)/%-raxml.newick: $(OUTDIR)/%.phy + raxml-ng --msa $< --model GTR+G --prefix xxxxx --seed $$RANDOM --threads 1 >/dev/null + mv xxxxx.raxml.bestTree $@ + rm -f xxxxx.* + +$(OUTDIR)/%.ascii: $(OUTDIR)/%.newick + newick-to-ascii.py --outgroup $(OUTGROUP) < $< > $@ + +uptree_branchlength: + uptree_branchlength.sh + +minimal_branchlength: + minimal_branchlength.sh + +clean: + rm -f $(ASCII) $(NEWICK) $(PHY) $(OUTDIR)/*xxxxx* xxxxx.* + +clobber: clean + rm -fr $(OUTDIR) diff --git a/recombinationgradients/recombinationgradient_A1B9/recombinant-10A1-B1.json b/recombinationgradients/recombinationgradient_A1B9/recombinant-10A1-B1.json new file mode 100644 index 0000000..907e557 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B9/recombinant-10A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 10 + }, + { + "from id": "B-mutant-9", + "start": 11, + "length": 90 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B9/recombinant-20A1-B1.json b/recombinationgradients/recombinationgradient_A1B9/recombinant-20A1-B1.json new file mode 100644 index 0000000..ce88ede --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B9/recombinant-20A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 20 + }, + { + "from id": "B-mutant-9", + "start": 21, + "length": 80 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B9/recombinant-30A1-B1.json b/recombinationgradients/recombinationgradient_A1B9/recombinant-30A1-B1.json new file mode 100644 index 0000000..e17160f --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B9/recombinant-30A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 30 + }, + { + "from id": "B-mutant-9", + "start": 31, + "length": 70 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B9/recombinant-40A1-B1.json b/recombinationgradients/recombinationgradient_A1B9/recombinant-40A1-B1.json new file mode 100644 index 0000000..9edc50e --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B9/recombinant-40A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 40 + }, + { + "from id": "B-mutant-9", + "start": 41, + "length": 60 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B9/recombinant-50A1-B1.json b/recombinationgradients/recombinationgradient_A1B9/recombinant-50A1-B1.json new file mode 100644 index 0000000..5aa4151 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B9/recombinant-50A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 50 + }, + { + "from id": "B-mutant-9", + "start": 51, + "length": 50 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B9/recombinant-60A1-B1.json b/recombinationgradients/recombinationgradient_A1B9/recombinant-60A1-B1.json new file mode 100644 index 0000000..329dd91 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B9/recombinant-60A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 60 + }, + { + "from id": "B-mutant-9", + "start": 61, + "length": 40 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B9/recombinant-70A1-B1.json b/recombinationgradients/recombinationgradient_A1B9/recombinant-70A1-B1.json new file mode 100644 index 0000000..7603556 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B9/recombinant-70A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 70 + }, + { + "from id": "B-mutant-9", + "start": 71, + "length": 30 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B9/recombinant-80A1-B1.json b/recombinationgradients/recombinationgradient_A1B9/recombinant-80A1-B1.json new file mode 100644 index 0000000..8c4f158 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B9/recombinant-80A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 80 + }, + { + "from id": "B-mutant-9", + "start": 81, + "length": 20 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B9/recombinant-90A1-B1.json b/recombinationgradients/recombinationgradient_A1B9/recombinant-90A1-B1.json new file mode 100644 index 0000000..e620281 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B9/recombinant-90A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-1", + "start": 1, + "length": 90 + }, + { + "from id": "B-mutant-9", + "start": 91, + "length": 10 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A1B9/recombinant_gradient.py b/recombinationgradients/recombinationgradient_A1B9/recombinant_gradient.py new file mode 100755 index 0000000..d31f5c9 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A1B9/recombinant_gradient.py @@ -0,0 +1,52 @@ +#!/usr/bin/env python + +from ete3 import Tree +from argparse import ArgumentParser +import matplotlib.pyplot as plt +import seaborn + +def rec_parentdistance(newickfile): + + with open(newickfile) as f: + name = f.name + print('Analysing sample:', name) + treedata = f.read() + treedata = treedata.strip() + t = Tree(treedata) + + # Reroot the tree. + midpoint = t.get_midpoint_outgroup() + t.set_outgroup(midpoint) + print(t) + + # Find distance from recombinant to A1 + A1distance = t.get_distance("recombinant", "A-mutant-1") + B9distance = t.get_distance("recombinant", "B-mutant-9") + + return(A1distance, B9distance) + + print('\n') + +parser = ArgumentParser() +parser.add_argument('fname', nargs='+', action='append', metavar='FILE', help='Newick file to analyse.') +args = parser.parse_args() + +A1_distances = [] +B9_distances = [] +filenames = args.fname +for filename in filenames[0]: + recdistances = rec_parentdistance(filename) + A1_distances.append(recdistances[0]) + B9_distances.append(recdistances[1]) + +listemitxwerten = [10, 20, 30, 40, 50, 60, 70, 80, 90] +plt.figure() +plt.plot(listemitxwerten, A1_distances, label="A1") +plt.plot(listemitxwerten, B9_distances, label="B9") +plt.title("Recombinant from A1 and B9 (a gradient of percentages)") +plt.xlabel("Percentage of recombinant from A1 (from B9=100-A1)", fontsize=14) +plt.ylabel('Distance to recombinant', fontsize=14) +plt.legend(fontsize=12) +plt.tight_layout() +plotpath = 'recombinants_A1B9.png' +plt.savefig(plotpath, dpi=300) \ No newline at end of file diff --git a/recombinationgradients/recombinationgradient_A9B9/Makefile b/recombinationgradients/recombinationgradient_A9B9/Makefile new file mode 100644 index 0000000..fc2618b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/Makefile @@ -0,0 +1,52 @@ +OUTGROUP := root +OUTDIR := out + +.PRECIOUS: $(OUTDIR)/%.fasta $(OUTDIR)/%.newick + +JSON := $(wildcard *.json) + +PHY := $(patsubst %.json, $(OUTDIR)/%.phy, $(JSON)) +FASTA := $(patsubst %.json, $(OUTDIR)/%.fasta, $(JSON)) +PHYML_ASCII := $(patsubst %.json, $(OUTDIR)/%-phyml.ascii, $(JSON)) +RAXML_ASCII := $(patsubst %.json, $(OUTDIR)/%-raxml.ascii, $(JSON)) +PHYML_NEWICK := $(patsubst %.json, $(OUTDIR)/%-phyml.newick, $(JSON)) +RAXML_NEWICK := $(patsubst %.json, $(OUTDIR)/%-raxml.newick, $(JSON)) + +ASCII := $(PHYML_ASCII) $(RAXML_ASCII) +NEWICK := $(PHYML_NEWICK) $(RAXML_NEWICK) + +all: $(OUTDIR) $(ASCII) $(NEWICK) + +out: + test -d $(OUTDIR) || mkdir $(OUTDIR) + +$(OUTDIR)/%.fasta : %.json + seq-gen.py --specification $< > $@ + +$(OUTDIR)/%.phy: $(OUTDIR)/%.fasta + fasta-to-phylip.py < $< > $@ + +$(OUTDIR)/%-phyml.newick: $(OUTDIR)/%.phy + phyml -m GTR -q -i $< -o tlr -f m -v e --run_id xxxxx >/dev/null + mv $(OUTDIR)/*_tree_xxxxx.txt $@ + rm -f $(OUTDIR)/*.phy_phyml_*_xxxxx* + +$(OUTDIR)/%-raxml.newick: $(OUTDIR)/%.phy + raxml-ng --msa $< --model GTR+G --prefix xxxxx --seed $$RANDOM --threads 1 >/dev/null + mv xxxxx.raxml.bestTree $@ + rm -f xxxxx.* + +$(OUTDIR)/%.ascii: $(OUTDIR)/%.newick + newick-to-ascii.py --outgroup $(OUTGROUP) < $< > $@ + +uptree_branchlength: + uptree_branchlength.sh + +minimal_branchlength: + minimal_branchlength.sh + +clean: + rm -f $(ASCII) $(NEWICK) $(PHY) $(OUTDIR)/*xxxxx* xxxxx.* + +clobber: clean + rm -fr $(OUTDIR) diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/outtest b/recombinationgradients/recombinationgradient_A9B9/out1/outtest new file mode 100644 index 0000000..7946626 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/outtest @@ -0,0 +1,387 @@ +Analysing sample: recombinant-10A1-B1-raxml.newick + + /-A-mutant-2 + | + | /-A-mutant-9 + | /-| + | /-| \-A-mutant-8 + | | | + /-| /-| \-A-mutant-7 + | | | | + | | /-| \-A-mutant-6 + | | | | + | | /-| \-A-mutant-5 + /-| | | | + | | \-| \-A-mutant-4 + | | | + /-| | \-A-mutant-3 + | | | + | | \-A-mutant-1 +--| | + | \-A + | + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + | /-B-mutant-9 + \-| + \-recombinant +Analysing sample: recombinant-20A1-B1-raxml.newick + + /-A + | + | /-A-mutant-2 + | | + | /-| /-A-mutant-3 + /-| | | | + | | | \-| /-A-mutant-4 + | | | | | + | | | \-| /-A-mutant-5 + | | | | | + | | | \-| /-A-mutant-6 + | \-| | | + | | \-| /-A-mutant-8 +--| | | /-| + | | \-| \-A-mutant-9 + | | | + | | \-A-mutant-7 + | | + | \-A-mutant-1 + | + | /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-4 + | | + \-| /-B-mutant-5 + | | + \-| /-B-mutant-6 + | | + \-| /-B-mutant-7 + | | + \-| /-recombinant + | /-| + \-| \-B-mutant-9 + | + \-B-mutant-8 +Analysing sample: recombinant-30A1-B1-raxml.newick + + /-B + | + | /-B-mutant-1 + | | + /-| | /-B-mutant-7 + | | | /-| + | | | | | /-B-mutant-8 + | | | | \-| + | | | | | /-recombinant + | \-| /-| \-| + | | | | \-B-mutant-9 + | | | | + | | /-| | /-B-mutant-5 + | | | | \-| +--| | | | \-B-mutant-6 + | | /-| | + | | | | \-B-mutant-4 + | \-| | + | | \-B-mutant-3 + | | + | \-B-mutant-2 + | + | /-A + | | + \-| /-A-mutant-1 + | | + \-| /-A-mutant-2 + | | + \-| /-A-mutant-3 + | | + \-| /-A-mutant-4 + | | + \-| /-A-mutant-5 + | | + \-| /-A-mutant-6 + | | + \-| /-A-mutant-9 + | /-| + \-| \-A-mutant-8 + | + \-A-mutant-7 +Analysing sample: recombinant-40A1-B1-raxml.newick + + /-A-mutant-1 + | + | /-A-mutant-2 + /-| | + | | | /-A-mutant-6 + | | | | + | | | /-| /-A-mutant-9 + | \-| | | /-| + | | | \-| \-A-mutant-8 + | | /-| | + /-| | | | \-A-mutant-7 + | | | /-| | + | | | | | \-A-mutant-5 + | | \-| | + | | | \-A-mutant-4 + /-| | | + | | | \-A-mutant-3 + | | | + | | \-A +--| | + | \-B + | + | /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + | | /-B-mutant-3 + \-| | + | | /-B-mutant-5 + | | | + \-| /-| /-B-mutant-6 + | | | | + | | \-| /-B-mutant-7 + | | | | + | | \-| /-recombinant + \-| | /-| + | \-| \-B-mutant-9 + | | + | \-B-mutant-8 + | + \-B-mutant-4 +Analysing sample: recombinant-50A1-B1-raxml.newick + + /-A + | + | /-A-mutant-5 + | /-| + | | | /-A-mutant-6 + | | \-| + | | | /-A-mutant-7 + /-| /-| \-| + | | | | | /-A-mutant-8 + | | | | \-| + | | /-| | \-A-mutant-9 + | | | | | + | | | | \-A-mutant-4 + /-| | /-| | + | | | | | \-A-mutant-3 + | | \-| | + | | | \-A-mutant-2 + | | | +--| | \-A-mutant-1 + | | + | \-B + | + | /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-3 + | | + \-| /-B-mutant-4 + | | + \-| /-B-mutant-5 + | | + \-| /-B-mutant-6 + | | + \-| /-B-mutant-7 + | | + \-| /-recombinant + | /-| + \-| \-B-mutant-9 + | + \-B-mutant-8 +Analysing sample: recombinant-60A1-B1-raxml.newick + + /-A + | + | /-B + /-| | + | | | /-B-mutant-2 + | | | /-| + | | | | | /-B-mutant-3 + | \-| | \-| + | | | | /-B-mutant-4 + | | | \-| + | | | | /-B-mutant-5 + | | | \-| + /-| \-| | /-B-mutant-6 + | | | \-| + | | | | /-B-mutant-7 + | | | \-| + | | | | /-B-mutant-8 + | | | \-| +--| | | \-B-mutant-9 + | | | + | | \-B-mutant-1 + | | + | \-A-mutant-1 + | + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + | /-recombinant + \-| + \-A-mutant-9 +Analysing sample: recombinant-70A1-B1-raxml.newick + + /-B + | + | /-B-mutant-1 + | | + /-| | /-B-mutant-4 + | | | | + | | | | /-B-mutant-6 + | | | /-| | + | \-| | | /-| /-B-mutant-9 + | | | | | | /-| + | | | | | \-| \-B-mutant-8 + | | /-| \-| | + | | | | | \-B-mutant-7 + | | | | | + | \-| | \-B-mutant-5 +--| | | + | | \-B-mutant-3 + | | + | \-B-mutant-2 + | + | /-A + | | + | | /-A-mutant-2 + | | | + | | | /-A-mutant-3 + | | /-| | + \-| | | | /-A-mutant-6 + | | | | | + | | | | /-| /-A-mutant-8 + | | \-| | | /-| + | | | | | | | /-recombinant + | | | | \-| \-| + \-| | /-| | \-A-mutant-9 + | | | | | + | | | | \-A-mutant-7 + | \-| | + | | \-A-mutant-5 + | | + | \-A-mutant-4 + | + \-A-mutant-1 +Analysing sample: recombinant-80A1-B1-raxml.newick + + /-A-mutant-2 + | + | /-A-mutant-3 + /-| | + | | | /-A-mutant-5 + | | | | + | \-| | /-A-mutant-8 + | | /-| /-| + | | | | | | /-A-mutant-9 + | | | | /-| \-| + /-| | | | | | \-recombinant + | | \-| \-| | + | | | | \-A-mutant-7 + | | | | + | | | \-A-mutant-6 +--| | | + | | \-A-mutant-4 + | | + | \-A-mutant-1 + | + | /-A + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-9 + \-| + \-B-mutant-8 +Analysing sample: recombinant-90A1-B1-raxml.newick + + /-A + | + | /-A-mutant-1 + | | + /-| | /-A-mutant-3 + | | | | + | | | | /-A-mutant-6 + | | | | | + | \-| | | /-A-mutant-9 + | | /-| /-| /-| + | | | | | | /-| \-recombinant + | | | | | | | | + | | | | /-| \-| \-A-mutant-8 + | | | | | | | +--| \-| | | | \-A-mutant-7 + | | \-| | + | | | \-A-mutant-5 + | | | + | | \-A-mutant-4 + | | + | \-A-mutant-2 + | + | /-B + | | + \-| /-B-mutant-1 + | | + \-| /-B-mutant-2 + | | + \-| /-B-mutant-3 + | | + | | /-B-mutant-4 + \-| | + | | /-B-mutant-9 + | | /-| + \-| /-| \-B-mutant-8 + | | | + | /-| \-B-mutant-7 + | | | + \-| \-B-mutant-6 + | + \-B-mutant-5 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1-phyml.ascii new file mode 100644 index 0000000..8657390 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-9 + | +--|--A-mutant-8 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + | /-recombinant + \-| + \-B-mutant-9 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1-phyml.newick new file mode 100644 index 0000000..6976a74 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.08550937,A-mutant-8:0.00000000,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000001,(A:0.00000000,(B:0.00852644,(B-mutant-1:0.00000000,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00000001,(B-mutant-5:0.00000001,(B-mutant-6:0.00000000,(B-mutant-7:0.01527110,(B-mutant-8:0.00000001,(recombinant:0.08470072,B-mutant-9:0.00000001)0.999999:0.05178694)0.999965:0.06041393)0.999999:0.07143861)1.000000:0.05179755)1.000000:0.06302902)1.000000:0.06215035)0.999998:0.04087081)0.999999:0.04121531)0.994704:0.03282554)1.000000:0.17757338)0.999974:0.06382395)1.000000:0.06272322)0.999994:0.04147295)1.000000:0.08635388)0.900907:0.01011054)1.000000:0.08646971)1.000000:0.06424838)1.000000:0.05295891); diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1-raxml.ascii new file mode 100644 index 0000000..e74576c --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-6 + | + | /-B-mutant-7 + |--| + | | /-B-mutant-8 + | \-| + | | /-B-mutant-9 +--| \-| + | \-recombinant + | + | /-B-mutant-5 + | | + | | /-B-mutant-4 + | | | + \-| | /-B-mutant-3 + | | | + | | | /-A-mutant-2 + | | | | + \-| | | /-A-mutant-9 + | | | /-| + | | | /-| \-A-mutant-8 + | | | | | + | | /-| /-| \-A-mutant-7 + | | | | | | + | | | | /-| \-A-mutant-6 + \-| | | | | + | | | /-| \-A-mutant-5 + | /-| | | | + | | | \-| \-A-mutant-4 + | | | | + | /-| | \-A-mutant-3 + | | | | + | | | \-A-mutant-1 + | /-| | + | | | \-A + | /-| | + | | | \-B + \-| | + | \-B-mutant-1 + | + \-B-mutant-2 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1-raxml.newick new file mode 100644 index 0000000..571c0a2 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1-raxml.newick @@ -0,0 +1 @@ +(B-mutant-6:0.000001,(B-mutant-7:0.015304,(B-mutant-8:0.000001,(B-mutant-9:0.000001,recombinant:0.084693)97:0.051787)100:0.060403)100:0.071411,(B-mutant-5:0.000001,(B-mutant-4:0.000001,(B-mutant-3:0.000001,((((((A-mutant-2:0.000001,((((((A-mutant-9:0.085503,A-mutant-8:0.000001)100:0.052954,A-mutant-7:0.000001)100:0.064237,A-mutant-6:0.000001)100:0.086463,A-mutant-5:0.000001)68:0.010111,A-mutant-4:0.000001)100:0.086356,A-mutant-3:0.000001)99:0.041481)99:0.062735,A-mutant-1:0.000001)100:0.063833,A:0.000001)100:0.177596,B:0.008525)95:0.032831,B-mutant-1:0.000001)99:0.041217,B-mutant-2:0.000001)97:0.040870)99:0.062150)100:0.063023)98:0.051798):0.0; diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1.fasta b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1.fasta new file mode 100644 index 0000000..114cfac --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-10A1-B1.fasta @@ -0,0 +1,42 @@ +>A +CGGGCTGGGGACCGCCGCCCGAGTTGCCTTGGGTAGCGTCCCGGACTTCCCCAATTTACTTCCGCGGCAGACCTAGCGTCCCATTAAACTGGAGGCGCAT +>A-mutant-1 +CGGGCTGGGGACCACCGCCCGAGTTGGCTTGGGTAGCGTCCCGGACTTCCCCTATTTACTTCCGCGGCAGACCTAGCGTCACATTAAACTTGAGGCACAT +>A-mutant-2 +CGGGCTGGGGACGACCGGCCGAGTTGGCATGGGTAGCGTCCCGGACTTCCCCTATTTTCTTCCGCGGCAGACCTAGCGTCTCATTAAACTTGAGGCACTT +>A-mutant-3 +TGGGCTGGGGACGACCGGCCGAGATGGCATGCGTAGCGTCCCGGACTTCCCCTATTTTCTTCCGCGGCAGACCTAGCGTCTCATTAAACTTGACGCACTT +>A-mutant-4 +TGGGCTGGGGAAGACCTGCCGAGATGGCATCCGTAACGTTCCGGATTTCCCCTATCTTCTTCCGCGGCAGACCTTGCGTCTCATTAAACTTGACGCACTT +>A-mutant-5 +TGGGCTGGGGAAGACCTGCCGAGATGGCATCCGTAACGTTCCGGATTTCCCCTATCTTCTACCGCGGCAGACCTTGCGTCTCATTAAACTTGACGCACTT +>A-mutant-6 +TCTCCTGGGGAAGTCCTGCCGAGATGACATCCGTAACGTTCCGGATTTCCCCTATCTGCTACCGCGGCAGACCTTGCGTCCCATTTAACTTGACGCACTT +>A-mutant-7 +TCTCCTGGGGAAGTCTTGCCTGGATGACATCCGTGACGTTCCGGATTTCACCTATCTGCTACCGCGGAAGACCTTGCGTCCCATTTAACTTGACGCACTT +>A-mutant-8 +CCTCCTGGGGGAGTCTTGACTGGATGACATCCGTGACGTTCCGGATGTCACCTATCTGCTACCGCGGAAGACCTTGTGTCCCATTTAACTTGACGCACTT +>A-mutant-9 +CCTCCAGGGAGAGTCTTGACTGGATGACATCCGTGACGTTCCGTATGCCACCTATCTGCTACCGCGGATGAGCTTGTGTACCATTAAACTTGACGCACTT +>B +CAGGCTGAGAACCGCCGCCCGAGTTGCCTTGGTTAGCGACCCGCAGGTCCCCAATTTGCTTCCGCGTCAGAGCTAGCGTCCCATTAAACTGGTGTCTGTT +>B-mutant-1 +CAGGCTGAGAACCGCCGTCCGAGTCGCTTTGGTTAGCGACCCGCAGGTCCCCAATTTGCTTCCGCGTCAGAGCTAGCGTCCCATTAAACTGGAGTCTGTT +>B-mutant-2 +CAGGCTGAGAACCGCCGTCCGAGTCGCTTTAGTTAGCGACCCGAAGGTCCCCAATATGCTTCCGCGTCAGAGCTAGCATCCCATTAAACTGGAGTCTGTT +>B-mutant-3 +CAGGCTGAGTACCGCCGTCCGAGTCGCTTTAGTTAGCGACCCGAAGGTCCCCAATATGCTTCAGCGTCAGAGCTACCATCTCATTAAACTGGAGTCTGTT +>B-mutant-4 +TAGGCTGGGTACCCCCGTCCGAGTCGCTTTAGTTAGCGACCGGATGCTCCCCAATATGCTTCAGCGTCAGAGCTACCATCTCATTAAACTGGAGTCTGTT +>B-mutant-5 +TAAGCTGGGTACCCCCGTCCGAGTCGCATTAGTTAGCGACCGGATGCTCCCCAATATGCTTCAGCGTCGGAGCTACCCTCTCGTTAAACTGGAGTATGTT +>B-mutant-6 +TAAGCTGGGTACCCCGGTCCGACTCGCATTAGTTAGCGACAGGATGCTCCCCAATATGCTTCAGCGTCGGAGCTGCCCTCTCGTTAAACCGGAGTATGTT +>B-mutant-7 +TAAGCTGGGTACCGCGGTCCGACTCGCCTTAGTTAGGAAGAGGATGCTCCCCAATATGCTTCAGCGTCGGAGCCGCGTTCTCGTTAAACCGGAGTATGTT +>B-mutant-8 +TAAGCTCCGTACCGCGGTCCGACTCGCCTTAGTTAGGAATAGGATGCTCCCCAATATGCTACAGCGTCGGAGCTGCATTCTCGTTAAGCCGGAGTATGTT +>B-mutant-9 +TAAGCTCCGTACCGCGGTCCGACTCGCTTTAGTTAGGAATAGGATGCTCCCCATTATGCTACATCGTCGGAGCTCCATTCTCGTTAAGCCGGAGTATGCT +>recombinant +CCTCCAGGGAACCGCGGTCCGACTCGCTTTAGTTAGGAATAGGATGCTCCCCATTATGCTACATCGTCGGAGCTCCATTCTCGTTAAGCCGGAGTATGCT diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1-phyml.ascii new file mode 100644 index 0000000..756f8f4 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-8 + | +--|--A-mutant-9 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + | /-B-mutant-9 + \-| + \-recombinant diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1-phyml.newick new file mode 100644 index 0000000..8c79970 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000001,A-mutant-9:0.04115498,(A-mutant-7:0.00000001,(A-mutant-6:0.01003848,(A-mutant-5:0.00000000,(A-mutant-4:0.00930096,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00992497,(A:0.00000000,(B:0.00000000,(B-mutant-1:0.00000000,(B-mutant-2:0.00000000,(B-mutant-3:0.00000000,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000000,(B-mutant-7:0.00000000,(B-mutant-8:0.00000000,(B-mutant-9:0.00000001,recombinant:0.11899544)0.999996:0.05108996)0.999973:0.03013474)1.000000:0.05091335)0.999997:0.04055720)1.000000:0.06191697)1.000000:0.06248221)0.999999:0.04126558)0.999999:0.04157741)1.000000:0.07365106)1.000000:0.18236428)0.990179:0.03131670)1.000000:0.06353275)0.999982:0.03075800)0.999992:0.04233195)1.000000:0.05321410)0.999990:0.04176276)0.999993:0.04185010)0.999999:0.05176768); diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1-raxml.ascii new file mode 100644 index 0000000..96da730 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-7 + | + | /-B-mutant-5 + | | + | | /-B-mutant-4 + | | | + | | | /-A + | | | | + | | | | /-A-mutant-2 + | /-| | | | + | | | | | /-| /-A-mutant-3 + | | | | /-| | | | + | | | | | | | \-| /-A-mutant-4 + | | | | | | | | | + | | | | | | | \-| /-A-mutant-5 + | | | | | | | | | + | | \-| | | | \-| /-A-mutant-6 + | | | | \-| | | + | | | /-| | \-| /-A-mutant-8 +--| | | | | | | /-| + | | | | | | \-| \-A-mutant-9 + |--| | | | | | + | | | | | | \-A-mutant-7 + | | | /-| | | + | | | | | | \-A-mutant-1 + | | | | | | + | | | /-| | \-B + | | | | | | + | | | | | \-B-mutant-1 + | | \-| | + | | | \-B-mutant-2 + | | | + | | \-B-mutant-3 + | | + | \-B-mutant-6 + | + | /-recombinant + | /-| + \-| \-B-mutant-9 + | + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1-raxml.newick new file mode 100644 index 0000000..a4aff40 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1-raxml.newick @@ -0,0 +1 @@ +(B-mutant-7:0.000001,((B-mutant-5:0.000001,(B-mutant-4:0.000001,(((((A:0.000001,((A-mutant-2:0.000001,(A-mutant-3:0.000001,(A-mutant-4:0.009307,(A-mutant-5:0.000001,(A-mutant-6:0.010039,((A-mutant-8:0.000001,A-mutant-9:0.041161)99:0.051774,A-mutant-7:0.000001)98:0.041854)98:0.041765)100:0.053218)100:0.042334)93:0.030760)100:0.063559,A-mutant-1:0.009920)95:0.031330)100:0.182546,B:0.000001)100:0.073681,B-mutant-1:0.000001)100:0.041584,B-mutant-2:0.000001)98:0.041274,B-mutant-3:0.000001)100:0.062501)100:0.061940)98:0.040566,B-mutant-6:0.000001)100:0.050927,((recombinant:0.119097,B-mutant-9:0.000001)100:0.051101,B-mutant-8:0.000001)93:0.030136):0.0; diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1.fasta b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1.fasta new file mode 100644 index 0000000..def112f --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-20A1-B1.fasta @@ -0,0 +1,42 @@ +>A +GCGATTACGTAATTTCTATTACTAGTGTGAGCAGATTTTAGTTATGGAAGCACGCGTTGGGTGTCGCCCATGACCAAGCTGTGTGTTTAGATGCTATAAG +>A-mutant-1 +GCGACTACTTAATTTCTATTACTAGTGTGAGCAGATTTTAGTTATTGAAGCACGCTTTGGGTGTCGCCCATGACCAAGCTGTGTGTTTAGATGCTATAAG +>A-mutant-2 +GCAACTACTTAATTTCTATTACTAGTGTGAGCCGATTTTTGTTATTGAAGCACGCGTGGGGTGTCGCCCATGACCAAGCTGTGGGTTTAGATGCTATAAC +>A-mutant-3 +GCAACTACTTAATTTCTATTAATAGTGTGCGCCGATTTTTGTTATTGAAGCACGCGTGGGGTGTCGCACATGACCAAGCTGTGGGTTTAGATGCTATAAC +>A-mutant-4 +ACTACTATTTAATTTCTATTAATAGTGTGCGCCGATTTTTGTTATTGAAGCACGCGTGGGCTGTCGCACAGGACCAAGCTGTGGGTTTAGATGCTATAAC +>A-mutant-5 +GCTGCTATTTAATTACTATTAATAGTGTGCTCCGATTTTTGTTATTGAAGCACGCGTGGGCTGTCTCACAGGACCAAGCTGTGGCTTTAGATGCTATAAC +>A-mutant-6 +GCTGCTATTTAATTACTATTAATAGTGTGCTTCGGTTTTTGTTATTGAAGCTCGCGTGGGCTGTCTCACAGGACCAAGCTGTGGCTTTAAATGCTAGAAC +>A-mutant-7 +GCTGCTATTTAATTACAATTAATAGTGTGCTTCGGTTTTTGTTATTGAAGCACGCGTCGGCTGTCTCACAGGACTAACCTGTGGCTTTAAATGCTAGAAC +>A-mutant-8 +GCTGCTATTTAATTACAATTAATAGTGTGGTTCGGTTCTTGTTATTCAAGCACGCGTCGGCTGTGTCACAGGACTAACCTGTGGCTTTAAATGCTAGAGC +>A-mutant-9 +GCTGCTATTTAATAACAATTAATAGTGTGGTTCGGTTATTGTTATTCAAGCACGCGTCAGCTGTGTCACGGGACTAACCTGTGGCTTTAAATGCTAGAGC +>B +GGGAATAAGTAATATTTATTACTAGTATAAGCAGATTTTAGTGATGGAAGCACGCGTTTGGTGTCGCCCATGTACGAGCGGCGTGTTTAGATGCTATGCG +>B-mutant-1 +GGGAATAAGTAATATTTATTACTAGTATAAGGAGATTTTAGTGATGGATGCACGCGATTGGTGTCGGCCATGTACGAGGGGCGAGTTTAGATGCTATGCA +>B-mutant-2 +GGGAATAAGTAATATTTATTACTAGTATAAGGAGATTTTAGTGATGGATGCAAGAGATTGGTGTCGGCGATGTACGAGGGACGAGTTTAGATGCTATGCA +>B-mutant-3 +GGGAATAAGTAATATTTATTACTAGTATAAGGAGATTTTAGTGATGGATGCAAGACATTGGTGCCGGCGATGTACGAGGGACGAGTTCGGATGCTATGCA +>B-mutant-4 +GGGAATAAGTAATATTTATTACTAGTATAAGGAGATTTTAGCGATGGATCCAAGACATTTGTGCCGGCGGTGTACTAGGGACGAGTGCGGATGCTATGCA +>B-mutant-5 +GGGAGTTAGTAATATTTATTGCTAGTATAAGGAGATTTTAGCGATGGATCCAAGACCTTTGTGCCGGCGGTGTACTAGAGACGAGTGCGGGTGCTATGCA +>B-mutant-6 +GGGAGTTAGTAATATTTGTTGCTAATATATGGAGATTTTAGCGATGGATCCAAGACCTTTGTGCCGGCGGTGTACTAGAGACGAGCGCGGGTGCTATGCA +>B-mutant-7 +GGGAGTCAGTAATATTTGTTGCTAATATGTGGAGATTTTAGCGATGGATCCAAGACCTTTGTGCCGACGGAGTATTAGAGACGAGCGCGGGTGCTATGCA +>B-mutant-8 +GGGAGTCAGTAATATTTGTTGCTAATATGTGGAAATTTCATCGATGGATCCAAGACCTTTGTGCCGACGGAGTATTAGAGACGAGCGCGGGTGCTATGCA +>B-mutant-9 +GGGAGTCAGTAATATTTGTTGCTAATATGTGGAAATTTCATCGATGGATCCAAGAGCTTTGTTCCGACGGAGTATTAGAGAGGAACACGGGTGCTATGCA +>recombinant +GCTGCTATTTAATAACAATTGCTAATATGTGGAAATTTCATCGATGGATCCAAGAGCTTTGTTCCGACGGAGTATTAGAGAGGAACACGGGTGCTATGCA diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1-phyml.ascii new file mode 100644 index 0000000..baebf56 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1-phyml.ascii @@ -0,0 +1,40 @@ + + /-A-mutant-9 + | +--|--A-mutant-8 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + | /-B-mutant-9 + \-| + \-recombinant diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1-phyml.newick new file mode 100644 index 0000000..e9678df --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.03094057,A-mutant-8:0.00000001,(A-mutant-7:0.00000000,(A-mutant-6:0.00000000,(A-mutant-5:0.00000001,(A-mutant-4:0.00000000,(A-mutant-3:0.00000001,(A-mutant-2:0.00000000,(A-mutant-1:0.00000001,(A:0.00058706,(B:0.00000001,(B-mutant-1:0.00000001,(B-mutant-2:0.00000001,(B-mutant-3:0.00000001,(B-mutant-4:0.00948283,(B-mutant-6:0.00000001,(B-mutant-7:0.00000001,(B-mutant-8:0.00000000,(B-mutant-9:0.00000000,recombinant:0.24259571)0.976205:0.02036718)1.000000:0.05186381)0.961473:0.02040011)1.000000:0.05304137)0.999933:0.04180312)1.000000:0.08506097)0.999990:0.05190635)0.999994:0.06299117)1.000000:0.21278223)1.000000:0.10859649)0.920990:0.01011082)1.000000:0.06312402)1.000000:0.06297645)0.999996:0.04138161)1.000000:0.05189430)0.999995:0.04129259)1.000000:0.07409176); diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1-raxml.ascii new file mode 100644 index 0000000..2d11517 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-4 + | + | /-A-mutant-3 + | | + /-| | /-A-mutant-2 + | | | | + | | | | /-B + | | | | | + | \-| | | /-B-mutant-1 + | | | | | + | | | /-| | /-B-mutant-7 + | | | | | | /-| + | | | | | | | | /-B-mutant-8 + | | | | | | | \-| + | \-| | | | | | /-recombinant + | | | \-| /-| \-| + | | | | | | \-B-mutant-9 + | | | | | | + /-| | | | /-| | /-B-mutant-5 + | | | /-| | | | \-| + | | | | | | | | \-B-mutant-6 + | | | | | | /-| | + | | | | | | | | \-B-mutant-4 + | | | | | \-| | + | | \-| | | \-B-mutant-3 + | | | | | + | | | | \-B-mutant-2 + | | | | +--| | | \-A + | | | + | | \-A-mutant-1 + | | + | \-A-mutant-5 + | + |--A-mutant-6 + | + | /-A-mutant-9 + | /-| + \-| \-A-mutant-8 + | + \-A-mutant-7 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1-raxml.newick new file mode 100644 index 0000000..c658d54 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1-raxml.newick @@ -0,0 +1 @@ +(((A-mutant-4:0.000001,(A-mutant-3:0.000001,(A-mutant-2:0.000001,(((B:0.000001,(B-mutant-1:0.000001,(((((B-mutant-7:0.000001,(B-mutant-8:0.000001,(recombinant:0.238604,B-mutant-9:0.000001)80:0.020223)86:0.051433)76:0.020284,(B-mutant-5:0.000001,B-mutant-6:0.000001)80:0.000001)86:0.052653,B-mutant-4:0.009333)74:0.041624,B-mutant-3:0.000001)86:0.084457,B-mutant-2:0.000001)85:0.051598)86:0.062626)94:0.207314,A:0.002770)86:0.105171,A-mutant-1:0.000001)56:0.010089)85:0.062643)88:0.062678)90:0.041142,A-mutant-5:0.000001)94:0.051581,A-mutant-6:0.000001,((A-mutant-9:0.030827,A-mutant-8:0.000001)94:0.073547,A-mutant-7:0.000001)92:0.041087):0.0; diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1.fasta b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1.fasta new file mode 100644 index 0000000..fe54aae --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-30A1-B1.fasta @@ -0,0 +1,42 @@ +>A +GATTAGAAGCGGCCTAGTATGGGTGACACTCTACATTAGTGGACAATAGGCTTGCCAGAGTGAGAGAACGCAACTCGCCGTCACCCCACGCTCAATCCTG +>A-mutant-1 +GATTAGAATCGGCCTAGTATGGGAGACATACTACATCAGTGGACGATAGGCTTGCCAGAGTGAGGGAACGCAACTCATCGTCACCCCACGCTCAAACCTG +>A-mutant-2 +GATTAGAATCGGCCTAGTATGGGAGACATACTACATCAGTGGACGATAGGCTTGCCAGAGTGAGGGAACGCAACTCATCGTCACCCCACGCTCAAACCTT +>A-mutant-3 +GATTAGAATCGGCCTAGTATGGGAGGCATACTCCATCAGTGGACGTTAGGCTTGCCAGAGTGAGGGAATGCAACTCATCGTCACCCCTCGCACAAACCTT +>A-mutant-4 +GATTAGAATCGGCCAAATATGGGAAGCGTACTCGATCAGTGGACGTTAGGCTTCCCAGAGTGAGGGAATGCAACTCATCGTCACCCCTCGCACAAACCTT +>A-mutant-5 +GATTAGAATCGGCCAAATATGGGAAGCGTACTCGATCAGTGGACGTTCGGCTTCCCAGACTGAGGGAATGCAACTCATTGTCACCCCTCGCACAAACCTG +>A-mutant-6 +GATTAGATTCGGCCATACATGGGAAGCGTACTCGATCAGTGGACGTCCGGCTTCCCAGACTGAGGGAATGCAACTCATTGTCACCCCACGCACAAACCTG +>A-mutant-7 +GATTAGATTCGGCCATACATGGGAAGCGTACGCGATCAGTGGACGTCGGGCTTCACATACTGAGGGAATGCAACTCATTGTCACCCCACGCACAAACCTG +>A-mutant-8 +GATTAGATTGGGCCATACATGGGAAGTGTACGCGATCGGTGGAGGTCGGGCATCACATACTGAGGGAATGCAACTCATTGTCACCCCACGCAGAAACATG +>A-mutant-9 +GATTAGATTGGGCCATACATGGGAAGTTTACGGGATCGGTGGATGTCGGGCATCACATACTGAGGGAATGCAACTCATTGTCACCCCACGCAGAAACATG +>B +GACCAGTAGCAGCCTAGTATGTGAGATGCTCTGCATTATTGGCCAATAGGCTTGCCAGAGTGAGAGCACGCAACTCGCCTTCACCCTAAGCTCGATACGG +>B-mutant-1 +GACCAGTAGCAGAGTCGTATGTGAGATGCTCTGCATTATTGGCCAATAGGCTTGGCAGAGTGAGAGCACGAAACTCGCCTTCACCCTAAGCTCGATACGT +>B-mutant-2 +GACCACTAGCCGAGTCGTATGTGAGATGCTCTGCACTATTGGCCAATAGGCTTGGCAGAGTGAGAGTACGAAACTCGCCTTCACCCTAAGCTCGATACCT +>B-mutant-3 +GACCACTAGCCGAGTCGTATGTGACATGCTCTGCACTATTGGCCAATAGGCTTGACCCAGTGAGAGTACGAAACTCACCTTCACCCTAGGCTCGATTCTT +>B-mutant-4 +GACCACTAGCCGAGTCCTCTGTGACATGCTCTGCACTATTGGCCAATAGGCTTCGCCCAGTGAGAGTACGAAACTCACCTTCACCCTAGGCTCGAATCTT +>B-mutant-5 +GACCACTAGCCGAGTCCTCTGTGACATGCTCTGGAATATTGGCCAATAGGCTTCACCCAGTGAGAGTACAAAACTAACCTTCACCCTAGGCTCGAATATT +>B-mutant-6 +GACCACTAGCCGAGTCCTCTGTGACATGCTCTGGAATATTGGCCAATAGGCTTCACCCAGTGAGAGTACAAAACTAACCTTCACCCTAGGCTCGAATATT +>B-mutant-7 +GACCACTAGCCGAGTCTTCTGTGACATGCTCTGGAATATTGGCCAATAGGCTTCACCCAGTGAGAGTACAAAACTAACCTTCACCCTAGGCTCGAAGATT +>B-mutant-8 +GACCAGTAGCCGAGTCTTCTGTGACATGCTCTGGAATATTCGCCAATAGGCTTCACCCAGTCAGACTACAAAACTAACCTTCACCCTAGGCTCGAACATT +>B-mutant-9 +GACCAGTAGCCGAGTCTTCTGTGACATGCTCTGGAATATTCGCCAATAGGCTTCACCCAGTCAGGCTACAAAACTAACATTCACCCTAGGCTCGAACATT +>recombinant +GATTAGATTGGGCCATACATGGGAAGTTTACTGGAATATTCGCCAATAGGCTTCACCCAGTCAGGCTACAAAACTAACATTCACCCTAGGCTCGAACATT diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1-phyml.ascii new file mode 100644 index 0000000..4597a4a --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-8 + | + | /-B-mutant-7 + |--| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-5 + | \-| + | | /-B-mutant-4 + | \-| + | | /-B-mutant-3 + | \-| + | | /-B-mutant-2 + | \-| + | | /-B-mutant-1 + | \-| + | | /-B + | \-| + | | /-A +--| \-| + | | /-A-mutant-1 + | \-| + | | /-A-mutant-2 + | \-| + | | /-A-mutant-3 + | \-| + | | /-A-mutant-4 + | \-| + | | /-A-mutant-5 + | \-| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-7 + | \-| + | | /-A-mutant-8 + | \-| + | \-A-mutant-9 + | + | /-recombinant + \-| + \-B-mutant-9 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1-phyml.newick new file mode 100644 index 0000000..5c2542a --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000001,(B-mutant-7:0.00000001,(B-mutant-6:0.00000001,(B-mutant-5:0.00000001,(B-mutant-4:0.00000001,(B-mutant-3:0.00000000,(B-mutant-2:0.00000000,(B-mutant-1:0.00000001,(B:0.00000000,(A:0.00000001,(A-mutant-1:0.00000000,(A-mutant-2:0.00000000,(A-mutant-3:0.00000001,(A-mutant-4:0.00000000,(A-mutant-5:0.00000000,(A-mutant-6:0.00000001,(A-mutant-7:0.00000000,(A-mutant-8:0.00000000,A-mutant-9:0.06274965)1.000000:0.07406722)0.995647:0.03081340)0.999938:0.03090290)0.999940:0.03100457)1.000000:0.05292865)0.998713:0.03116569)0.942369:0.01024073)1.000000:0.10938388)1.000000:0.21234963)0.977660:0.02022765)1.000000:0.05214909)0.999985:0.04139760)0.998969:0.03079000)0.999999:0.04127186)0.999999:0.05163314)1.000000:0.07423395)1.000000:0.06216099,(recombinant:0.25711378,B-mutant-9:0.00882018)0.650433:0.02163872); diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1-raxml.ascii new file mode 100644 index 0000000..dc888b7 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-1 + | + | /-A-mutant-2 + /-| | + | | | /-A-mutant-6 + | | | | + | | | /-| /-A-mutant-9 + | \-| | | /-| + | | | \-| \-A-mutant-8 + | | /-| | + /-| | | | \-A-mutant-7 + | | | /-| | + | | | | | \-A-mutant-5 + | | \-| | + | | | \-A-mutant-4 + /-| | | + | | | \-A-mutant-3 + | | | + /-| | \-A + | | | + | | \-B + | | + | \-B-mutant-1 + | +--|--B-mutant-2 + | + | /-B-mutant-3 + | | + | | /-B-mutant-5 + | | | + \-| /-| /-B-mutant-6 + | | | | + | | \-| /-B-mutant-7 + | | | | + | | \-| /-recombinant + \-| | /-| + | \-| \-B-mutant-9 + | | + | \-B-mutant-8 + | + \-B-mutant-4 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1-raxml.newick new file mode 100644 index 0000000..b304028 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1-raxml.newick @@ -0,0 +1 @@ +(((((A-mutant-1:0.000001,(A-mutant-2:0.000001,((((A-mutant-6:0.000001,((A-mutant-9:0.062508,A-mutant-8:0.000001)98:0.073673,A-mutant-7:0.000001)89:0.030787)82:0.030858,A-mutant-5:0.000001)91:0.030969,A-mutant-4:0.000001)97:0.052655,A-mutant-3:0.000001)94:0.031054)56:0.010224)98:0.108233,A:0.000001)99:0.208030,B:0.000001)85:0.020228,B-mutant-1:0.000001)94:0.052018,B-mutant-2:0.000001,(B-mutant-3:0.000001,((B-mutant-5:0.000001,(B-mutant-6:0.000001,(B-mutant-7:0.000001,((recombinant:0.251085,B-mutant-9:0.009009)52:0.021442,B-mutant-8:0.000001)81:0.062018)90:0.073895)92:0.051551)91:0.041219,B-mutant-4:0.000001)93:0.030775)94:0.041324):0.0; diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1.fasta b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1.fasta new file mode 100644 index 0000000..9f054b3 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-40A1-B1.fasta @@ -0,0 +1,42 @@ +>A +TGGTTGCATTTGCCTGACGGCCCTTCCAGTAAGATTGCGATGCGTTGGGCCTACGTGAAACTTCCGAAGTCCCGTGCAGGGGTGCACACCACAGTTTACC +>A-mutant-1 +AGGTTGCCTTTGCCTGACTGCCCTTCCAGTAAGGTAGCGATGCGTTGGGCCTCCGTGAAACTTCCGAAGGCCCGTGCAGGGGTGCATACCACAGTATTCC +>A-mutant-2 +AGGTTGCCTTTGCCTGACTGCCCTTCCAGTAAGGTAGCGATGCGTTGGGCCTCCGTGAAACTTCCGAAGGCCCGTGCAGGGGTGCATACGACAGTATTCC +>A-mutant-3 +AGGTTGCCTTTGCCTGACTGCCCTTACAGTAAGGTAGCGATGCGTTGGGCCTCCGTGAAACTTCCGAAGGCCCGTGCAGGGGTGTATACGACAGGATTCC +>A-mutant-4 +AGGTTGCCTTTGCCCGACTGCCCTTACAGTAAGGTAGCGATGCGTTGGACCTCCATGAAACTTCCGAAGGCCCGGGCAGGGGTGGATACGACAGGATTCC +>A-mutant-5 +AGGTTGCCTTTGACCGACTGCCCTTACAGTAAGCTAGCGATGCGTTGGACCTCCATGAAACTTCCGAAGGCCCGGGCAGGGGTGGATACGACAGGATTCA +>A-mutant-6 +AGGTTGCCTTTGAACGACTGCCCTTACAGTAAGCTAGCGATGCGTTGGACCTCCATGAAACTTCCGAAGGCCCGGGCAGGCGGGGATACGACAGGATTCA +>A-mutant-7 +AGGTTGCCTTTGAACGACTGCCCTTACAGTAAGGTAGCGATTCGTTGGACCTCCATGAAACTTCAGAAGGCCCGGGCAGGCGGGGATACGACAGGATTCA +>A-mutant-8 +AGGTTGCCTTAGAACGACTGCCCTTACAGTAAGACATCGATTCGTTGGACCTCCATGAAACTTCAGAAGGCTCGGTCAGGCGGGGATGCGACAGGATTCA +>A-mutant-9 +AGGTTGCCTTAGAACGACTGCGCTTACAGTGAGACATCGCCTCGTTAGACCTCCATGAAACTTCAGAAGGCTCGGTCAGGCGGGGATGCTACAGGATTCA +>B +TGGATGCATATGCCTGGCGGCTCATCCAGTAAGACTTCGATGCGCTATGCCGACGTGAATATTCCGAAGTCCTGTGCACGGGTGCTCACCACAGATAACC +>B-mutant-1 +TGGATGCATATGCCTGGCGGCTCATCCAGTAAGACTTCGATGCGCTATGCCGACGCGAATATTCCGAAGTCCTGTGCACGGGTGCTCACCCCAGATAACC +>B-mutant-2 +TGGATGCATATGCCTGGCGGCTCATCCGGTAAGACTTCGATGCGCTATGCCGACGCGAAAATTCGGAAGTCCTATGCACGGGTGCTCCCCCCAGATAACC +>B-mutant-3 +TGGATGCATTTGCCTGGCGGCTCATCCGGTAAGACTTCTATGCGCTATGCCGACGCGAAAATTCGGAAGTGCTAAGCACGGGTGCTCCCCCCAGATAACC +>B-mutant-4 +TGGATGCATCTGCCTGGCGGCTCATCCGGTAAGACTTCTATGCGCCATGCAGACGCGAAAATTCGGAAGTGCTAAGCACGGGTGCTCCCCCCAGATAACC +>B-mutant-5 +TGGATGCATCTGCCTGGCGGCTCATACGGTAAGACTTCTTTGCGCCATGCAGACGCGAAAATTCGGAAGTTCTAAGCACGGGTGCTCCCCCCAGATAAGC +>B-mutant-6 +TGGATGCAACTGCCTGGCGGCTCATACGGGAAGAATTCTTTGCGCCATGCAGACGCGAAAATTCGGAAGTTCTACGCAAGGGTGCTCCCCCCAGATAAGC +>B-mutant-7 +TGGATGCAATTGCCTGGCGGCTCATACGGGAAGAATTCTTTGCACCATGCACAGGAGAAAATTCGGAAGTTCTCCGCAAGGGTGCTCCCCCCGGATAAGC +>B-mutant-8 +TGCCTGCAATTGCCTGGCGGCACATAAGGGAAGAATTCTTTGCAAAATGCACAGGAGAAAATTCGGAAGTTCTCCGCAAGGGTGCTCCCCCCGGATAAGC +>B-mutant-9 +TGCCTGCAATTGCCTGGCGGCACATGAGGGAAGAATTCTTTGCGAAATGCACAGGAGAAAATTCGGAAGTTCTCCGCAAGGGTGCTCCCCGCGGATAAGC +>recombinant +AGGTTGCCTTAGAACGACTGCGCTTACAGTGAGACATCGCTGCGAAATGCACAGGAGAAAATTCGGAAGTTCTCCGCAAGGGTGCTCCCCGCGGATAAGC diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1-phyml.ascii new file mode 100644 index 0000000..85da46e --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-9 + | +--|--A-mutant-8 + | + | /-A-mutant-7 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-1 + \-| + | /-A + \-| + | /-B + \-| + | /-B-mutant-1 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-7 + \-| + | /-B-mutant-8 + \-| + | /-B-mutant-9 + \-| + \-recombinant diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1-phyml.newick new file mode 100644 index 0000000..0f026ba --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-9:0.03096343,A-mutant-8:0.00000001,(A-mutant-7:0.00000001,(A-mutant-6:0.00000000,(A-mutant-5:0.00000000,(A-mutant-4:0.00000000,(A-mutant-3:0.00000001,(A-mutant-2:0.00000000,(A-mutant-1:0.00977119,(A:0.00839668,(B:0.00000001,(B-mutant-1:0.00000001,(B-mutant-2:0.00000001,(B-mutant-3:0.00000000,(B-mutant-4:0.00000001,(B-mutant-5:0.00000001,(B-mutant-6:0.00000000,(B-mutant-7:0.00000000,(B-mutant-8:0.00000000,(B-mutant-9:0.00000001,recombinant:0.34691240)0.808601:0.04104847)1.000000:0.06329977)0.999929:0.03070391)1.000000:0.07418349)0.998131:0.02029375)1.000000:0.06297655)1.000000:0.06327802)0.997523:0.02038843)0.999195:0.04142587)1.000000:0.27784639)0.834703:0.02251225)0.999998:0.04167320)0.999988:0.04124095)1.000000:0.07431434)1.000000:0.06297253)0.999998:0.06255760)1.000000:0.08534065)0.998441:0.03093465); diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1-raxml.ascii new file mode 100644 index 0000000..98747e4 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-recombinant + /-| + | \-B-mutant-9 + | + |--B-mutant-8 + | + | /-B-mutant-6 + | | + | | /-B-mutant-5 + | | | + | | | /-B-mutant-3 + | /-| | | + | | | | | /-B-mutant-2 +--| | | | /-| | + | | | | | | | /-B-mutant-1 + | | | | | | | | + | | \-| | \-| | /-A + | | | | | | | + | | | | | | | /-A-mutant-5 + | | | | | | | /-| + | | | | | | | | | /-A-mutant-6 + | | | | \-| | | \-| + | | | | | | | | /-A-mutant-7 + | | | | | /-| /-| \-| + | | | | | | | | | | /-A-mutant-8 + \-| \-| | | | | | \-| + | | | | | /-| | \-A-mutant-9 + | | | | | | | | + | | | | | | | \-A-mutant-4 + | | \-| | /-| | + | | | | | | \-A-mutant-3 + | | | \-| | + | | | | \-A-mutant-2 + | | | | + | | | \-A-mutant-1 + | | | + | | \-B + | | + | \-B-mutant-4 + | + \-B-mutant-7 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1-raxml.newick new file mode 100644 index 0000000..08405dc --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1-raxml.newick @@ -0,0 +1 @@ +((recombinant:0.338153,B-mutant-9:0.000001)43:0.040864,B-mutant-8:0.000001,((B-mutant-6:0.000001,(B-mutant-5:0.000001,((B-mutant-3:0.000001,(B-mutant-2:0.000001,(B-mutant-1:0.000001,((A:0.008581,(((((A-mutant-5:0.000001,(A-mutant-6:0.000001,(A-mutant-7:0.000001,(A-mutant-8:0.000001,A-mutant-9:0.030829)78:0.030831)83:0.084682)83:0.062218)83:0.062469,A-mutant-4:0.000001)83:0.073709,A-mutant-3:0.000001)79:0.040964,A-mutant-2:0.000001)83:0.041392,A-mutant-1:0.009722)80:0.022191)85:0.270640,B:0.000001)54:0.041166)48:0.020275)55:0.062781)51:0.062532,B-mutant-4:0.000001)49:0.020201)51:0.073692)50:0.030602,B-mutant-7:0.000001)49:0.062921):0.0; diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1.fasta b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1.fasta new file mode 100644 index 0000000..8f5728a --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-50A1-B1.fasta @@ -0,0 +1,42 @@ +>A +CCATTTCGCGGGCAGGCAGCGAGATACCGTACTCTAAAGGCGTATAGATGACCGTAGGTCTAACTACAGTCGTGCCCGGGGATACCACAAGTTGCAGGAC +>A-mutant-1 +CCATTTCGCGGGCAGGCAGAGAGATACCGTACTCTAAAGGCGTATAGATGACCGTAGGTCTAACTACAGTCGTGCCCCGGTATACCACAAGTTGCAGAAC +>A-mutant-2 +CCATATCGCGGGCAGGCAGCGAGATACCGTACTCTAAAGGCGTATAGATGACCGAAGGTCGAACTACAGTCGTGCCCCGGTATGCCACAAGTTGCAGAAC +>A-mutant-3 +CCATATCGCGGGCAGGCAGCGAGAGACCGTACTCTAAAGGCGTATAGATGACCGAAGGTCGAACTACAATCGTGCCCCAGTATGCCACCAGTTGCAGAAC +>A-mutant-4 +CCATATCGCGGGCAGGCAGCGAGAGACCGTACCCGAAAGGCCTATAGATGACCGAAGGTCGAACTACAATCGTGCCCCAGTATACCCCCAGTTGCTGAAT +>A-mutant-5 +CCATATCGCGGGCAGGCAGCGAGAGACCGTACCCGAAAGGCCTATAGATGCCCGACGGTCGAACCACAATCGTGCACCAGTATACACACAGTTGCTGAAT +>A-mutant-6 +CCATATCGCGGGCAGGCAGGGAGAGACCGTAGGCGAAAGGCCTATAGATGCGGGACGGTCGAAGCACAATCGTGCACCAGTATACACACAGTTGCTGAAT +>A-mutant-7 +CCAAATCGCGGGCAGGCAGGGAGAGCCCGTAGGCGAAAGGCCTATAGTTGCGGGACGGTCGGAACACAATCGTGCACCAGTATACACACAGTAGGTGATT +>A-mutant-8 +CCAGCTCGCGGGCAGGCAGGGAGAGCCCGTAGGCGAAAGGCCCATAGTTGCGGGACGGTCGGAACACAATCGTGCACCAGTATACACACAGTAGGTGATT +>A-mutant-9 +CCGGCTCGCGGGCAGGCAAGGAGAGCCCGTAGGCGAAAGGCCCATAGTTGCGGGACGGTCGGAACACAATCGTGCACCAGTCTACACACAGTAGGTGATT +>B +CCGTTTCGTGTGCGGCCAACGTGATAACGTACTCTATTGGCGGCCACATGACCGTAGGTCTAACTACATTGGTTCCCCGGGACACGACAACTCGCGGGAC +>B-mutant-1 +CCGTTCCGTGTGCGGCCAACGTGATAACGTACTCTATTGGCCGCCACATGCCCGTAGGTCTAACTACATTGGTTCCCCGCGACACGACAACTCGCGGGAC +>B-mutant-2 +CCGTTCCGTGTGCGGCCAACGTGATAACCTACTCTATTGGCCGCCACATGCCCGTAGGGCTAACTACATTGGTTCCCCGCGACACGACAACTCGCGGGAC +>B-mutant-3 +CCGTTCCGTGGGCGGCCAACGTCATAACCTACGCTATTGGCCGCCACATGCCCGTAGTGCTAACTACATTGGTTCCCCGCGACACCACAACTCGAGGGAC +>B-mutant-4 +CCGTTAGGTGGACGGCCAACGTCTTAACCTACGCTATTGACCGCCACATGCCCGTAGTGCTAACTACATTGGTTCACCGCGACACCACAACTCGAGGGAC +>B-mutant-5 +CCGTTAGGTGGACGGCCAACGTCTTAACCTATGCTATTGACCGCCACATGCCCGTAGTGCTAACTACATTGGTTCAGCGCGACACCACAACTCGAGGGAC +>B-mutant-6 +CCGGTTGGGGGACGGCCATCGTCTTAACCTATGCTACTGACCGCCACATGCCCGTAGTGCTAAATACATTGGTTCAGCGCGACACCACAACTCGAGGGTC +>B-mutant-7 +CCGGTTGGGAGACGGCCATCGGCTTAACCTATGCTACTGACCGCCACATGCCCGTAGTGCTAAATACATTGGTTCAGCGCGACACCTCAACTCGAGGGTC +>B-mutant-8 +CCGGTTGGGAGACGGCAATCGGCTTAACCTATGCCACTGACCGCCACATGTCCGTAGTGCTAAATACATTGGTTCAGTGCGACAACTCAACTCGAGGTTC +>B-mutant-9 +CCGGATAGGAGACGGCAATCGGCTTGACCTATGCCACTGACCGCCACATGTCCGTAGTGCTAAATACATTGGTTCAGTGCGACAACTCATCTCGAGGTTC +>recombinant +CCGGCTCGCGGGCAGGCAAGGAGAGCCCGTAGGCGAAAGGCCCATAGTTGTCCGTAGTGCTAAATACATTGGTTCAGTGCGACAACTCATCTCGAGGTTC diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1-phyml.ascii new file mode 100644 index 0000000..1b70594 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-8 + | + | /-A-mutant-7 + |--| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-5 + | \-| + | | /-A-mutant-4 + | \-| + | | /-A-mutant-3 + | \-| + | | /-A-mutant-2 + | \-| + | | /-A-mutant-1 + | \-| + | | /-A + | \-| + | | /-B +--| \-| + | | /-B-mutant-1 + | \-| + | | /-B-mutant-2 + | \-| + | | /-B-mutant-3 + | \-| + | | /-B-mutant-4 + | \-| + | | /-B-mutant-5 + | \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-8 + | \-| + | \-B-mutant-9 + | + | /-recombinant + \-| + \-A-mutant-9 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1-phyml.newick new file mode 100644 index 0000000..5739161 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000000,(A-mutant-7:0.00000001,(A-mutant-6:0.00000001,(A-mutant-5:0.01161236,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,(A:0.00659589,(B:0.01010709,(B-mutant-1:0.00000000,(B-mutant-2:0.00000000,(B-mutant-3:0.00990012,(B-mutant-4:0.00000000,(B-mutant-5:0.00000001,(B-mutant-6:0.00000000,(B-mutant-7:0.00000001,(B-mutant-8:0.00000000,B-mutant-9:0.02039047)0.999999:0.04142648)0.999799:0.03090588)1.000000:0.09782820)1.000000:0.07419512)0.995843:0.02056636)0.999940:0.03109311)1.000000:0.05215495)0.677806:0.01010630)1.000000:0.15218509)0.999993:0.06726496)1.000000:0.07444056)1.000000:0.08551443)0.999780:0.03059665)0.999999:0.06253598)0.999998:0.06284427)0.999996:0.05191282)0.999945:0.03073381,(recombinant:0.32582454,A-mutant-9:0.00755685)0.938777:0.03364222); diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1-raxml.ascii new file mode 100644 index 0000000..87b431e --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-7 + | + | /-A-mutant-6 + | | + | | /-A-mutant-5 + | | | + | | | /-A-mutant-3 + | | | | + |--| | | /-A + | | | | | + | | | | | /-B + | | | | /-| | + | | | | | | | /-B-mutant-2 + | | | | | | | /-| + | \-| | | | | | | /-B-mutant-3 + | | | | \-| | \-| + | | /-| | | | | /-B-mutant-4 + | | | | | | | \-| +--| | | | | | | | /-B-mutant-5 + | | | | | | | \-| + | | | | /-| \-| | /-B-mutant-6 + | | | | | | | \-| + | | | | | | | | /-B-mutant-7 + | | | | | | | \-| + | | | | | | | | /-B-mutant-8 + | \-| | | | | \-| + | | \-| | | \-B-mutant-9 + | | | | | + | | | | \-B-mutant-1 + | | | | + | | | \-A-mutant-1 + | | | + | | \-A-mutant-2 + | | + | \-A-mutant-4 + | + | /-A-mutant-8 + \-| + | /-recombinant + \-| + \-A-mutant-9 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1-raxml.newick new file mode 100644 index 0000000..bfcf8c6 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1-raxml.newick @@ -0,0 +1 @@ +(A-mutant-7:0.000001,(A-mutant-6:0.000001,(A-mutant-5:0.011806,((A-mutant-3:0.000001,(((A:0.007401,(B:0.010070,((B-mutant-2:0.000001,(B-mutant-3:0.009936,(B-mutant-4:0.000001,(B-mutant-5:0.000001,(B-mutant-6:0.000001,(B-mutant-7:0.000001,(B-mutant-8:0.000001,B-mutant-9:0.020460)89:0.041415)86:0.030905)89:0.096909)86:0.073555)71:0.020450)83:0.030871)86:0.051702,B-mutant-1:0.000001)62:0.010083)90:0.147878)84:0.065721,A-mutant-1:0.000001)86:0.073439,A-mutant-2:0.000001)86:0.084067)80:0.030303,A-mutant-4:0.000001)79:0.061531)72:0.061619)51:0.051201,(A-mutant-8:0.000001,(recombinant:0.309565,A-mutant-9:0.008083)36:0.032669)40:0.030390):0.0; diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1.fasta b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1.fasta new file mode 100644 index 0000000..61dab4b --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-60A1-B1.fasta @@ -0,0 +1,42 @@ +>A +CCAGAAGTAACGGTACAAGCTAAGGAGACCTTAAAGCGTCATGGGAATTTATATCTAGATGACCTTAACGCAGCAACTGTAAGAAGGCGTGTTCGGCTCT +>A-mutant-1 +CCAGAAGTAACGGTACAAGCTAAGGAGACCTTAAACCGTCATGGGAATCGATACCTAGATGCCCTTAATGCAGCAACTGTAAGCAGGCGTGTTCGGCTCT +>A-mutant-2 +CCAGAGGTAACGGTACAAGCCAAGGAGACCTTAAACCGTCTTGGGAATCGATACGTAGATGCCCTAAATGCAGCAACTGTGAGCAGGCGTGTTGGGCTCT +>A-mutant-3 +CGAGGGCTAACGGTACGAGCCATGGAGACCTTAAACCGTCTTGAGAATCGATACGTAGATGCCCTGAATGCAGCAACTGTGAGCAAGCGTGTTGGGCTCT +>A-mutant-4 +CGAGGGCTAACGGTACGAGCCATGGAGACCTTCAACCGTCTTGAGAATCGATACGTAGATGCCCTGATTGCAGCAACTGTGAGCAAGCGTGTTGGGCTAT +>A-mutant-5 +CGAGGGCTAATGTTACGAGCCATTGAGACCTTCATTCGTCTTGAGAATCGATACGTAGAGGCCCTGATTGCAGCAACTGTGAGCAAGCGTGTTTGGCTAT +>A-mutant-6 +CGAGGGCTAAGGTGACGAGCCATGGAGAGCTTCATTCGACTTGAGAATCGATACGTAGAGGCCCTGATTGCAGCAACAGTGCGCAAGCGTGTTTGGCTAT +>A-mutant-7 +CGAGGGCTAAGGCGACGAGCCATGGAGAACTTCATTCGACTTGAGAATCGATACGTAGAGGCCCTGATTGCAGCAACAGTGCGCAAGCATGTGTGGCCAT +>A-mutant-8 +CGAGGGCTAAGGCGACGAGCAATGGAGAACTTCATTCGACTTGAGAATCGATATGTAGAGGCCCTGATTGCAGCAACAGTGCGCTAGCATGTGTGGCCAT +>A-mutant-9 +CGAGGGCTAAGGCGACGAGCAATGGAGAACTTCATTAGACTTGAGAATCCATATGTAGAGGCCCTGATTGCAGCAACAGTGCACTAGCATGTGTGACCAT +>B +CCAGAAGCAACAGTCCAAGCTCAGGAGCCGTTCAAGCGACATGGGAATTTACATCTAGTTGCCCTTAACGCAACAACTTCAAGAAGGCGGGTTCGGCTCT +>B-mutant-1 +CCAGAAGCAACAGTCCAAGCTCAGGAGCCGTTCAAGCGACATGGGAATTTACATCTAGTTGCCCTTAACTCAACAACTGCAAGAAGGCGGGTTCGGCTCT +>B-mutant-2 +CCAGAAGCAACAGTCCAAGCTCAGGAGCCGTTCAAGCGACATGGAAATTTACATCTACTTGCCCGTAACTTAACAACTGCAAGAAGGCGGGTTGGGCTCT +>B-mutant-3 +CCAGCAGCAACAGTCCAAGCTCAGGACCCGTTCAAGTGACATGGAAATTTACATCTACTTGCCCGTACCTTAACAACTGCAAGAAGGCGGGTTGGGCTCT +>B-mutant-4 +CCAGAAGCAACAGTACAAGCTCAGGACCCGTTCAAGTGACATGGAAATTTACATCTACTTTCCCGTACCTTAACAACTGCAAGAAGGCGGGTTGGGCTCT +>B-mutant-5 +CCAGAAGCAACACTACAAGCTCAGGGCCCATTCAAGTGACATGGAAATTTAAATATACTTTCCCGTACCTTAACATCTGCAAGAAGGCGGGTTGGACTCT +>B-mutant-6 +CCACAAGCAACTCTACAAGCTCAGAGCCCATTCAACTGACATGGAAATCTAAATATACTTACCCGAACCTTAAAATCTCCAAGAAGGCGGGTTGGACTCT +>B-mutant-7 +CCACAAGCAACTCAACAATCTCAGAGCCCATTCAACTGACGTGGAAATCTAAATATACTTACCCGAACCTTAAAATCTCCAAGAAGGCGGGTTGGACTCT +>B-mutant-8 +CCACAAGCAACTCAACAATCTCAGAGCAAATTCAACTGACGTGGAAATCTGAATATACTTACCCGCACCTTAAAATCTCCAAGAAGGCGGGTTGGACTCT +>B-mutant-9 +CCACAAGCAACTCAACAATCTCAGAGCAAATTCAACTGACGTGGAAATCTGAATATACTTACCCGCACCTTAAAATCTCCTAGAAGCCGGGTTGGACTCT +>recombinant +CGAGGGCTAAGGCGACGAGCAATGGAGAACTTCATTAGACTTGAGAATCCATATGTAGAGACCCGCACCTTAAAATCTCCTAGAAGCCGGGTTGGACTCT diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1-phyml.ascii new file mode 100644 index 0000000..8c8d2e4 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-8 + | +--|--B-mutant-9 + | + | /-B-mutant-7 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-1 + \-| + | /-B + \-| + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + | /-A-mutant-9 + \-| + \-recombinant diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1-phyml.newick new file mode 100644 index 0000000..e8f3855 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-8:0.00000000,B-mutant-9:0.05184967,(B-mutant-7:0.00000000,(B-mutant-6:0.00000001,(B-mutant-5:0.00000001,(B-mutant-4:0.00000001,(B-mutant-3:0.00000001,(B-mutant-2:0.00000001,(B-mutant-1:0.00000000,(B:0.00586153,(A:0.00000001,(A-mutant-1:0.00000000,(A-mutant-2:0.00969990,(A-mutant-3:0.00000000,(A-mutant-4:0.00000001,(A-mutant-5:0.00000001,(A-mutant-6:0.00000000,(A-mutant-7:0.00000000,(A-mutant-8:0.00000000,(A-mutant-9:0.03216750,recombinant:0.19933482)0.785105:0.01949368)1.000000:0.07366687)1.000000:0.07300329)0.997829:0.02005895)0.998774:0.03038054)0.999987:0.04089782)1.000000:0.05254185)0.999995:0.04237507)0.997542:0.04140946)1.000000:0.24099102)0.999996:0.08908109)1.000000:0.06195650)1.000000:0.05144103)1.000000:0.05141703)1.000000:0.06187557)1.000000:0.06178659)1.000000:0.05128694)1.000000:0.07319850); diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1-raxml.ascii new file mode 100644 index 0000000..73a445c --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B + | + | /-B-mutant-1 + | | + /-| | /-B-mutant-4 + | | | | + | | | | /-B-mutant-6 + | | | /-| | + | \-| | | /-| /-B-mutant-9 + | | | | | | /-| + | | | | | \-| \-B-mutant-8 + | | /-| \-| | + | | | | | \-B-mutant-7 + | | | | | + | \-| | \-B-mutant-5 + | | | + | | \-B-mutant-3 + | | +--| \-B-mutant-2 + | + |--A + | + | /-A-mutant-2 + | | + | | /-A-mutant-3 + | /-| | + | | | | /-A-mutant-6 + | | | | | + | | | | /-| /-A-mutant-8 + | | \-| | | /-| + | | | | | | | /-recombinant + | | | | \-| \-| + \-| | /-| | \-A-mutant-9 + | | | | | + | | | | \-A-mutant-7 + | \-| | + | | \-A-mutant-5 + | | + | \-A-mutant-4 + | + \-A-mutant-1 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1-raxml.newick new file mode 100644 index 0000000..7dfe8f9 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1-raxml.newick @@ -0,0 +1 @@ +((B:0.005964,(B-mutant-1:0.000001,(((B-mutant-4:0.000001,((B-mutant-6:0.000001,((B-mutant-9:0.051838,B-mutant-8:0.000001)100:0.073179,B-mutant-7:0.000001)100:0.051273)100:0.061776,B-mutant-5:0.000001)100:0.061861)100:0.051406,B-mutant-3:0.000001)97:0.051427,B-mutant-2:0.000001)99:0.061939)100:0.088948)100:0.240798,A:0.000001,((A-mutant-2:0.009691,(A-mutant-3:0.000001,(((A-mutant-6:0.000001,((A-mutant-8:0.000001,(recombinant:0.199231,A-mutant-9:0.032134)92:0.019509)100:0.073638,A-mutant-7:0.000001)100:0.072988)89:0.020056,A-mutant-5:0.000001)94:0.030374,A-mutant-4:0.000001)99:0.040889)99:0.052536)98:0.042378,A-mutant-1:0.000001)89:0.041407):0.0; diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1.fasta b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1.fasta new file mode 100644 index 0000000..2a7cf01 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-70A1-B1.fasta @@ -0,0 +1,42 @@ +>A +CCGATCGGCGCAAGGATTGTTTCATGTAACGGCGAGAAAAACACTCGGAGGAGGAGGCTTAAGCTGGCCCGCCCCAAGAAATACAGTTTTAATATCCCAA +>A-mutant-1 +ACGATCGGCGCAAGGATTGTTTGATGTAACGGCGAGAAAAACACTCTGAGGAGGAGGCTTAAGCTGGCCCGCCCCAAGAAATAGAGTTTTAATATCCCAA +>A-mutant-2 +ACGATCTGCGCAAGGATTGTTTGATGTAATGGCGAGAAGAACACTCTGAGGAGGAGGCTTAAGCTGGCCCGCCCCTTGAAATAGAGTTTTAATATCCCAA +>A-mutant-3 +ACGATCTGCGCAAGGCTTGTCTGATGTAACGGCGAGACGAACACTCTGAGGAGGAGGCTTAAGCTCGCCCGCCCCTTGAAATAGAGTTTCAATATCCCAA +>A-mutant-4 +ACGATCTGCGCAAGGCTTGTCTGATGCAACAGCGAGACGAACACTCTGAGGAGGAGGCTTAAGCTCGCGAGCCCCTTGAAATAGAGTTTCAATATCCCAA +>A-mutant-5 +ACGCTCTGCGCAACGCTTGTCTGATGCAACTGCGAGACGAACACTCTGAGGAGGAGGCTTAAGCTCGCGAGCCCCTTGAAATAGAGTTTCAATATCCCAA +>A-mutant-6 +ACGCTCTGCGCAACGCTTGTCTGATGCAACTGCGAGACGAACACTCTGAGGAGGAGGCTTAAGTTCGCGAGCCCCTGGAAATAGAGTTTCAATATCCCAA +>A-mutant-7 +ACGCTCTCTGCAAAGCTTGTCTGATGCAATTGCGATACGAACACTCTGAGGAGGAGGCTTAAGTTCGCGATCCCCTGGAAATAGAGTTTCAATTTCCCAA +>A-mutant-8 +ACGCAATCTGCAAAGCTTGTCTGATGCAATTGCGATACGGACACTCTGAGGAGGAGGCTTAAGTTCCAGTTCCCCTGGAAATAGAGTTTCAATTTCACAA +>A-mutant-9 +ACGCAATCTGCAAAGCTTGTCTGATGCAATTGCGATACGGACACTGTGAGAAGGAGGCTTAAGTTCCAGTTCCCCTGGAAATAGTGTCCCAATTTCACAA +>B +CTGATCGGCGCAAGGTGTCTTTCATTTATAGGCGATAAAAACACTCCGTTGCCGAGGCTTAAGCGAGCGCGCTCCTAGAGATACATATTTAATATCCCAA +>B-mutant-1 +TTCATCGGCGCACGGTGTTTTTCCTTTATAGGCGATAAAAACACTCCGTTGCCGAGGCTTGAGCGACCGCGGTCCTAGAGATACATTTTTAATATCCCAA +>B-mutant-2 +TTAATTGGCGCACGGTGTTATTCCTCTATAGGCGATAAAAACACTCCGTTGCCGAGGCTGGAGCGACCGCGGTCCTAGAGATGCATTTTTAATATCCCAA +>B-mutant-3 +ATAATTGGCGCACGGTGTTAGTCCTCTATAGGTGATAAAAACGCTCCGTTGCCGAGGCTGGAGCGACCGCGGTCCTAGAGAAGCATTTTTAATATCCCAA +>B-mutant-4 +ATAATTGGCGCACGGTGTTTGTCCTCTATAGGTGATAAAACGGCTCCGTTGCCGAGGCTGAAGCGACCGCGGTCCTAGTGAAGCATTTTTAATATCCCAA +>B-mutant-5 +ATGATTGGCGCACGGTGTTTGTCCTCTCTAGGTGATAAAACGGCTCCGTTGGCGAGGCTGAAGCGACCGCCGTCCCAGTGAAGCATTTTTAATATCACAA +>B-mutant-6 +ATGATTGGCGCACGGTGTGTGTCCTCTCTAGGTGATAAAACGGCTCGGTTGGCGAGGCTGAAGCGACCGCTGTCGCAGTTAAGCATTTTTAATGTCACAA +>B-mutant-7 +ATGATTGGCGCACGGTCTGTGTCCTCTCTAGTTGATAAAACGGCTCGGTTGGCGAGGCTGAAGCAACCGCTGTCGCAGGTAAGCATTTTTAATGTCAGAA +>B-mutant-8 +ATGATTGGCGCACGGTCAGTGTACTGTCTAGTTGATAAGACGGCTCGGTTGGCGAGGCTGAAGCAACCGCTGTCGCACGTAAGCATTTTTAAGGGCAGAA +>B-mutant-9 +ATGATTGGCGCACGGTCAGTGTACTGTCTAGTTGATAAGAGGGCTCGGTGGGCGGGACTGAAGCAATCGCTGTCGCACGTAAGCATTTTTAAGGGCAGAA +>recombinant +ACGCAATCTGCAAAGCTTGTCTGATGCAATTGCGATACGGACACTGTGAGAAGGAGGCTTAAGTTCCAGTTGTCGCACGTAAGCATTTTTAAGGGCAGAA diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1-phyml.ascii new file mode 100644 index 0000000..caaac6d --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-A-mutant-8 + | + | /-A-mutant-7 + |--| + | | /-A-mutant-6 + | \-| + | | /-A-mutant-5 + | \-| + | | /-A-mutant-4 + | \-| + | | /-A-mutant-3 + | \-| + | | /-A-mutant-2 + | \-| + | | /-A-mutant-1 + | \-| + | | /-A + | \-| + | | /-B +--| \-| + | | /-B-mutant-1 + | \-| + | | /-B-mutant-2 + | \-| + | | /-B-mutant-3 + | \-| + | | /-B-mutant-4 + | \-| + | | /-B-mutant-5 + | \-| + | | /-B-mutant-6 + | \-| + | | /-B-mutant-7 + | \-| + | | /-B-mutant-9 + | \-| + | \-B-mutant-8 + | + | /-A-mutant-9 + \-| + \-recombinant diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1-phyml.newick new file mode 100644 index 0000000..3d214e9 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1-phyml.newick @@ -0,0 +1 @@ +(A-mutant-8:0.00000000,(A-mutant-7:0.00000000,(A-mutant-6:0.00000001,(A-mutant-5:0.00907853,(A-mutant-4:0.00000000,(A-mutant-3:0.00000000,(A-mutant-2:0.00000000,(A-mutant-1:0.00000000,(A:0.00000001,(B:0.00608626,(B-mutant-1:0.00000000,(B-mutant-2:0.00000000,(B-mutant-3:0.00000001,(B-mutant-4:0.00000000,(B-mutant-5:0.00000000,(B-mutant-6:0.00000001,(B-mutant-7:0.00000001,(B-mutant-9:0.07371736,B-mutant-8:0.00000001)1.000000:0.08459990)1.000000:0.07357339)0.999998:0.04110575)0.997964:0.02023479)1.000000:0.07346164)1.000000:0.05227056)0.999999:0.04116184)0.999998:0.06702293)1.000000:0.16031757)1.000000:0.07339619)1.000000:0.05141082)1.000000:0.05172866)1.000000:0.09589750)0.999999:0.06400086)0.999999:0.05342558)0.999994:0.05191458)1.000000:0.07414088,(A-mutant-9:0.01914066,recombinant:0.11075078)0.999986:0.06518840); diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1-raxml.ascii new file mode 100644 index 0000000..167d0ec --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-6 + | + | /-B-mutant-5 + | | + | | /-B-mutant-2 + | | | + | | | /-A + /-| | | | + | | | | | /-A-mutant-2 + | | | | | | + | | | | | | /-A-mutant-3 + | | | | | /-| | + | | | | /-| | | | /-A-mutant-5 + | | | | | | | | | | + | | | /-| | | | \-| | /-A-mutant-8 + | \-| | | | | | | /-| /-| + | | | | | | | | | | | | /-A-mutant-9 + | | | | | | | | | | /-| \-| + | | | | | \-| | | | | | \-recombinant + | | | | | | \-| \-| | + | | | | /-| | | | \-A-mutant-7 + /-| | | | | | | | | + | | | | | | | | | \-A-mutant-6 + | | | /-| | | | | | + | | | | | | | | | \-A-mutant-4 + | | | | | \-| | | + | | | | | | | \-A-mutant-1 + | | | | | | | + | | \-| | | \-B + | | | | | +--| | | | \-B-mutant-1 + | | | | + | | | \-B-mutant-3 + | | | + | | \-B-mutant-4 + | | + | \-B-mutant-7 + | + |--B-mutant-9 + | + \-B-mutant-8 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1-raxml.newick new file mode 100644 index 0000000..669825c --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1-raxml.newick @@ -0,0 +1 @@ +(((B-mutant-6:0.000001,(B-mutant-5:0.000001,(((B-mutant-2:0.000001,(((A:0.000001,((A-mutant-2:0.000001,(A-mutant-3:0.000001,((A-mutant-5:0.009073,(((A-mutant-8:0.000001,(A-mutant-9:0.019120,recombinant:0.110800)94:0.065207)99:0.074143,A-mutant-7:0.000001)100:0.051912,A-mutant-6:0.000001)100:0.053432)99:0.064015,A-mutant-4:0.000001)100:0.095907)99:0.051731)100:0.051408,A-mutant-1:0.000001)99:0.073409)100:0.160386,B:0.006054)100:0.067052,B-mutant-1:0.000001)99:0.041155)100:0.052270,B-mutant-3:0.000001)100:0.073461,B-mutant-4:0.000001)88:0.020232)99:0.041103)100:0.073587,B-mutant-7:0.000001)100:0.084631,B-mutant-9:0.073746,B-mutant-8:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1.fasta b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1.fasta new file mode 100644 index 0000000..e229a49 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-80A1-B1.fasta @@ -0,0 +1,42 @@ +>A +GGGTTGGGGGGGTGGCGTCCGGCTGAATAAACGTCCTCTCGACAAGTCCCTACACTGTAACAATTTGAAGGCAATTATAATCCCCGCCATATATGAGCCC +>A-mutant-1 +GGGTGGGGGGGGCGGCGTCCGGCTGAATATACGTCTTCTCGACAAGTCCCTACACTGTAACAATTTGAAGGCAAATACAATCCCCCCCATATATGAGCCC +>A-mutant-2 +GGGTGGGGGGGGCGGCGTCCGGCTGAATATACGCCTTCTCTACAAGTCCCTACACTGTAACAATTTGAAGGCAAATGCCATCCCCCCCATATCTGAGCCC +>A-mutant-3 +GGGTGGGGGGGGCGGCGTCCGGCTGTATATACGCCTTCTGTATAAGTCCCTACACTGTAACAATTTGAAGGCAAATGCCATCCCCCCCGTATCTTAGCCC +>A-mutant-4 +GGGTGCAGGGTGCGGCGTCCGGCTTTATATAAGCCTTCTGTATAAGTCCCTACACTGTACCAATTTGAAGGCAAATGCCAGCTCCCCCGTACCTTAGCCC +>A-mutant-5 +GGCTGCAGGGTGCGGCGTTTGGCTTTATATAAGCCTTCTGTATAAGTCCCTACACTATATCAATTTGAAGGCAAATGCCAGCTCTCCCGTCCCTTAGCCC +>A-mutant-6 +GGCTGCAGGGTGCGGCGTTTGGCTTTATATAAGCGTTCTGTGTAAGCCCCTACACTGTATCAATTTGAAGGCAAATGCCATCTCTTCCGTCCCTTAGCCC +>A-mutant-7 +GGCTGCAGGGTGCGGCGTTTGGCTTTATATAAGCGTTCTGTGTAAGCCCATGCACTGTGTCAATTTGAAGGCAAATGCCATATATTCCGTCCCTTAGCCC +>A-mutant-8 +GGCTGCAGGGTGCGGCGTCTGGCTTTATCTACGCGTTCTGTGTAAGCGCATGCACTGTGTCAATTTGAAGGCAAATGCCATTTAGTCCGTCCCTTAGCAC +>A-mutant-9 +ACCTGCAGGGTGCGGCGTCTGGCTCTATCTACGGGTTCTGTGTAAGGGCATGCACTGTGTCGATTTGAAGGCAAATGCCATTTAGACCGTCCCTTGGCAC +>B +GGGCTGGGGGGTTTGCGTCCAGTTGGGTAAACGCCCTCTCGACGAGTCCTTACACTGTAAGAATTAGAAGGCATTGATAATCCCCGGCATATATGAGCCC +>B-mutant-1 +GGGCTGGGGGATTTTCATCCAGTTGGATAAGCGCCCTCTCGACGAGTCCTTACACTGTAAGAATTAGAAGGCATTGATAATCCCCGGCCTTTATGAGCCC +>B-mutant-2 +GGGCTGTGGGATTTTCATCCAGTTGGATAAGCGCCCTCTAGACGATTCCTCACACTGTAAGAATTAGAAGGCATTGATAATCCCCGGCCTTTATGAGCCC +>B-mutant-3 +GGGCTGTGGGATTTTCATGCAGTTGGAAAAGCGCCCTCTAGACGATTCCTCACACTGTAAGAATTAGATGGCATTGATAATCCCCTGCCTTTATGAGCCG +>B-mutant-4 +GGGCAGTGGGATTTCCATGCAGTTGGAAACGCGCCCTCTAGACGGTTCCTCAGACTATAAGAATTAGATGGCATTGATAATCCCCTGCCTTTATGAACCG +>B-mutant-5 +GGGCAGTGGGATTTCCATGCAGTTGGAAACGCGCCCTCTAGACGGTTCCTCAGACTATAAGAATTAGCTGGCATTGATAATCCCCTGCCTTCATGAACCG +>B-mutant-6 +GGGCAGTGGGATTTCCATGCAGTTGGAAACGCGCCCTCTAGACGGTTCCTCAGAATATAACAATTAGCTGTCATTGACAATCCCCTGCCTTCATGAACCG +>B-mutant-7 +GGGCAGTGGGATTTCCATGCAGTTGGAAACACGCCCTCTAGACGTGTCCTCAGAATATAACAATTACTTGTCATTGACAATCCCATGCCTTCATGAACCC +>B-mutant-8 +GGGCAGTAGGATTTCCATGCAGTTGGTAAAACGCCCTCTAGATATGTCCTCAGACTATAACAATTACTTGTCATAGACAATACCATGCCTTCATGAACCC +>B-mutant-9 +GGGCAGTAGGATTTCCATGCAGTTGCTAAAACGCCCTCTAGATATGTCCATTGACTATAACAATTACCTGTCATAGACGATACCATCCCTTCATGAACCC +>recombinant +ACCTGCAGGGTGCGGCGTCTGGCTCTATCTACGGGTTCTGTGTAAGGGCATGCACTGTGTCGATTTGAAGGCAAATGCCATACCATCCCTTCATGAACCC diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1-phyml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1-phyml.ascii new file mode 100644 index 0000000..4ca5bb0 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1-phyml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-9 + | +--|--B-mutant-8 + | + | /-B-mutant-7 + \-| + | /-B-mutant-6 + \-| + | /-B-mutant-5 + \-| + | /-B-mutant-4 + \-| + | /-B-mutant-3 + \-| + | /-B-mutant-2 + \-| + | /-B-mutant-1 + \-| + | /-B + \-| + | /-A + \-| + | /-A-mutant-1 + \-| + | /-A-mutant-2 + \-| + | /-A-mutant-3 + \-| + | /-A-mutant-4 + \-| + | /-A-mutant-5 + \-| + | /-A-mutant-6 + \-| + | /-A-mutant-7 + \-| + | /-A-mutant-8 + \-| + | /-recombinant + \-| + \-A-mutant-9 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1-phyml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1-phyml.newick new file mode 100644 index 0000000..0a6bd75 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1-phyml.newick @@ -0,0 +1 @@ +(B-mutant-9:0.07377491,B-mutant-8:0.00000000,(B-mutant-7:0.00000000,(B-mutant-6:0.00000000,(B-mutant-5:0.00000000,(B-mutant-4:0.00000000,(B-mutant-3:0.00000000,(B-mutant-2:0.00000000,(B-mutant-1:0.00000001,(B:0.00000001,(A:0.00000001,(A-mutant-1:0.00000001,(A-mutant-2:0.00000001,(A-mutant-3:0.00000001,(A-mutant-4:0.00000000,(A-mutant-5:0.00993603,(A-mutant-6:0.00000000,(A-mutant-7:0.00000000,(A-mutant-8:0.00000001,(recombinant:0.07361130,A-mutant-9:0.00000001)0.999996:0.04112592)1.000000:0.05139401)1.000000:0.08396001)0.999850:0.03075660)0.999951:0.03093956)1.000000:0.04107301)1.000000:0.04106647)0.999999:0.04091338)0.999995:0.05161431)1.000000:0.16734405)0.999997:0.05158584)0.999997:0.04121493)1.000000:0.07381041)1.000000:0.05199150)1.000000:0.05191248)1.000000:0.06279707)1.000000:0.05189641)1.000000:0.06272071); diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1-raxml.ascii b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1-raxml.ascii new file mode 100644 index 0000000..6964842 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1-raxml.ascii @@ -0,0 +1,42 @@ + + /-B-mutant-9 + /-| + /-| \-B-mutant-8 + | | + /-| \-B-mutant-7 + | | + | \-B-mutant-6 + | + | /-B-mutant-3 + | | + | | /-B-mutant-1 + | | | + | | | /-A + | | | | + | | | | /-A-mutant-1 + | | | | | + | | | /-| | /-A-mutant-3 + | /-| /-| | | | | + | | | | | | | | | /-A-mutant-6 + | | | | | | | | | | + | | | | | | \-| | | /-A-mutant-9 + | | | | | | | /-| /-| /-| +--| | | | | | | | | | | /-| \-recombinant + | | | | | | | | | | | | | + | | | | | | | | | /-| \-| \-A-mutant-8 + | | | | \-| | | | | | | + | | \-| | \-| | | | \-A-mutant-7 + |--| | | | \-| | + | | | | | | \-A-mutant-5 + | | | | | | + | | | | | \-A-mutant-4 + | | | | | + | | | | \-A-mutant-2 + | | | | + | | | \-B + | | | + | | \-B-mutant-2 + | | + | \-B-mutant-4 + | + \-B-mutant-5 diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1-raxml.newick b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1-raxml.newick new file mode 100644 index 0000000..2b6c6c3 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1-raxml.newick @@ -0,0 +1 @@ +((((B-mutant-9:0.073796,B-mutant-8:0.000001)99:0.062737,B-mutant-7:0.000001)98:0.051910,B-mutant-6:0.000001)100:0.062808,((B-mutant-3:0.000001,((B-mutant-1:0.000001,((A:0.000001,(A-mutant-1:0.000001,((A-mutant-3:0.000001,(((A-mutant-6:0.000001,(((A-mutant-9:0.000001,recombinant:0.073632)95:0.041128,A-mutant-8:0.000001)99:0.051397,A-mutant-7:0.000001)100:0.083976)93:0.030755,A-mutant-5:0.009937)97:0.030940,A-mutant-4:0.000001)98:0.041077)98:0.041070,A-mutant-2:0.000001)95:0.040915)98:0.051615)100:0.167449,B:0.000001)100:0.051586)99:0.041215,B-mutant-2:0.000001)100:0.073823)100:0.051994,B-mutant-4:0.000001)98:0.051922,B-mutant-5:0.000001):0.0; diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1.fasta b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1.fasta new file mode 100644 index 0000000..cdacf35 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/out1/recombinant-90A1-B1.fasta @@ -0,0 +1,42 @@ +>A +CCATTCTGTACGCAGTCCGCGCTCTACCTAGAGGGATTACGTCCACGTCGCTGCCAACCCGTTTGGGTTTTGTAGGATTTGTCACGCCCACTTGGAATTC +>A-mutant-1 +CGATTCTGTACGCAGTCCGCACTCTACCGAGAGGGATTACGTCCACGTCGCTGCCAACCCGTTTGGGTTTTGTAGGATTGGTCACGCCCACTTGGAATCC +>A-mutant-2 +CGATTCTGTATGCAGTCAGCACTCTACCGAGCGGGATTACGTCCACGTCGCTGCCAACCCGTTTGGGTTTTGTAGGATTGGTCACACCCACTTGGAATCC +>A-mutant-3 +CGATTCTGTATGCAGTCAGCACTCTACCGAGCGGGATTACCTCCACGCCGCTGCCAACCCGTTTGGGTTTTGTAGGATTTGTGACACCCACTTGGAATCC +>A-mutant-4 +CGATTCTGTATGCAGTCAGCACTCTACCGAGGGGCATTACCTCCACGCCGCTGCCAACCCGTTTGGGTTTTGTGGGATTTGTGACAACCACTTGGAATCC +>A-mutant-5 +CGATTCTGTATGCATTCAGCACTCTACCGAGGGGCATTACATCCACGCCGCTGCCACCCCGTTTGGGTTTTGTGGGATTTGTGACAACCACATGGAATCC +>A-mutant-6 +CGATTTTGTGTGCAGTCAGCACTCTACCGAGGGGCATTACATCCACGCCGCTGCCACCCCGTTTGGGTCTTGTGGGATTTGTGACAACCACATGGAATCC +>A-mutant-7 +CGATTTTGTGTGCGGTCAGCACGCAACCGAGGGACATTACATCCACGCCGCTGCTACTCCGTTTGGGTCTTGTGGGACTTGTGACAACTACATGGAATCC +>A-mutant-8 +CGACTTTGTGTGCGGTCAGCACGCAACCGAGGGACATTACATCCACGCCGCTGCTACTCCGCTTGGTTCTTGTGGGACTTGTGCCAACTACATGTAATCC +>A-mutant-9 +CGACGATGTGTGCGGTCAGCACGCAACCGAGGGACATTACCTCCACCCCGCTGCTACTCCGCTTGGTTCTTGTGGGACTTGTGCCAACTACATGTAATCC +>B +CCGTTCTGTACGCCGTCCGTGCTCAACCTAGAGCAATTACGTCCACGTCGCAGACAACCTGTTTGGGTTTTGTGGGATTTGTCACGCCTAGGTGGCATTG +>B-mutant-1 +CCGTTCTGTACGCCGTCAGTGCTCAACCTAGAGCAATTACGTCCCCGTCGCACACAACCTGTTTGGGTTTTGTGGGATTTGTCACCTCTAGGTGGCATTG +>B-mutant-2 +CCGTTCTGTACGCCGTCAGTGCTCAACCTACAGCAATTACATCCCCGTCGCACACAACCTGTTTGGTTTTTGTGGGATTTGACACCTCTAGGTGGCATTG +>B-mutant-3 +CCATTCTGTACGTCGTCCGTTCTGAACCTACAGCAATTACATCCCCGTCGCACACAACCTGTTTGGTTTTTATGGGATTTGACACCTCTAGGAGGCATTG +>B-mutant-4 +CCATTCTGTACGTCGTCCGTTCTGAGCCTACAGCAATTACATCCCCGTCGCACACAACGTATTTGGTTTTTATGGGATATGACACCCCTAGGAGGCATTG +>B-mutant-5 +CCATTCCGTACGTCGTCCGTTCTGAGCCTACAGCAATTACATCCCCGTCGCACACAACGTATTTGGGTTTTAAAGGATATGACACCCCTAGGAGGCATTT +>B-mutant-6 +CCATTCCATACGTCGTCCGTTCTGAGCCTACATCAATTACATCCCCGTCGCACACAACGTATTTGGGATTTAAAGGATATGAAAGCCCTAGGAGGTATTT +>B-mutant-7 +CCCTTCCATACGTCGTCAGTTCAGAGCCCACATCAATTACATCCCCGTCGCACACAACGTATCTGGGATTTAAAGGATATGAAAGCCCTAGGAGGTATTT +>B-mutant-8 +CCCTTCCCTACGTCGTCAGTTCAGAGCCCATATCAATTACATCCCCGTCCCACACAACTTATCTGGAATGTAAAGGATATGAAAGCCCTAGGAGGTATTT +>B-mutant-9 +CCCTTCCCTACGTCGGCAGTTCAGAGCCCATATCAATTCCAGCCCCGTCCCACACAACTTATCTGGAATGGAAAGGATATGAAAGCCATAGAACGTATTT +>recombinant +CGACGATGTGTGCGGTCAGCACGCAACCGAGGGACATTACCTCCACCCCGCTGCTACTCCGCTTGGTTCTTGTGGGACTTGTGCCAACTAGAACGTATTT diff --git a/recombinationgradients/recombinationgradient_A9B9/out1/recombinants_A9B9.png b/recombinationgradients/recombinationgradient_A9B9/out1/recombinants_A9B9.png new file mode 100644 index 0000000..0152d45 Binary files /dev/null and b/recombinationgradients/recombinationgradient_A9B9/out1/recombinants_A9B9.png differ diff --git a/recombinationgradients/recombinationgradient_A9B9/recombinant-10A1-B1.json b/recombinationgradients/recombinationgradient_A9B9/recombinant-10A1-B1.json new file mode 100644 index 0000000..eda9dd1 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/recombinant-10A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-9", + "start": 1, + "length": 10 + }, + { + "from id": "B-mutant-9", + "start": 11, + "length": 90 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A9B9/recombinant-20A1-B1.json b/recombinationgradients/recombinationgradient_A9B9/recombinant-20A1-B1.json new file mode 100644 index 0000000..83fbd89 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/recombinant-20A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-9", + "start": 1, + "length": 20 + }, + { + "from id": "B-mutant-9", + "start": 21, + "length": 80 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A9B9/recombinant-30A1-B1.json b/recombinationgradients/recombinationgradient_A9B9/recombinant-30A1-B1.json new file mode 100644 index 0000000..201edff --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/recombinant-30A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-9", + "start": 1, + "length": 30 + }, + { + "from id": "B-mutant-9", + "start": 31, + "length": 70 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A9B9/recombinant-40A1-B1.json b/recombinationgradients/recombinationgradient_A9B9/recombinant-40A1-B1.json new file mode 100644 index 0000000..638cdc2 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/recombinant-40A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-9", + "start": 1, + "length": 40 + }, + { + "from id": "B-mutant-9", + "start": 41, + "length": 60 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A9B9/recombinant-50A1-B1.json b/recombinationgradients/recombinationgradient_A9B9/recombinant-50A1-B1.json new file mode 100644 index 0000000..66b7c07 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/recombinant-50A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-9", + "start": 1, + "length": 50 + }, + { + "from id": "B-mutant-9", + "start": 51, + "length": 50 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A9B9/recombinant-60A1-B1.json b/recombinationgradients/recombinationgradient_A9B9/recombinant-60A1-B1.json new file mode 100644 index 0000000..f1c7dff --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/recombinant-60A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-9", + "start": 1, + "length": 60 + }, + { + "from id": "B-mutant-9", + "start": 61, + "length": 40 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A9B9/recombinant-70A1-B1.json b/recombinationgradients/recombinationgradient_A9B9/recombinant-70A1-B1.json new file mode 100644 index 0000000..3d9567e --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/recombinant-70A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-9", + "start": 1, + "length": 70 + }, + { + "from id": "B-mutant-9", + "start": 71, + "length": 30 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A9B9/recombinant-80A1-B1.json b/recombinationgradients/recombinationgradient_A9B9/recombinant-80A1-B1.json new file mode 100644 index 0000000..0ce6d4f --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/recombinant-80A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-9", + "start": 1, + "length": 80 + }, + { + "from id": "B-mutant-9", + "start": 81, + "length": 20 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A9B9/recombinant-90A1-B1.json b/recombinationgradients/recombinationgradient_A9B9/recombinant-90A1-B1.json new file mode 100644 index 0000000..25d4240 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/recombinant-90A1-B1.json @@ -0,0 +1,58 @@ +{ + "variables": { + "length": 100, + "root to AB rate": 0.1, + "mutant rate": 0.05, + "mutant count": 9 + }, + "sequences": [ + { + "id": "root", + "length": "%(length)d", + "skip": true + }, + { + "id": "A", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "A", + "id prefix": "A-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "B", + "from id": "root", + "length": "%(length)d", + "mutation rate": "%(root to AB rate)f" + }, + { + "from id": "B", + "id prefix": "B-mutant-", + "length": "%(length)d", + "count": "%(mutant count)d", + "mutation rate": "%(mutant rate)f", + "ratchet": true + }, + { + "id": "recombinant", + "sections": [ + { + "from id": "A-mutant-9", + "start": 1, + "length": 90 + }, + { + "from id": "B-mutant-9", + "start": 91, + "length": 10 + } + ] + } + ] +} diff --git a/recombinationgradients/recombinationgradient_A9B9/recombinant_gradient.py b/recombinationgradients/recombinationgradient_A9B9/recombinant_gradient.py new file mode 100755 index 0000000..7c3ef25 --- /dev/null +++ b/recombinationgradients/recombinationgradient_A9B9/recombinant_gradient.py @@ -0,0 +1,52 @@ +#!/usr/bin/env python + +from ete3 import Tree +from argparse import ArgumentParser +import matplotlib.pyplot as plt +import seaborn + +def rec_parentdistance(newickfile): + + with open(newickfile) as f: + name = f.name + print('Analysing sample:', name) + treedata = f.read() + treedata = treedata.strip() + t = Tree(treedata) + + # Reroot the tree. + midpoint = t.get_midpoint_outgroup() + t.set_outgroup(midpoint) + print(t) + + # Find distance from recombinant to A9 + A9distance = t.get_distance("recombinant", "A-mutant-1") + B9distance = t.get_distance("recombinant", "B-mutant-9") + + return(A9distance, B9distance) + + print('\n') + +parser = ArgumentParser() +parser.add_argument('fname', nargs='+', action='append', metavar='FILE', help='Newick file to analyse.') +args = parser.parse_args() + +A9_distances = [] +B9_distances = [] +filenames = args.fname +for filename in filenames[0]: + recdistances = rec_parentdistance(filename) + A9_distances.append(recdistances[0]) + B9_distances.append(recdistances[1]) + +listemitxwerten = [10, 20, 30, 40, 50, 60, 70, 80, 90] +plt.figure() +plt.plot(listemitxwerten, A9_distances, label="A9") +plt.plot(listemitxwerten, B9_distances, label="B9") +plt.title("Recombinant from A9 and B9 (a gradient of percentages)") +plt.xlabel("Percentage of recombinant from A9 (from B9=100-A9)", fontsize=14) +plt.ylabel('Distance to recombinant', fontsize=14) +plt.legend(fontsize=12) +plt.tight_layout() +plotpath = 'recombinants_A9B9.png' +plt.savefig(plotpath, dpi=300) \ No newline at end of file