diff --git a/conf/modules.config b/conf/modules.config
index cd02ec98..1fe1acbe 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -32,149 +32,151 @@ process {
/////////////
// FASTQC
-if (!params.skip_qc && !params.skip_fastqc) {
- process {
- withName: '.*:FASTQC_NANOPLOT_PRE_TRIM:FASTQC' {
- ext.prefix = { "${meta.id}.raw" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/qc/fastqc/pre_trim" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+process {
+ withName: '.*:FASTQC_NANOPLOT_PRE_TRIM:FASTQC' {
+ ext.prefix = { "${meta.id}.raw" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/qc/fastqc/pre_trim" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_fastqc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
]
- }
+ }
+}
- if (!params.skip_trimming) {
- withName: '.*:FASTQC_NANOPLOT_POST_TRIM:FASTQC' {
- ext.prefix = { "${meta.id}.trimmed" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/qc/fastqc/post_trim" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
- }
+process {
+ withName: '.*:FASTQC_NANOPLOT_POST_TRIM:FASTQC' {
+ ext.prefix = { "${meta.id}.trimmed" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/qc/fastqc/post_trim" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_fastqc && !params.skip_trimming },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
+ }
+}
- withName: '.*:FASTQC_NANOPLOT_POST_EXTRACT:FASTQC' {
- ext.prefix = { "${meta.id}.extracted" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/qc/fastqc/post_extract" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+process {
+ withName: '.*:FASTQC_NANOPLOT_POST_EXTRACT:FASTQC' {
+ ext.prefix = { "${meta.id}.extracted" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/qc/fastqc/post_extract" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_fastqc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
]
- }
}
}
// NANOPLOT
-if (!params.skip_qc && !params.skip_nanoplot) {
- process {
- withName: '.*:FASTQC_NANOPLOT_PRE_TRIM:NANOPLOT' {
- ext.prefix = { "${meta.id}.raw" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/qc/nanoplot/pre_trim/" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+process {
+ withName: '.*:FASTQC_NANOPLOT_PRE_TRIM:NANOPLOT' {
+ ext.prefix = { "${meta.id}.raw" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/qc/nanoplot/pre_trim/" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_nanoplot },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
]
- }
+ }
+}
- if (!params.skip_trimming) {
- withName: '.*:FASTQC_NANOPLOT_POST_TRIM:NANOPLOT' {
- ext.prefix = { "${meta.id}.trimmed" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/qc/nanoplot/post_trim/" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
- }
+process {
+ withName: '.*:FASTQC_NANOPLOT_POST_TRIM:NANOPLOT' {
+ ext.prefix = { "${meta.id}.trimmed" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/qc/nanoplot/post_trim/" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_nanoplot && !params.skip_trimming },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
+ }
+}
- withName: '.*:FASTQC_NANOPLOT_POST_EXTRACT:NANOPLOT' {
- ext.prefix = { "${meta.id}.extracted" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/qc/nanoplot/post_extract/" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+process {
+ withName: '.*:FASTQC_NANOPLOT_POST_EXTRACT:NANOPLOT' {
+ ext.prefix = { "${meta.id}.extracted" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/qc/nanoplot/post_extract/" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_nanoplot },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
]
- }
}
}
// NANOCOMP
-if (!params.skip_qc && !params.skip_fastq_nanocomp) {
- process {
- withName: '.*:NANOCOMP_FASTQ' {
- publishDir = [
- path: { "${params.outdir}/batch_qcs/nanocomp/fastq" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName: '.*:NANOCOMP_FASTQ' {
+ publishDir = [
+ path: { "${params.outdir}/batch_qcs/nanocomp/fastq" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_fastq_nanocomp },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
}
// TOULLIGQC
-if (!params.skip_qc && !params.skip_toulligqc) {
- process {
- withName: '.*:FASTQC_NANOPLOT_PRE_TRIM:TOULLIGQC' {
- ext.prefix = { "${meta.id}.raw_" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/qc/toulligqc/pre_trim/" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+process {
+ withName: '.*:FASTQC_NANOPLOT_PRE_TRIM:TOULLIGQC' {
+ ext.prefix = { "${meta.id}.raw_" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/qc/toulligqc/pre_trim/" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_toulligqc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
]
- }
+ }
+}
- if (!params.skip_trimming) {
- withName: '.*:FASTQC_NANOPLOT_POST_TRIM:TOULLIGQC' {
- ext.prefix = { "${meta.id}.trimmed_" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/qc/toulligqc/post_trim/" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
- }
+process {
+ withName: '.*:FASTQC_NANOPLOT_POST_TRIM:TOULLIGQC' {
+ ext.prefix = { "${meta.id}.trimmed_" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/qc/toulligqc/post_trim/" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_toulligqc && !params.skip_trimming },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
+ }
+}
- withName: '.*:FASTQC_NANOPLOT_POST_EXTRACT:TOULLIGQC' {
- ext.prefix = { "${meta.id}.extracted_" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/qc/toulligqc/post_extract/" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+process {
+ withName: '.*:FASTQC_NANOPLOT_POST_EXTRACT:TOULLIGQC' {
+ ext.prefix = { "${meta.id}.extracted_" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/qc/toulligqc/post_extract/" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_toulligqc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
]
- }
}
}
// SAMTOOLS
-if (!params.skip_qc){
-
- process {
- withName:'.*:BAM_SORT_STATS_SAMTOOLS_CORRECTED:BAM_STATS_SAMTOOLS:.*' {
- ext.prefix = { "${meta.id}.corrected" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/qc/samtools/corrected" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName:'.*:BAM_SORT_STATS_SAMTOOLS_CORRECTED:BAM_STATS_SAMTOOLS:.*' {
+ ext.prefix = { "${meta.id}.corrected" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/qc/samtools/corrected" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
-
}
-
// READ COUNTS
-if (!params.skip_qc) {
-
- process {
- withName:'.*:READ_COUNTS' {
- publishDir = [
- path: { "${params.outdir}/batch_qcs/read_counts" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName:'.*:READ_COUNTS' {
+ publishDir = [
+ path: { "${params.outdir}/batch_qcs/read_counts" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
}
@@ -238,87 +240,77 @@ process {
}
}
-if (params.split_amount > 0) {
- process {
- withName: '.*:SPLIT_SEQ_BC_FASTQ' {
- publishDir = [
- enabled: false
- ]
- }
+process {
+ withName: '.*:SPLIT_SEQ_BC_FASTQ' {
+ publishDir = [
+ enabled: false
+ ]
}
+}
- process {
- withName: '.*:SPLIT_FILE_BC_CSV' {
- publishDir = [
- enabled: false
- ]
- }
+process {
+ withName: '.*:SPLIT_FILE_BC_CSV' {
+ publishDir = [
+ enabled: false
+ ]
}
+}
- process {
- withName: '.*:CAT_CAT_PREEXTRACT' {
- ext.prefix = { "${meta.id}_filtered.fastq" }
- publishDir = [
- enabled: false
- ]
- }
+process {
+ withName: '.*:CAT_CAT_PREEXTRACT' {
+ ext.prefix = { "${meta.id}_filtered.fastq" }
+ publishDir = [
+ enabled: false
+ ]
}
+}
- process {
- withName: '.*:CAT_CAT_BARCODE' {
- ext.prefix = { "${meta.id}.corrected_bc_umi.tsv" }
- publishDir = [
- enabled: false
- ]
- }
+process {
+ withName: '.*:CAT_CAT_BARCODE' {
+ ext.prefix = { "${meta.id}.corrected_bc_umi.tsv" }
+ publishDir = [
+ enabled: false
+ ]
}
+}
- process {
- withName: '.*:PIGZ_COMPRESS' {
- publishDir = [
- enabled: false
- ]
- }
+process {
+ withName: '.*:PIGZ_COMPRESS' {
+ publishDir = [
+ enabled: false
+ ]
}
}
// FASTQ TRIMMING
-if (!params.skip_trimming) {
-
- if (params.split_amount > 0){
- process {
- withName: '.*:SPLIT_SEQ' {
- publishDir = [
- enabled: false
- ]
- }
- }
-
+process {
+ withName: '.*:SPLIT_SEQ' {
+ publishDir = [
+ enabled: false
+ ]
+ }
+}
- process {
- withName: '.*:CAT_CAT' {
- publishDir = [
- enabled: false
- ]
- }
- }
+process {
+ withName: '.*:CAT_CAT' {
+ publishDir = [
+ enabled: false
+ ]
}
+}
- // CHOPPER
- if ( !params.skip_trimming ){
- process {
- withName:'.*:CHOPPER' {
- ext.args = {
- [
- params.min_length ? "--minlength ${params.min_length}" : "",
- params.min_q_score ? "--quality ${params.min_q_score}" : ""
- ].join(' ').trim()
- }
- publishDir = [
- enabled: false
- ]
- }
+// CHOPPER
+process {
+ withName:'.*:CHOPPER' {
+ ext.args = {
+ [
+ params.min_length ? "--minlength ${params.min_length}" : "",
+ params.min_q_score ? "--quality ${params.min_q_score}" : ""
+ ].join(' ').trim()
}
+ publishDir = [
+ enabled: false
+ ]
}
}
@@ -428,40 +420,40 @@ process {
/////////////////////
// MINIMAP2_INDEX
-if (!params.skip_save_minimap2_index) {
- process {
- withName:'.*PROCESS_LONGREAD_SCRNA_GENOME.*:MINIMAP2_INDEX' {
- ext.args = {
- [
- "-ax splice",
- params.stranded == "forward" ? "-uf" : params.stranded == "reverse" ? "-ub" : "-un",
- "-k${params.kmer_size}",
- params.save_genome_secondary_alignment == false ? "--secondary=no " : "--secondary=yes "
- ].join(' ').trim()
- }
- publishDir = [
- path: { "${params.outdir}/references/genome/minimap_index" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
+process {
+ withName:'.*PROCESS_LONGREAD_SCRNA_GENOME.*:MINIMAP2_INDEX' {
+ ext.args = {
+ [
+ "-ax splice",
+ params.stranded == "forward" ? "-uf" : params.stranded == "reverse" ? "-ub" : "-un",
+ "-k${params.kmer_size}",
+ params.save_genome_secondary_alignment == false ? "--secondary=no " : "--secondary=yes "
+ ].join(' ').trim()
}
+ publishDir = [
+ path: { "${params.outdir}/references/genome/minimap_index" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_save_minimap2_index },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
- process {
- withName:'.*PROCESS_LONGREAD_SCRNA_TRANSCRIPT.*:MINIMAP2_INDEX' {
- ext.args = {
- [
- "-ax splice",
- params.stranded == "forward" ? "-uf" : params.stranded == "reverse" ? "-ub" : "-un",
- "-k${params.kmer_size}",
- params.save_transcript_secondary_alignment == false ? "--secondary=no " : "--secondary=yes "
- ].join(' ').trim()
- }
- publishDir = [
- path: { "${params.outdir}/references/transcriptome/minimap_index" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
+}
+process {
+ withName:'.*PROCESS_LONGREAD_SCRNA_TRANSCRIPT.*:MINIMAP2_INDEX' {
+ ext.args = {
+ [
+ "-ax splice",
+ params.stranded == "forward" ? "-uf" : params.stranded == "reverse" ? "-ub" : "-un",
+ "-k${params.kmer_size}",
+ params.save_transcript_secondary_alignment == false ? "--secondary=no " : "--secondary=yes "
+ ].join(' ').trim()
}
+ publishDir = [
+ path: { "${params.outdir}/references/transcriptome/minimap_index" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_save_minimap2_index },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
}
@@ -604,99 +596,100 @@ process {
}
}
-if (!params.skip_qc) {
-
- // SAMTOOLS FLAGSTAT/STAT/IDXSTAT
- process {
- withName:'.*PROCESS_LONGREAD_SCRNA_GENOME.*:ALIGN_LONGREADS:BAM_SORT_STATS_SAMTOOLS:BAM_STATS_SAMTOOLS:.*' {
- ext.prefix = { "${meta.id}.genome.minimap" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/genome/qc/samtools/minimap" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+// SAMTOOLS FLAGSTAT/STAT/IDXSTAT
+process {
+ withName:'.*PROCESS_LONGREAD_SCRNA_GENOME.*:ALIGN_LONGREADS:BAM_SORT_STATS_SAMTOOLS:BAM_STATS_SAMTOOLS:.*' {
+ ext.prefix = { "${meta.id}.genome.minimap" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/genome/qc/samtools/minimap" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
+}
- process {
- withName:'.*PROCESS_LONGREAD_SCRNA_TRANSCRIPT.*:ALIGN_LONGREADS:BAM_SORT_STATS_SAMTOOLS:BAM_STATS_SAMTOOLS:.*' {
- ext.prefix = { "${meta.id}.transcriptome.minimap" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/transcriptome/qc/samtools/minimap" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName:'.*PROCESS_LONGREAD_SCRNA_TRANSCRIPT.*:ALIGN_LONGREADS:BAM_SORT_STATS_SAMTOOLS:BAM_STATS_SAMTOOLS:.*' {
+ ext.prefix = { "${meta.id}.transcriptome.minimap" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/transcriptome/qc/samtools/minimap" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
+}
- process {
- withName:'.*PROCESS_LONGREAD_SCRNA_GENOME.*:ALIGN_LONGREADS:BAM_SORT_STATS_SAMTOOLS_FILTERED:BAM_STATS_SAMTOOLS:.*' {
- ext.prefix = { "${meta.id}.genome.mapped_only" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/genome/qc/samtools/mapped_only" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName:'.*PROCESS_LONGREAD_SCRNA_GENOME.*:ALIGN_LONGREADS:BAM_SORT_STATS_SAMTOOLS_FILTERED:BAM_STATS_SAMTOOLS:.*' {
+ ext.prefix = { "${meta.id}.genome.mapped_only" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/genome/qc/samtools/mapped_only" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
+}
- process {
- withName:'.*PROCESS_LONGREAD_SCRNA_TRANSCRIPT.*:ALIGN_LONGREADS:BAM_SORT_STATS_SAMTOOLS_FILTERED:BAM_STATS_SAMTOOLS:.*' {
- ext.prefix = { "${meta.id}.transcriptome.mapped_only" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/transcriptome/qc/samtools/mapped_only" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName:'.*PROCESS_LONGREAD_SCRNA_TRANSCRIPT.*:ALIGN_LONGREADS:BAM_SORT_STATS_SAMTOOLS_FILTERED:BAM_STATS_SAMTOOLS:.*' {
+ ext.prefix = { "${meta.id}.transcriptome.mapped_only" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/transcriptome/qc/samtools/mapped_only" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
+}
- // RSEQC
- if (!params.skip_rseqc) {
- process {
- withName:'.*PROCESS_LONGREAD_SCRNA_GENOME.*:RSEQC_READDISTRIBUTION' {
- publishDir = [
- path: { "${params.outdir}/${meta.id}/genome/qc/rseqc" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
- }
+// RSEQC
+process {
+ withName:'.*PROCESS_LONGREAD_SCRNA_GENOME.*:RSEQC_READDISTRIBUTION' {
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/genome/qc/rseqc" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_rseqc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
+ }
+}
- process {
- withName:'.*PROCESS_LONGREAD_SCRNA_TRANSCRIPT.*:RSEQC_READDISTRIBUTION' {
- publishDir = [
- path: { "${params.outdir}/${meta.id}/transcriptome/qc/rseqc" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
- }
+process {
+ withName:'.*PROCESS_LONGREAD_SCRNA_TRANSCRIPT.*:RSEQC_READDISTRIBUTION' {
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/transcriptome/qc/rseqc" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_rseqc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
+}
- // NANOCOMP
- if (!params.skip_bam_nanocomp) {
- process {
- withName: '.*PROCESS_LONGREAD_SCRNA_GENOME.*:ALIGN_LONGREADS:NANOCOMP' {
- ext.prefix = { "${meta.id}.genome" }
- publishDir = [
- path: { "${params.outdir}/batch_qcs/genome/nanocomp/bam" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
- }
+// NANOCOMP
+process {
+ withName: '.*PROCESS_LONGREAD_SCRNA_GENOME.*:ALIGN_LONGREADS:NANOCOMP' {
+ ext.prefix = { "${meta.id}.genome" }
+ publishDir = [
+ path: { "${params.outdir}/batch_qcs/genome/nanocomp/bam" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_bam_nanocomp },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
+ }
+}
- process {
- withName: '.*PROCESS_LONGREAD_SCRNA_TRANSCRIPT.*:ALIGN_LONGREADS:NANOCOMP' {
- ext.prefix = { "${meta.id}.transcriptome" }
- publishDir = [
- path: { "${params.outdir}/batch_qcs/transcriptome/nanocomp/bam" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
- }
+process {
+ withName: '.*PROCESS_LONGREAD_SCRNA_TRANSCRIPT.*:ALIGN_LONGREADS:NANOCOMP' {
+ ext.prefix = { "${meta.id}.transcriptome" }
+ publishDir = [
+ path: { "${params.outdir}/batch_qcs/transcriptome/nanocomp/bam" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_bam_nanocomp },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
}
@@ -717,16 +710,15 @@ process {
}
}
-if (!params.skip_dedup) {
- process {
- withName:'.*:BAM_SORT_STATS_SAMTOOLS_MERGED:SAMTOOLS_SORT' {
- ext.prefix = { "${meta.id}.merged.sorted" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/bam/dedup" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName:'.*:BAM_SORT_STATS_SAMTOOLS_MERGED:SAMTOOLS_SORT' {
+ ext.prefix = { "${meta.id}.merged.sorted" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/bam/dedup" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_dedup },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
}
@@ -862,88 +854,88 @@ process {
}
}
-if (!params.skip_dedup){
- process {
- withName: '.*PROCESS_LONGREAD_SCRNA_GENOME.*:UMITOOLS_DEDUP' {
- ext.prefix = { "${meta.id}.genome.umi_dedup" }
- ext.args = {
- [
- '--per-cell'
- ].join(' ').trim()
- }
- publishDir = [
- enabled: false
- ]
+process {
+ withName: '.*PROCESS_LONGREAD_SCRNA_GENOME.*:UMITOOLS_DEDUP' {
+ ext.prefix = { "${meta.id}.genome.umi_dedup" }
+ ext.args = {
+ [
+ '--per-cell'
+ ].join(' ').trim()
}
+ publishDir = [
+ enabled: false
+ ]
}
+}
- process {
- withName: '.*PROCESS_LONGREAD_SCRNA_GENOME.*:PICARD_MARKDUPLICATES' {
- ext.prefix = { "${meta.id}.genome.dedup" }
- ext.args = {
- [
- "--BARCODE_TAG 'CB'",
- "--TAG_DUPLICATE_SET_MEMBERS true",
- "--TAGGING_POLICY 'All'"
- ].join(' ').trim()
- }
- publishDir = [
- enabled: false
- ]
+process {
+ withName: '.*PROCESS_LONGREAD_SCRNA_GENOME.*:PICARD_MARKDUPLICATES' {
+ ext.prefix = { "${meta.id}.genome.dedup" }
+ ext.args = {
+ [
+ "--BARCODE_TAG 'CB'",
+ "--TAG_DUPLICATE_SET_MEMBERS true",
+ "--TAGGING_POLICY 'All'"
+ ].join(' ').trim()
}
+ publishDir = [
+ enabled: false
+ ]
}
+}
- process {
- withName:'.*PROCESS_LONGREAD_SCRNA_GENOME.*:SAMTOOLS_INDEX_DEDUP' {
- ext.prefix = { "${meta.id}.genome.dedup.sorted" }
- publishDir = [
- enabled: false
- ]
- }
+process {
+ withName:'.*PROCESS_LONGREAD_SCRNA_GENOME.*:SAMTOOLS_INDEX_DEDUP' {
+ ext.prefix = { "${meta.id}.genome.dedup.sorted" }
+ publishDir = [
+ enabled: false
+ ]
}
+}
- process {
- withName: '.*:PROCESS_LONGREAD_SCRNA_GENOME:DEDUP_UMIS:BAM_SORT_STATS_SAMTOOLS:SAMTOOLS_SORT' {
- ext.prefix = { "${meta.id}.sorted" }
- publishDir = [
- enabled: false
- ]
- }
+process {
+ withName: '.*:PROCESS_LONGREAD_SCRNA_GENOME:DEDUP_UMIS:BAM_SORT_STATS_SAMTOOLS:SAMTOOLS_SORT' {
+ ext.prefix = { "${meta.id}.sorted" }
+ publishDir = [
+ enabled: false
+ ]
}
+}
- process {
- withName: '.*PROCESS_LONGREAD_SCRNA_GENOME.*DEDUP_UMIS:SAMTOOLS_MERGE' {
- ext.prefix = { "${meta.id}.genome.dedup" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/genome/bam/dedup" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName: '.*PROCESS_LONGREAD_SCRNA_GENOME.*DEDUP_UMIS:SAMTOOLS_MERGE' {
+ ext.prefix = { "${meta.id}.genome.dedup" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/genome/bam/dedup" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_dedup },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
+}
- process {
- withName: '.*PROCESS_LONGREAD_SCRNA_GENOME.*DEDUP_UMIS:SAMTOOLS_INDEX_MERGED' {
- ext.prefix = { "${meta.id}.genome.dedup" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/genome/bam/dedup" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName: '.*PROCESS_LONGREAD_SCRNA_GENOME.*DEDUP_UMIS:SAMTOOLS_INDEX_MERGED' {
+ ext.prefix = { "${meta.id}.genome.dedup" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/genome/bam/dedup" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_dedup },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
+}
- process {
- withName: '.*PROCESS_LONGREAD_SCRNA_GENOME.*DEDUP_UMIS:BAM_STATS_SAMTOOLS.*' {
- ext.prefix = { "${meta.id}.genome.${params.dedup_tool}_dedup" }
- publishDir = [
- path: { "${params.outdir}/${meta.id}/genome/qc/samtools/dedup" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName: '.*PROCESS_LONGREAD_SCRNA_GENOME.*DEDUP_UMIS:BAM_STATS_SAMTOOLS.*' {
+ ext.prefix = { "${meta.id}.genome.${params.dedup_tool}_dedup" }
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/genome/qc/samtools/dedup" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_dedup },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
-
}
/////////////////////////////
@@ -1039,43 +1031,43 @@ process {
}
}
-if (!params.skip_qc && !params.skip_seurat) {
- process {
- withName: '.*QUANTIFY_SCRNA_ISOQUANT:QC_SCRNA_GENE:SEURAT' {
- publishDir = [
- path: { "${params.outdir}/${meta.id}/genome/qc/seurat_isoquant/gene" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName: '.*QUANTIFY_SCRNA_ISOQUANT:QC_SCRNA_GENE:SEURAT' {
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/genome/qc/seurat_isoquant/gene" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_seurat },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
+}
- process {
- withName: '.*QUANTIFY_SCRNA_ISOQUANT:QC_SCRNA_TRANSCRIPT:SEURAT' {
- publishDir = [
- path: { "${params.outdir}/${meta.id}/genome/qc/seurat_isoquant/transcript" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName: '.*QUANTIFY_SCRNA_ISOQUANT:QC_SCRNA_TRANSCRIPT:SEURAT' {
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/genome/qc/seurat_isoquant/transcript" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_seurat },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
+}
- process {
- withName: '.*:QUANTIFY_SCRNA_ISOQUANT:QC_SCRNA_GENE:COMBINE_SEURAT_STATS' {
- ext.args = "-o isoquant_gene.tsv -f gene"
- publishDir = [
- enabled: false
- ]
- }
+process {
+ withName: '.*:QUANTIFY_SCRNA_ISOQUANT:QC_SCRNA_GENE:COMBINE_SEURAT_STATS' {
+ ext.args = "-o isoquant_gene.tsv -f gene"
+ publishDir = [
+ enabled: false
+ ]
}
+}
- process {
- withName: '.*:QUANTIFY_SCRNA_ISOQUANT:QC_SCRNA_TRANSCRIPT:COMBINE_SEURAT_STATS' {
- ext.args = "-o isoquant_transcript.tsv -f transcript"
- publishDir = [
- enabled: false
- ]
- }
+process {
+ withName: '.*:QUANTIFY_SCRNA_ISOQUANT:QC_SCRNA_TRANSCRIPT:COMBINE_SEURAT_STATS' {
+ ext.args = "-o isoquant_transcript.tsv -f transcript"
+ publishDir = [
+ enabled: false
+ ]
}
}
@@ -1112,24 +1104,23 @@ process {
}
}
-if (!params.skip_qc && !params.skip_seurat) {
- process {
- withName: '.*QUANTIFY_SCRNA_OARFISH:QC_SCRNA:SEURAT' {
- publishDir = [
- path: { "${params.outdir}/${meta.id}/transcriptome/qc/seurat_oarfish/" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName: '.*QUANTIFY_SCRNA_OARFISH:QC_SCRNA:SEURAT' {
+ publishDir = [
+ path: { "${params.outdir}/${meta.id}/transcriptome/qc/seurat_oarfish/" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_seurat },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
+}
- process {
- withName: '.*:QUANTIFY_SCRNA_OARFISH:QC_SCRNA:COMBINE_SEURAT_STATS' {
- ext.args = "-o oarfish_transcript.tsv -f transcript"
- publishDir = [
- enabled: false
- ]
- }
+process {
+ withName: '.*:QUANTIFY_SCRNA_OARFISH:QC_SCRNA:COMBINE_SEURAT_STATS' {
+ ext.args = "-o oarfish_transcript.tsv -f transcript"
+ publishDir = [
+ enabled: false
+ ]
}
}
@@ -1137,26 +1128,26 @@ if (!params.skip_qc && !params.skip_seurat) {
// MULTIQC //
/////////////
-if (!params.skip_qc && !params.skip_multiqc) {
- process {
- withName: '.*:MULTIQC_FINALQC' {
- ext.args = { params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' }
- publishDir = [
- path: { "${params.outdir}/batch_qcs/multiqc/final_qc" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName: '.*:MULTIQC_FINALQC' {
+ ext.args = { params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' }
+ publishDir = [
+ path: { "${params.outdir}/batch_qcs/multiqc/final_qc" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_multiqc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
+}
- process {
- withName: '.*:MULTIQC_RAWQC' {
- ext.args = { params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' }
- publishDir = [
- path: { "${params.outdir}/batch_qcs/multiqc/raw_qc" },
- mode: params.publish_dir_mode,
- saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
- ]
- }
+process {
+ withName: '.*:MULTIQC_RAWQC' {
+ ext.args = { params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' }
+ publishDir = [
+ path: { "${params.outdir}/batch_qcs/multiqc/raw_qc" },
+ mode: params.publish_dir_mode,
+ enabled: { !params.skip_qc && !params.skip_multiqc },
+ saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+ ]
}
}
diff --git a/modules.json b/modules.json
index 349815ff..e889bf4f 100644
--- a/modules.json
+++ b/modules.json
@@ -7,225 +7,185 @@
"nf-core": {
"bamtools/split": {
"branch": "master",
- "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5",
- "installed_by": ["modules"]
+ "git_sha": "8c8ee20d5b87647b24df0c95296b2a9854a139aa",
+ "installed_by": [
+ "modules"
+ ]
},
"cat/cat": {
"branch": "master",
- "git_sha": "9437e6053dccf4aafa022bfd6e7e9de67e625af8",
- "installed_by": ["modules"]
+ "git_sha": "7ed72ef972290b93d0bdd7c60ff00a693250f77a",
+ "installed_by": [
+ "modules"
+ ]
},
"cat/fastq": {
"branch": "master",
- "git_sha": "0997b47c93c06b49aa7b3fefda87e728312cf2ca",
- "installed_by": ["modules"],
+ "git_sha": "5d28ea7cfaebcfae6f74d1067ea766d8ff19dff3",
+ "installed_by": [
+ "modules"
+ ],
"patch": "modules/nf-core/cat/fastq/cat-fastq.diff"
},
"custom/dumpsoftwareversions": {
"branch": "master",
- "git_sha": "de45447d060b8c8b98575bc637a4a575fd0638e1",
- "installed_by": ["modules"]
+ "git_sha": "ad65d06c959cff1da9e94c4a972deaf7430931fa",
+ "installed_by": [
+ "modules"
+ ]
},
"fastqc": {
"branch": "master",
- "git_sha": "dc94b6ee04a05ddb9f7ae050712ff30a13149164",
- "installed_by": ["modules"]
+ "git_sha": "3009f27c4e4b6e99da4eeebe82799e13924a4a1f",
+ "installed_by": [
+ "modules"
+ ]
},
"minimap2/align": {
"branch": "master",
- "git_sha": "a33ef9475558c6b8da08c5f522ddaca1ec810306",
- "installed_by": ["modules"]
+ "git_sha": "5c9f8d5b7671237c906abadc9ff732b301ca15ca",
+ "installed_by": [
+ "modules"
+ ]
},
"minimap2/index": {
"branch": "master",
- "git_sha": "72e277acfd9e61a9f1368eafb4a9e83f5bcaa9f5",
- "installed_by": ["modules"],
+ "git_sha": "14980f759266eec42dac401fcafeb83d6c957b41",
+ "installed_by": [
+ "modules"
+ ],
"patch": "modules/nf-core/minimap2/index/minimap2-index.diff"
},
"multiqc": {
"branch": "master",
- "git_sha": "f0719ae309075ae4a291533883847c3f7c441dad",
- "installed_by": ["modules"]
+ "git_sha": "2c73cc8fa92cf48de3da0b643fdf357a8a290b36",
+ "installed_by": [
+ "modules"
+ ]
},
"nanocomp": {
"branch": "master",
- "git_sha": "f0c766af7e897ecf52c13f5424426f06d221194b",
- "installed_by": ["modules"],
+ "git_sha": "2956d489fac13be1b7c8d54effd766a1965cd3de",
+ "installed_by": [
+ "modules"
+ ],
"patch": "modules/nf-core/nanocomp/nanocomp.diff"
},
"nanoplot": {
"branch": "master",
- "git_sha": "a31407dfaf0cb0d04768d5cb439fc6f4523a6981",
- "installed_by": ["modules"],
+ "git_sha": "e753770db613ce014b3c4bc94f6cba443427b726",
+ "installed_by": [
+ "modules"
+ ],
"patch": "modules/nf-core/nanoplot/nanoplot.diff"
},
"picard/markduplicates": {
"branch": "master",
- "git_sha": "49f4e50534fe4b64101e62ea41d5dc43b1324358",
- "installed_by": ["modules"]
+ "git_sha": "a631e12055f6c23ba2c942d3902b3ed1b9eed859",
+ "installed_by": [
+ "modules"
+ ]
},
"pigz/compress": {
"branch": "master",
- "git_sha": "c00055a0b13d622b4f1f51a8e5be31deaf99ded7",
- "installed_by": ["modules"]
+ "git_sha": "c908ccaf0a5c802b6f8e814d8c5cf85da2364222",
+ "installed_by": [
+ "modules"
+ ]
},
"pigz/uncompress": {
"branch": "master",
- "git_sha": "c00055a0b13d622b4f1f51a8e5be31deaf99ded7",
- "installed_by": ["modules"],
+ "git_sha": "f84336b7fa91a65aa61d215b8c109fbb8e4b4ac6",
+ "installed_by": [
+ "modules"
+ ],
"patch": "modules/nf-core/pigz/uncompress/pigz-uncompress.diff"
},
"rseqc/readdistribution": {
"branch": "master",
- "git_sha": "6c7d8f1d6247655e4bc4d97f37b68b2461f645f6",
- "installed_by": ["modules"]
+ "git_sha": "eed5d14302a6c9070dcc25feeab707a27a4b3254",
+ "installed_by": [
+ "modules"
+ ]
},
"samtools/faidx": {
"branch": "master",
- "git_sha": "aeb02a39d4c463598bfdcb2d964dbb7acbcf1298",
- "installed_by": ["modules"]
+ "git_sha": "b2e78932ef01165fd85829513eaca29eff8e640a",
+ "installed_by": [
+ "modules"
+ ]
},
"samtools/flagstat": {
"branch": "master",
- "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62",
- "installed_by": ["bam_stats_samtools"]
+ "git_sha": "1d2fbdcbca677bbe8da0f9d0d2bb7c02f2cab1c9",
+ "installed_by": [
+ "bam_stats_samtools"
+ ]
},
"samtools/idxstats": {
"branch": "master",
- "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62",
- "installed_by": ["bam_stats_samtools"]
+ "git_sha": "1d2fbdcbca677bbe8da0f9d0d2bb7c02f2cab1c9",
+ "installed_by": [
+ "bam_stats_samtools"
+ ]
},
"samtools/index": {
"branch": "master",
- "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62",
- "installed_by": ["bam_sort_stats_samtools"]
+ "git_sha": "1d2fbdcbca677bbe8da0f9d0d2bb7c02f2cab1c9",
+ "installed_by": [
+ "bam_sort_stats_samtools"
+ ]
},
"samtools/merge": {
"branch": "master",
- "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62",
- "installed_by": ["modules"]
+ "git_sha": "440edf75d8782913115a7b72a88392a227f72cc1",
+ "installed_by": [
+ "modules"
+ ]
},
"samtools/sort": {
"branch": "master",
- "git_sha": "4352dbdb09ec40db71e9b172b97a01dcf5622c26",
- "installed_by": ["bam_sort_stats_samtools"]
+ "git_sha": "5cb9a8694da0a0e550921636bb60bc8c56445fd7",
+ "installed_by": [
+ "bam_sort_stats_samtools"
+ ]
},
"samtools/stats": {
"branch": "master",
- "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62",
- "installed_by": ["bam_stats_samtools"]
+ "git_sha": "fe93fde0845f907fc91ad7cc7d797930408824df",
+ "installed_by": [
+ "bam_stats_samtools"
+ ]
},
"samtools/view": {
"branch": "master",
- "git_sha": "0bd7d2333a88483aa0476acea172e9f5f6dd83bb",
- "installed_by": ["modules"],
+ "git_sha": "b2e78932ef01165fd85829513eaca29eff8e640a",
+ "installed_by": [
+ "modules"
+ ],
"patch": "modules/nf-core/samtools/view/samtools-view.diff"
},
"toulligqc": {
"branch": "master",
- "git_sha": "061a322293b3487e53f044304710e54cbf657717",
- "installed_by": ["modules"],
+ "git_sha": "d9137377f4dd6246242829772eb1949b96de1ef0",
+ "installed_by": [
+ "modules"
+ ],
"patch": "modules/nf-core/toulligqc/toulligqc.diff"
},
"umitools/dedup": {
"branch": "master",
- "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc",
- "installed_by": ["modules"]
+ "git_sha": "bd6d730b3f32742f402189113ba9480006a3350f",
+ "installed_by": [
+ "modules"
+ ]
},
"unzipfiles": {
"branch": "master",
- "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc",
- "installed_by": ["modules"]
- },
- "nanocomp": {
- "branch": "master",
- "git_sha": "f0c766af7e897ecf52c13f5424426f06d221194b",
- "installed_by": ["modules"],
- "patch": "modules/nf-core/nanocomp/nanocomp.diff"
- },
- "nanoplot": {
- "branch": "master",
- "git_sha": "a31407dfaf0cb0d04768d5cb439fc6f4523a6981",
- "installed_by": ["modules"],
- "patch": "modules/nf-core/nanoplot/nanoplot.diff"
- },
- "picard/markduplicates": {
- "branch": "master",
- "git_sha": "49f4e50534fe4b64101e62ea41d5dc43b1324358",
- "installed_by": ["modules"]
- },
- "pigz/compress": {
- "branch": "master",
- "git_sha": "c00055a0b13d622b4f1f51a8e5be31deaf99ded7",
- "installed_by": ["modules"]
- },
- "pigz/uncompress": {
- "branch": "master",
- "git_sha": "c00055a0b13d622b4f1f51a8e5be31deaf99ded7",
- "installed_by": ["modules"],
- "patch": "modules/nf-core/pigz/uncompress/pigz-uncompress.diff"
- },
- "rseqc/readdistribution": {
- "branch": "master",
- "git_sha": "6c7d8f1d6247655e4bc4d97f37b68b2461f645f6",
- "installed_by": ["modules"]
- },
- "samtools/faidx": {
- "branch": "master",
- "git_sha": "aeb02a39d4c463598bfdcb2d964dbb7acbcf1298",
- "installed_by": ["modules"]
- },
- "samtools/flagstat": {
- "branch": "master",
- "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62",
- "installed_by": ["bam_stats_samtools"]
- },
- "samtools/idxstats": {
- "branch": "master",
- "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62",
- "installed_by": ["bam_stats_samtools"]
- },
- "samtools/index": {
- "branch": "master",
- "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62",
- "installed_by": ["bam_sort_stats_samtools"]
- },
- "samtools/merge": {
- "branch": "master",
- "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62",
- "installed_by": ["modules"]
- },
- "samtools/sort": {
- "branch": "master",
- "git_sha": "4352dbdb09ec40db71e9b172b97a01dcf5622c26",
- "installed_by": ["bam_sort_stats_samtools"]
- },
- "samtools/stats": {
- "branch": "master",
- "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62",
- "installed_by": ["bam_stats_samtools"]
- },
- "samtools/view": {
- "branch": "master",
- "git_sha": "0bd7d2333a88483aa0476acea172e9f5f6dd83bb",
- "installed_by": ["modules"],
- "patch": "modules/nf-core/samtools/view/samtools-view.diff"
- },
- "toulligqc": {
- "branch": "master",
- "git_sha": "061a322293b3487e53f044304710e54cbf657717",
- "installed_by": ["modules"],
- "patch": "modules/nf-core/toulligqc/toulligqc.diff"
- },
- "umitools/dedup": {
- "branch": "master",
- "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc",
- "installed_by": ["modules"]
- },
- "unzipfiles": {
- "branch": "master",
- "git_sha": "81880787133db07d9b4c1febd152c090eb8325dc",
- "installed_by": ["modules"]
+ "git_sha": "41dfa3f7c0ffabb96a6a813fe321c6d1cc5b6e46",
+ "installed_by": [
+ "modules"
+ ]
}
}
},
@@ -233,31 +193,41 @@
"nf-core": {
"bam_sort_stats_samtools": {
"branch": "master",
- "git_sha": "4352dbdb09ec40db71e9b172b97a01dcf5622c26",
- "installed_by": ["subworkflows"]
+ "git_sha": "7ac6cbe7c17c2dad685da7f70496c8f48ea48687",
+ "installed_by": [
+ "subworkflows"
+ ]
},
"bam_stats_samtools": {
"branch": "master",
- "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62",
- "installed_by": ["bam_sort_stats_samtools"]
+ "git_sha": "7ac6cbe7c17c2dad685da7f70496c8f48ea48687",
+ "installed_by": [
+ "bam_sort_stats_samtools"
+ ]
},
"utils_nextflow_pipeline": {
"branch": "master",
"git_sha": "05954dab2ff481bcb999f24455da29a5828af08d",
- "installed_by": ["subworkflows"]
+ "installed_by": [
+ "subworkflows"
+ ]
},
"utils_nfcore_pipeline": {
"branch": "master",
- "git_sha": "1b89f75f1aa2021ec3360d0deccd0f6e97240551",
- "installed_by": ["subworkflows"]
+ "git_sha": "f0b535b3ae20080f8db03dd5388876ad1ec29d70",
+ "installed_by": [
+ "subworkflows"
+ ]
},
"utils_nfschema_plugin": {
"branch": "master",
- "git_sha": "4b406a74dc0449c0401ed87d5bfff4252fd277fd",
- "installed_by": ["subworkflows"]
+ "git_sha": "fdc08b8b1ae74f56686ce21f7ea11ad11990ce57",
+ "installed_by": [
+ "subworkflows"
+ ]
}
}
}
}
}
-}
+}
\ No newline at end of file
diff --git a/modules/local/blaze/main.nf b/modules/local/blaze/main.nf
index ab03c24a..63e518eb 100644
--- a/modules/local/blaze/main.nf
+++ b/modules/local/blaze/main.nf
@@ -14,11 +14,11 @@ process BLAZE {
path in_whitelist
output:
- tuple val(meta), path("*.putative_bc.no_header.csv") , emit: putative_bc
- tuple val(meta), path("*.whitelist.csv") , emit: whitelist
- tuple val(meta), path("*.bc_count.txt") , emit: bc_count
- tuple val(meta), path("*.knee_plot.png") , emit: knee_plot
- path "versions.yml" , emit: versions
+ tuple val(meta), path("*.putative_bc.no_header.csv"), emit: putative_bc
+ tuple val(meta), path("*.whitelist.csv") , emit: whitelist
+ tuple val(meta), path("*.bc_count.txt") , emit: bc_count
+ tuple val(meta), path("*.knee_plot.png") , emit: knee_plot
+ path "versions.yml" , emit: versions_blaze, topic: versions
when:
task.ext.when == null || task.ext.when
diff --git a/modules/local/chopper/main.nf b/modules/local/chopper/main.nf
index 7fe6f57b..5f3c9bd3 100644
--- a/modules/local/chopper/main.nf
+++ b/modules/local/chopper/main.nf
@@ -12,7 +12,7 @@ process CHOPPER {
output:
tuple val(meta), path("*.filtered.fastq.gz"), emit: reads
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_chopper, topic: versions
when:
task.ext.when == null || task.ext.when
diff --git a/modules/local/combine_seurat_stats/main.nf b/modules/local/combine_seurat_stats/main.nf
index 99369420..269c13bd 100644
--- a/modules/local/combine_seurat_stats/main.nf
+++ b/modules/local/combine_seurat_stats/main.nf
@@ -11,7 +11,7 @@ process COMBINE_SEURAT_STATS {
output:
path "*.tsv" , emit: combined_stats
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_combine_seurat_stats, topic: versions
when:
task.ext.when == null || task.ext.when
diff --git a/modules/local/correct_barcodes/main.nf b/modules/local/correct_barcodes/main.nf
index 65aa370b..85429c99 100644
--- a/modules/local/correct_barcodes/main.nf
+++ b/modules/local/correct_barcodes/main.nf
@@ -12,7 +12,7 @@ process CORRECT_BARCODES {
output:
tuple val(meta), path("*.corrected_bc_umi.tsv"), emit: corrected_bc_info
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_correct_barcodes, topic: versions
when:
task.ext.when == null || task.ext.when
diff --git a/modules/local/group_transcripts/main.nf b/modules/local/group_transcripts/main.nf
index e855ade2..74403c91 100644
--- a/modules/local/group_transcripts/main.nf
+++ b/modules/local/group_transcripts/main.nf
@@ -9,18 +9,17 @@ process GROUP_TRANSCRIPTS {
input:
tuple val(meta), path(fasta)
- tuple val(meta), path(gtf)
+ tuple val(meta2), path(gtf)
val delimiter
output:
path "*.transcripts.txt", emit: grouped_transcripts
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_group_transcripts, topic: versions
when:
task.ext.when == null || task.ext.when
script:
- def args = task.ext.args ?: ''
def delim_arg = delimiter ? "-d '${delimiter}'" : ''
"""
diff --git a/modules/local/isoquant/main.nf b/modules/local/isoquant/main.nf
index d04aa6c0..c27613ec 100644
--- a/modules/local/isoquant/main.nf
+++ b/modules/local/isoquant/main.nf
@@ -35,7 +35,7 @@ process ISOQUANT {
tuple val(meta), path("*/*/*.extended_annotation.gtf"), emit: extended_gtf, optional: true
tuple val(meta), path("*/*/*.transcript_model_grouped_counts.tsv"), emit: grouped_transcript_model_counts, optional: true
tuple val(meta), path("*/*/*.transcript_model_grouped_tpm.tsv"), emit: grouped_transcript_model_tpm, optional: true
- path "versions.yml", emit: versions
+ path "versions.yml", emit: versions_isoquant, topic: versions
when:
task.ext.when == null || task.ext.when
diff --git a/modules/local/merge_mtx/main.nf b/modules/local/merge_mtx/main.nf
index eaa23ef0..eb83fc69 100644
--- a/modules/local/merge_mtx/main.nf
+++ b/modules/local/merge_mtx/main.nf
@@ -12,13 +12,12 @@ process MERGE_MTX {
output:
tuple val(meta), path("*.merged.tsv"), emit: merged_mtx
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_merge_mtx, topic: versions
when:
task.ext.when == null || task.ext.when
script:
- def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}"
"""
diff --git a/modules/local/oarfish/main.nf b/modules/local/oarfish/main.nf
index 4a904f8d..8fbe32b1 100644
--- a/modules/local/oarfish/main.nf
+++ b/modules/local/oarfish/main.nf
@@ -15,7 +15,7 @@ process OARFISH {
tuple val(meta), path("*barcodes.tsv.gz") , emit: barcodes
tuple val(meta), path("*matrix.mtx.gz") , emit: mtx
tuple val(meta), path("*meta_info.json") , emit: meta_info
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_oarfish, topic: versions
when:
task.ext.when == null || task.ext.when
@@ -55,5 +55,10 @@ process OARFISH {
touch ${prefix}.barcodes.tsv.gz
touch ${prefix}.matrix.mtx.gz
touch ${prefix}.meta_info.json
+
+ cat <<-END_VERSIONS > versions.yml
+ "${task.process}":
+ oarfish: \$(oarfish --version | sed 's#oarfish ##g')
+ END_VERSIONS
"""
}
diff --git a/modules/local/preextract_fastq/main.nf b/modules/local/preextract_fastq/main.nf
index e7b70ea7..4844bbe3 100644
--- a/modules/local/preextract_fastq/main.nf
+++ b/modules/local/preextract_fastq/main.nf
@@ -15,7 +15,7 @@ process PREEXTRACT_FASTQ {
output:
tuple val(meta), path("*.putative_bc_umi.tsv") , emit: barcode_info
tuple val(meta), path("*.extracted.fastq") , emit: extracted_fastq
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_preextract_fastq, topic: versions
when:
task.ext.when == null || task.ext.when
diff --git a/modules/local/read_counts/main.nf b/modules/local/read_counts/main.nf
index f4a8d0e7..72329aed 100644
--- a/modules/local/read_counts/main.nf
+++ b/modules/local/read_counts/main.nf
@@ -14,7 +14,7 @@ process READ_COUNTS {
output:
path "read_counts.csv" , emit: read_counts
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_read_counts, topic: versions
when:
task.ext.when == null || task.ext.when
diff --git a/modules/local/seurat/main.nf b/modules/local/seurat/main.nf
index 5cbd3d8f..469dc512 100644
--- a/modules/local/seurat/main.nf
+++ b/modules/local/seurat/main.nf
@@ -15,7 +15,7 @@ process SEURAT {
tuple val(meta), path("*.csv"), emit: seurat_stats
tuple val(meta), path("*.png"), emit: seurat_qcs
tuple val(meta), path("*.rds"), emit: seurat_rds
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_seurat, topic: versions
when:
task.ext.when == null || task.ext.when
diff --git a/modules/local/split_bam/main.nf b/modules/local/split_bam/main.nf
index 8c97ff34..5f393344 100644
--- a/modules/local/split_bam/main.nf
+++ b/modules/local/split_bam/main.nf
@@ -12,7 +12,7 @@ process SPLIT_BAM {
output:
tuple val(meta), path("*.split.bam"), emit: split_bam
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_split_bam, topic: versions
when:
task.ext.when == null || task.ext.when
diff --git a/modules/local/split_fasta/main.nf b/modules/local/split_fasta/main.nf
index 00d9fbb8..9830a58c 100644
--- a/modules/local/split_fasta/main.nf
+++ b/modules/local/split_fasta/main.nf
@@ -11,14 +11,12 @@ process SPLIT_FASTA {
output:
path "*.split.fa" , emit: split_fasta
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_split_fasta, topic: versions
when:
task.ext.when == null || task.ext.when
script:
- def args = task.ext.args ?: ''
-
"""
awk '/^>/{chrom=(split(substr(\$0,2), a, " ")); filename=( a[1] ".split.fa"); print > filename; next}{print >> filename}' $fasta
diff --git a/modules/local/split_file/main.nf b/modules/local/split_file/main.nf
index d89b035b..9c04b587 100644
--- a/modules/local/split_file/main.nf
+++ b/modules/local/split_file/main.nf
@@ -14,13 +14,12 @@ process SPLIT_FILE {
output:
tuple val(meta), path("*$file_ext"), emit: split_files
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_split_file, topic: versions
when:
task.ext.when == null || task.ext.when
script:
- def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}"
"""
diff --git a/modules/local/split_gtf/main.nf b/modules/local/split_gtf/main.nf
index 1f91ee7c..c589e13b 100644
--- a/modules/local/split_gtf/main.nf
+++ b/modules/local/split_gtf/main.nf
@@ -11,14 +11,12 @@ process SPLIT_GTF {
output:
path "*.split.gtf" , emit: split_gtf
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_split_gtf, topic: versions
when:
task.ext.when == null || task.ext.when
script:
- def args = task.ext.args ?: ''
-
"""
grep -v '^#' $gtf | awk -F \$'\\t' '{print > \$1".split.gtf"}'
diff --git a/modules/local/split_seq/main.nf b/modules/local/split_seq/main.nf
index 725f9e6d..82684667 100644
--- a/modules/local/split_seq/main.nf
+++ b/modules/local/split_seq/main.nf
@@ -14,7 +14,7 @@ process SPLIT_SEQ {
output:
tuple val(meta), path("output/*$file_ext"), emit: split_files
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_split_seq, topic: versions
when:
task.ext.when == null || task.ext.when
diff --git a/modules/local/tag_barcodes/main.nf b/modules/local/tag_barcodes/main.nf
index bbb48401..13b12f59 100644
--- a/modules/local/tag_barcodes/main.nf
+++ b/modules/local/tag_barcodes/main.nf
@@ -12,13 +12,12 @@ process TAG_BARCODES {
output:
tuple val(meta), path("*.tagged.bam"), emit: tagged_bam
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_tag_barcodes, topic: versions
when:
task.ext.when == null || task.ext.when
script:
- def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}"
"""
diff --git a/modules/local/ucsc_genepredtobed/main.nf b/modules/local/ucsc_genepredtobed/main.nf
index 8296076f..95373950 100644
--- a/modules/local/ucsc_genepredtobed/main.nf
+++ b/modules/local/ucsc_genepredtobed/main.nf
@@ -12,7 +12,7 @@ process UCSC_GENEPREDTOBED {
output:
path "*.bed" , emit: bed
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_genepredtobed, topic: versions
when:
task.ext.when == null || task.ext.when
diff --git a/modules/local/ucsc_gtftogenepred/main.nf b/modules/local/ucsc_gtftogenepred/main.nf
index 1e0ee26d..f3489f63 100644
--- a/modules/local/ucsc_gtftogenepred/main.nf
+++ b/modules/local/ucsc_gtftogenepred/main.nf
@@ -12,7 +12,7 @@ process UCSC_GTFTOGENEPRED {
output:
path "*.genepred" , emit: genepred
- path "versions.yml" , emit: versions
+ path "versions.yml" , emit: versions_gtftogenepred, topic: versions
when:
task.ext.when == null || task.ext.when
diff --git a/modules/nf-core/bamtools/split/environment.yml b/modules/nf-core/bamtools/split/environment.yml
index 995d25ee..5ee33607 100644
--- a/modules/nf-core/bamtools/split/environment.yml
+++ b/modules/nf-core/bamtools/split/environment.yml
@@ -1,7 +1,7 @@
-name: bamtools_split
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
channels:
- conda-forge
- bioconda
- - defaults
dependencies:
- bioconda::bamtools=2.5.2
diff --git a/modules/nf-core/bamtools/split/main.nf b/modules/nf-core/bamtools/split/main.nf
index 7c36501c..e26c4688 100644
--- a/modules/nf-core/bamtools/split/main.nf
+++ b/modules/nf-core/bamtools/split/main.nf
@@ -12,7 +12,7 @@ process BAMTOOLS_SPLIT {
output:
tuple val(meta), path("*.bam"), emit: bam
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val('bamtools'), eval("bamtools --version | sed '2!d;s/bamtools //g'"), emit: versions_bamtools, topic: versions
when:
task.ext.when == null || task.ext.when
@@ -20,7 +20,7 @@ process BAMTOOLS_SPLIT {
script:
def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}"
- def input_list = bam.collect{"-in $it"}.join(' ')
+ def input_list = bam.collect{ bam_file -> "-in ${bam_file}"}.join(' ')
"""
bamtools \\
merge \\
@@ -29,10 +29,13 @@ process BAMTOOLS_SPLIT {
split \\
-stub $prefix \\
$args
+ """
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- bamtools: \$( bamtools --version | grep -e 'bamtools' | sed 's/^.*bamtools //' )
- END_VERSIONS
+ stub:
+ def prefix = task.ext.prefix ?: "${meta.id}"
"""
+ touch ${prefix}.split1.bam
+ touch ${prefix}.unmapped.bam
+ """
+
}
diff --git a/modules/nf-core/bamtools/split/meta.yml b/modules/nf-core/bamtools/split/meta.yml
index e42242bb..921c7401 100644
--- a/modules/nf-core/bamtools/split/meta.yml
+++ b/modules/nf-core/bamtools/split/meta.yml
@@ -1,5 +1,6 @@
name: bamtools_split
-description: BamTools provides both a programmer's API and an end-user's toolkit for handling BAM files.
+description: BamTools provides both a programmer's API and an end-user's toolkit for
+ handling BAM files.
keywords:
- bamtools
- bamtools/split
@@ -13,33 +14,54 @@ tools:
documentation: https://github.com/pezmaster31/bamtools/wiki
tool_dev_url: http://github.com/pezmaster31/bamtools
licence: ["MIT"]
+ identifier: biotools:bamtools
input:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - bam:
- type: file
- description: A list of one or more BAM files to merge and then split
- pattern: "*.bam"
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - bam:
+ type: file
+ description: A list of one or more BAM files to merge and then split
+ pattern: "*.bam"
+ ontologies: []
output:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - versions:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
- - bam:
- type: file
- description: Several Bam files
- pattern: "*.bam"
+ bam:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "*.bam":
+ type: file
+ description: Several Bam files
+ pattern: "*.bam"
+ ontologies: []
+ versions_bamtools:
+ - - "${task.process}":
+ type: string
+ description: The name of the process
+ - bamtools:
+ type: string
+ description: The name of the tool
+ - "bamtools --version | sed '2!d;s/bamtools //g'":
+ type: eval
+ description: The expression to obtain the version of the tool
authors:
- "@sguizard"
- "@matthdsm"
maintainers:
- "@sguizard"
- "@matthdsm"
+topics:
+ versions:
+ - - "${task.process}":
+ type: string
+ description: The name of the process
+ - bamtools:
+ type: string
+ description: The name of the tool
+ - "bamtools --version | sed '2!d;s/bamtools //g'":
+ type: eval
+ description: The expression to obtain the version of the tool
diff --git a/modules/nf-core/bamtools/split/tests/main.nf.test b/modules/nf-core/bamtools/split/tests/main.nf.test
new file mode 100644
index 00000000..9407cb35
--- /dev/null
+++ b/modules/nf-core/bamtools/split/tests/main.nf.test
@@ -0,0 +1,81 @@
+nextflow_process {
+
+ name "Test Process BAMTOOLS_SPLIT"
+ script "../main.nf"
+ process "BAMTOOLS_SPLIT"
+
+ tag "modules"
+ tag "modules_nfcore"
+ tag "bamtools"
+ tag "bamtools/split"
+
+ config "./nextflow.config"
+ test("single_bam") {
+
+ when {
+ process {
+ """
+ input[0] = [
+ [ id:'test' ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true)
+ ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+
+ }
+
+ test("two_bams") {
+
+ when {
+ process {
+ """
+ input[0] = [
+ [ id:'test' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true)
+ ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+
+ }
+
+ test("single_bam - stub") {
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = [
+ [ id:'test' ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true)
+ ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+
+ }
+
+}
diff --git a/modules/nf-core/bamtools/split/tests/main.nf.test.snap b/modules/nf-core/bamtools/split/tests/main.nf.test.snap
new file mode 100644
index 00000000..0706cb42
--- /dev/null
+++ b/modules/nf-core/bamtools/split/tests/main.nf.test.snap
@@ -0,0 +1,143 @@
+{
+ "two_bams": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test"
+ },
+ [
+ "test.REF_chr22.bam:md5,b7dc50e0edf9c6bfc2e3b0e6d074dc07",
+ "test.REF_unmapped.bam:md5,e0754bf72c51543b2d745d96537035fb"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ "BAMTOOLS_SPLIT",
+ "bamtools",
+ "2.5.2"
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test"
+ },
+ [
+ "test.REF_chr22.bam:md5,b7dc50e0edf9c6bfc2e3b0e6d074dc07",
+ "test.REF_unmapped.bam:md5,e0754bf72c51543b2d745d96537035fb"
+ ]
+ ]
+ ],
+ "versions_bamtools": [
+ [
+ "BAMTOOLS_SPLIT",
+ "bamtools",
+ "2.5.2"
+ ]
+ ]
+ }
+ ],
+ "timestamp": "2026-03-11T18:54:32.314097039",
+ "meta": {
+ "nf-test": "0.9.4",
+ "nextflow": "25.10.4"
+ }
+ },
+ "single_bam - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test"
+ },
+ [
+ "test.split1.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.unmapped.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ "BAMTOOLS_SPLIT",
+ "bamtools",
+ "2.5.2"
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test"
+ },
+ [
+ "test.split1.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.unmapped.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions_bamtools": [
+ [
+ "BAMTOOLS_SPLIT",
+ "bamtools",
+ "2.5.2"
+ ]
+ ]
+ }
+ ],
+ "timestamp": "2026-03-11T18:54:44.733616549",
+ "meta": {
+ "nf-test": "0.9.4",
+ "nextflow": "25.10.4"
+ }
+ },
+ "single_bam": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test"
+ },
+ [
+ "test.REF_chr22.bam:md5,b7dc50e0edf9c6bfc2e3b0e6d074dc07",
+ "test.REF_unmapped.bam:md5,e0754bf72c51543b2d745d96537035fb"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ "BAMTOOLS_SPLIT",
+ "bamtools",
+ "2.5.2"
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test"
+ },
+ [
+ "test.REF_chr22.bam:md5,b7dc50e0edf9c6bfc2e3b0e6d074dc07",
+ "test.REF_unmapped.bam:md5,e0754bf72c51543b2d745d96537035fb"
+ ]
+ ]
+ ],
+ "versions_bamtools": [
+ [
+ "BAMTOOLS_SPLIT",
+ "bamtools",
+ "2.5.2"
+ ]
+ ]
+ }
+ ],
+ "timestamp": "2026-03-11T18:54:19.303851983",
+ "meta": {
+ "nf-test": "0.9.4",
+ "nextflow": "25.10.4"
+ }
+ }
+}
\ No newline at end of file
diff --git a/modules/nf-core/bamtools/split/tests/nextflow.config b/modules/nf-core/bamtools/split/tests/nextflow.config
new file mode 100644
index 00000000..abaed7eb
--- /dev/null
+++ b/modules/nf-core/bamtools/split/tests/nextflow.config
@@ -0,0 +1,5 @@
+process {
+ withName: BAMTOOLS_SPLIT {
+ ext.args = '-reference'
+ }
+}
diff --git a/modules/nf-core/cat/cat/environment.yml b/modules/nf-core/cat/cat/environment.yml
index 17a04ef2..98511769 100644
--- a/modules/nf-core/cat/cat/environment.yml
+++ b/modules/nf-core/cat/cat/environment.yml
@@ -1,7 +1,7 @@
-name: cat_cat
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
channels:
- conda-forge
- bioconda
- - defaults
dependencies:
- - conda-forge::pigz=2.3.4
+ - conda-forge::pigz=2.8
diff --git a/modules/nf-core/cat/cat/main.nf b/modules/nf-core/cat/cat/main.nf
index adbdbd7b..15274c4c 100644
--- a/modules/nf-core/cat/cat/main.nf
+++ b/modules/nf-core/cat/cat/main.nf
@@ -4,15 +4,15 @@ process CAT_CAT {
conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/pigz:2.3.4' :
- 'biocontainers/pigz:2.3.4' }"
+ 'https://depot.galaxyproject.org/singularity/pigz:2.8' :
+ 'biocontainers/pigz:2.8' }"
input:
tuple val(meta), path(files_in)
output:
tuple val(meta), path("${prefix}"), emit: file_out
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val("pigz"), eval("pigz --version 2>&1 | sed 's/pigz //g'"), topic: versions, emit: versions_cat
when:
task.ext.when == null || task.ext.when
@@ -20,7 +20,7 @@ process CAT_CAT {
script:
def args = task.ext.args ?: ''
def args2 = task.ext.args2 ?: ''
- def file_list = files_in.collect { it.toString() }
+ def file_list = files_in.collect { file -> file.toString() }
// choose appropriate concatenation tool depending on input and output format
@@ -55,7 +55,7 @@ process CAT_CAT {
"""
stub:
- def file_list = files_in.collect { it.toString() }
+ def file_list = files_in.collect { file -> file.toString() }
prefix = task.ext.prefix ?: "${meta.id}${file_list[0].substring(file_list[0].lastIndexOf('.'))}"
if(file_list.contains(prefix.trim())) {
error "The name of the input file can't be the same as for the output prefix in the " +
@@ -76,4 +76,3 @@ def getFileSuffix(filename) {
def match = filename =~ /^.*?((\.\w{1,5})?(\.\w{1,5}\.gz$))/
return match ? match[0][1] : filename.substring(filename.lastIndexOf('.'))
}
-
diff --git a/modules/nf-core/cat/cat/meta.yml b/modules/nf-core/cat/cat/meta.yml
index 00a8db0b..36a7359b 100644
--- a/modules/nf-core/cat/cat/meta.yml
+++ b/modules/nf-core/cat/cat/meta.yml
@@ -9,25 +9,52 @@ tools:
description: Just concatenation
documentation: https://man7.org/linux/man-pages/man1/cat.1.html
licence: ["GPL-3.0-or-later"]
+ identifier: ""
input:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - files_in:
- type: file
- description: List of compressed / uncompressed files
- pattern: "*"
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - files_in:
+ type: file
+ description: List of compressed / uncompressed files
+ pattern: "*"
+ ontologies: []
output:
- - versions:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
- - file_out:
- type: file
- description: Concatenated file. Will be gzipped if file_out ends with ".gz"
- pattern: "${file_out}"
+ file_out:
+ - - meta:
+ type: map
+ description: Groovy Map containing sample information
+ - ${prefix}:
+ type: file
+ description: Concatenated file. Will be gzipped if file_out ends with
+ ".gz"
+ pattern: "${file_out}"
+ ontologies: []
+ versions_cat:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - pigz:
+ type: string
+ description: The name of the tool
+ - "pigz --version 2>&1 | sed 's/pigz //g'":
+ type: eval
+ description: The expression to obtain the version of the tool
+
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - pigz:
+ type: string
+ description: The name of the tool
+ - "pigz --version 2>&1 | sed 's/pigz //g'":
+ type: eval
+ description: The expression to obtain the version of the tool
+
authors:
- "@erikrikarddaniel"
- "@FriederikeHanssen"
diff --git a/modules/nf-core/cat/cat/tests/main.nf.test b/modules/nf-core/cat/cat/tests/main.nf.test
index fcee2d19..030c6649 100644
--- a/modules/nf-core/cat/cat/tests/main.nf.test
+++ b/modules/nf-core/cat/cat/tests/main.nf.test
@@ -3,16 +3,14 @@ nextflow_process {
name "Test Process CAT_CAT"
script "../main.nf"
process "CAT_CAT"
+
tag "modules"
tag "modules_nfcore"
tag "cat"
tag "cat/cat"
- test("test_cat_name_conflict") {
+ test("sarscov2 - genome - error: name conflict") {
when {
- params {
- outdir = "${outputDir}"
- }
process {
"""
input[0] =
@@ -29,16 +27,14 @@ nextflow_process {
then {
assertAll(
{ assert !process.success },
- { assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") }
+ { assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") },
+ { assert snapshot(process.out).match() }
)
}
}
- test("test_cat_unzipped_unzipped") {
+ test("sarscov2 - [ fasta, sizes ] - unzipped") {
when {
- params {
- outdir = "${outputDir}"
- }
process {
"""
input[0] =
@@ -61,11 +57,8 @@ nextflow_process {
}
- test("test_cat_zipped_zipped") {
+ test("sarscov2 - [ gff3_gz, maf_gz ] - zipped") {
when {
- params {
- outdir = "${outputDir}"
- }
process {
"""
input[0] =
@@ -80,21 +73,20 @@ nextflow_process {
}
}
then {
- def lines = path(process.out.file_out.get(0).get(1)).linesGzip
assertAll(
{ assert process.success },
- { assert snapshot(lines[0..5]).match("test_cat_zipped_zipped_lines") },
- { assert snapshot(lines.size()).match("test_cat_zipped_zipped_size")}
+ { assert snapshot(process.out).match()
+ }
)
}
}
- test("test_cat_zipped_unzipped") {
- config './nextflow_zipped_unzipped.config'
+ test("sarscov2 - [ gff3_gz, maf_gz ] - unzipped") {
+ config './nextflow.config'
when {
params {
- outdir = "${outputDir}"
+ cat_prefix = "cat.txt"
}
process {
"""
@@ -119,11 +111,12 @@ nextflow_process {
}
- test("test_cat_unzipped_zipped") {
- config './nextflow_unzipped_zipped.config'
+ test("sarscov2 - [ fasta, sizes ] - zipped") {
+ config './nextflow.config'
+
when {
params {
- outdir = "${outputDir}"
+ cat_prefix = "cat.txt.gz"
}
process {
"""
@@ -139,21 +132,44 @@ nextflow_process {
}
}
then {
- def lines = path(process.out.file_out.get(0).get(1)).linesGzip
assertAll(
{ assert process.success },
- { assert snapshot(lines[0..5]).match("test_cat_unzipped_zipped_lines") },
- { assert snapshot(lines.size()).match("test_cat_unzipped_zipped_size")}
+ { assert snapshot(process.out).match() }
)
}
}
- test("test_cat_one_file_unzipped_zipped") {
- config './nextflow_unzipped_zipped.config'
+ test("sarscov2 - fasta - zipped") {
+ config './nextflow.config'
+
when {
params {
- outdir = "${outputDir}"
+ cat_prefix = "cat.txt.gz"
+ }
+ process {
+ """
+ input[0] =
+ [
+ [ id:'test', single_end:true ],
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+ ]
+ ]
+ """
}
+ }
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("sarscov2 - fasta - unzipped - stub") {
+ options "-stub"
+
+ when {
process {
"""
input[0] =
@@ -167,11 +183,9 @@ nextflow_process {
}
}
then {
- def lines = path(process.out.file_out.get(0).get(1)).linesGzip
assertAll(
{ assert process.success },
- { assert snapshot(lines[0..5]).match("test_cat_one_file_unzipped_zipped_lines") },
- { assert snapshot(lines.size()).match("test_cat_one_file_unzipped_zipped_size")}
+ { assert snapshot(process.out).match() }
)
}
}
diff --git a/modules/nf-core/cat/cat/tests/main.nf.test.snap b/modules/nf-core/cat/cat/tests/main.nf.test.snap
index 423571ba..5b4e4cc3 100644
--- a/modules/nf-core/cat/cat/tests/main.nf.test.snap
+++ b/modules/nf-core/cat/cat/tests/main.nf.test.snap
@@ -1,11 +1,5 @@
{
- "test_cat_unzipped_zipped_size": {
- "content": [
- 375
- ],
- "timestamp": "2023-10-16T14:33:08.049445686"
- },
- "test_cat_unzipped_unzipped": {
+ "sarscov2 - [ gff3_gz, maf_gz ] - unzipped": {
"content": [
{
"0": [
@@ -14,11 +8,15 @@
"id": "test",
"single_end": true
},
- "test.fasta:md5,f44b33a0e441ad58b2d3700270e2dbe2"
+ "cat.txt:md5,c439d3b60e7bc03e8802a451a0d9a5d9"
]
],
"1": [
- "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
+ [
+ "CAT_CAT",
+ "pigz",
+ "2.8"
+ ]
],
"file_out": [
[
@@ -26,17 +24,25 @@
"id": "test",
"single_end": true
},
- "test.fasta:md5,f44b33a0e441ad58b2d3700270e2dbe2"
+ "cat.txt:md5,c439d3b60e7bc03e8802a451a0d9a5d9"
]
],
- "versions": [
- "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
+ "versions_cat": [
+ [
+ "CAT_CAT",
+ "pigz",
+ "2.8"
+ ]
]
}
],
- "timestamp": "2023-10-16T14:32:18.500464399"
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T09:08:31.479828"
},
- "test_cat_zipped_unzipped": {
+ "sarscov2 - fasta - unzipped - stub": {
"content": [
{
"0": [
@@ -45,11 +51,15 @@
"id": "test",
"single_end": true
},
- "cat.txt:md5,c439d3b60e7bc03e8802a451a0d9a5d9"
+ "test.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
"1": [
- "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
+ [
+ "CAT_CAT",
+ "pigz",
+ "2.8"
+ ]
],
"file_out": [
[
@@ -57,65 +67,217 @@
"id": "test",
"single_end": true
},
- "cat.txt:md5,c439d3b60e7bc03e8802a451a0d9a5d9"
+ "test.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "versions": [
- "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
+ "versions_cat": [
+ [
+ "CAT_CAT",
+ "pigz",
+ "2.8"
+ ]
]
}
],
- "timestamp": "2023-10-16T14:32:49.642741302"
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T16:16:28.118094"
},
- "test_cat_zipped_zipped_lines": {
+ "sarscov2 - [ fasta, sizes ] - zipped": {
"content": [
- [
- "MT192765.1\tGenbank\ttranscript\t259\t29667\t.\t+\t.\tID=unknown_transcript_1;geneID=orf1ab;gene_name=orf1ab",
- "MT192765.1\tGenbank\tgene\t259\t21548\t.\t+\t.\tParent=unknown_transcript_1",
- "MT192765.1\tGenbank\tCDS\t259\t13461\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1",
- "MT192765.1\tGenbank\tCDS\t13461\t21548\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1",
- "MT192765.1\tGenbank\tCDS\t21556\t25377\t.\t+\t0\tParent=unknown_transcript_1;gbkey=CDS;gene=S;note=\"structural protein\";product=\"surface glycoprotein\";protein_id=QIK50427.1",
- "MT192765.1\tGenbank\tgene\t21556\t25377\t.\t+\t.\tParent=unknown_transcript_1"
- ]
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "cat.txt.gz:md5,f44b33a0e441ad58b2d3700270e2dbe2"
+ ]
+ ],
+ "1": [
+ [
+ "CAT_CAT",
+ "pigz",
+ "2.8"
+ ]
+ ],
+ "file_out": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "cat.txt.gz:md5,f44b33a0e441ad58b2d3700270e2dbe2"
+ ]
+ ],
+ "versions_cat": [
+ [
+ "CAT_CAT",
+ "pigz",
+ "2.8"
+ ]
+ ]
+ }
],
- "timestamp": "2023-10-16T14:32:33.629048645"
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T16:15:56.529595"
},
- "test_cat_unzipped_zipped_lines": {
+ "sarscov2 - genome - error: name conflict": {
"content": [
- [
- ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome",
- "GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT",
- "GTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAG",
- "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG",
- "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT",
- "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG"
- ]
+ {
+ "0": [
+
+ ],
+ "1": [
+
+ ],
+ "file_out": [
+
+ ],
+ "versions_cat": [
+
+ ]
+ }
],
- "timestamp": "2023-10-16T14:33:08.038830506"
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T16:14:54.496538"
},
- "test_cat_one_file_unzipped_zipped_lines": {
+ "sarscov2 - [ fasta, sizes ] - unzipped": {
"content": [
- [
- ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome",
- "GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT",
- "GTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAG",
- "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG",
- "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT",
- "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG"
- ]
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fasta:md5,f44b33a0e441ad58b2d3700270e2dbe2"
+ ]
+ ],
+ "1": [
+ [
+ "CAT_CAT",
+ "pigz",
+ "2.8"
+ ]
+ ],
+ "file_out": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fasta:md5,f44b33a0e441ad58b2d3700270e2dbe2"
+ ]
+ ],
+ "versions_cat": [
+ [
+ "CAT_CAT",
+ "pigz",
+ "2.8"
+ ]
+ ]
+ }
],
- "timestamp": "2023-10-16T14:33:21.39642399"
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T11:26:29.942203"
},
- "test_cat_zipped_zipped_size": {
+ "sarscov2 - [ gff3_gz, maf_gz ] - zipped": {
"content": [
- 78
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.gff3.gz:md5,c439d3b60e7bc03e8802a451a0d9a5d9"
+ ]
+ ],
+ "1": [
+ [
+ "CAT_CAT",
+ "pigz",
+ "2.8"
+ ]
+ ],
+ "file_out": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.gff3.gz:md5,c439d3b60e7bc03e8802a451a0d9a5d9"
+ ]
+ ],
+ "versions_cat": [
+ [
+ "CAT_CAT",
+ "pigz",
+ "2.8"
+ ]
+ ]
+ }
],
- "timestamp": "2023-10-16T14:32:33.641869244"
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T11:26:45.679401"
},
- "test_cat_one_file_unzipped_zipped_size": {
+ "sarscov2 - fasta - zipped": {
"content": [
- 374
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "cat.txt.gz:md5,6e9fe4042a72f2345f644f239272b7e6"
+ ]
+ ],
+ "1": [
+ [
+ "CAT_CAT",
+ "pigz",
+ "2.8"
+ ]
+ ],
+ "file_out": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "cat.txt.gz:md5,6e9fe4042a72f2345f644f239272b7e6"
+ ]
+ ],
+ "versions_cat": [
+ [
+ "CAT_CAT",
+ "pigz",
+ "2.8"
+ ]
+ ]
+ }
],
- "timestamp": "2023-10-16T14:33:21.4094373"
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T16:16:12.439911"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/cat/cat/tests/nextflow.config b/modules/nf-core/cat/cat/tests/nextflow.config
new file mode 100644
index 00000000..5bc9bf50
--- /dev/null
+++ b/modules/nf-core/cat/cat/tests/nextflow.config
@@ -0,0 +1,6 @@
+
+process {
+ withName: CAT_CAT {
+ ext.prefix = "${params.cat_prefix}"
+ }
+}
diff --git a/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config b/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config
deleted file mode 100644
index ec26b0fd..00000000
--- a/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config
+++ /dev/null
@@ -1,6 +0,0 @@
-
-process {
- withName: CAT_CAT {
- ext.prefix = 'cat.txt.gz'
- }
-}
diff --git a/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config b/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config
deleted file mode 100644
index fbc79783..00000000
--- a/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config
+++ /dev/null
@@ -1,8 +0,0 @@
-
-process {
-
- withName: CAT_CAT {
- ext.prefix = 'cat.txt'
- }
-
-}
diff --git a/modules/nf-core/cat/cat/tests/tags.yml b/modules/nf-core/cat/cat/tests/tags.yml
deleted file mode 100644
index 37b578f5..00000000
--- a/modules/nf-core/cat/cat/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-cat/cat:
- - modules/nf-core/cat/cat/**
diff --git a/modules/nf-core/cat/fastq/cat-fastq.diff b/modules/nf-core/cat/fastq/cat-fastq.diff
index 37e6ce28..e51fbf6a 100644
--- a/modules/nf-core/cat/fastq/cat-fastq.diff
+++ b/modules/nf-core/cat/fastq/cat-fastq.diff
@@ -4,53 +4,47 @@ Changes in component 'nf-core/cat/fastq'
Changes in 'cat/fastq/main.nf':
--- modules/nf-core/cat/fastq/main.nf
+++ modules/nf-core/cat/fastq/main.nf
+@@ -14,7 +14,7 @@
+ tuple val(meta), path("*.merged.fastq.gz"), emit: reads
+- tuple val("${task.process}"), val("cat"), eval("cat --version 2>&1 | head -n 1 | sed 's/^.*coreutils) //; s/ .*\$//'"), emit: versions_cat, topic: versions
++ tuple val("${task.process}"), val("python"), eval("python --version | sed 's/Python //'"), emit: versions_python, topic: versions
+
@@ -20,34 +20,20 @@
script:
- def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}"
-- def readList = reads instanceof List ? reads.collect{ it.toString() } : [reads.toString()]
+- def readList = reads instanceof List ? reads.collect { item -> item.toString() } : [reads.toString()]
+- def compress = readList[0]?.endsWith('.gz') ? '' : '| gzip'
- if (meta.single_end) {
- if (readList.size >= 1) {
- """
-- cat ${readList.join(' ')} > ${prefix}.merged.fastq.gz
-+ def read_list_str = reads instanceof List ? reads.join(' ') : reads.toString()
-+ def single_end_flag = meta.single_end ? '--single_end' : ''
-
-- cat <<-END_VERSIONS > versions.yml
-- "${task.process}":
-- cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//')
-- END_VERSIONS
+- cat ${readList.join(' ')} ${compress} > ${prefix}.merged.fastq.gz
- """
+- } else {
+- error("Could not find any FASTQ files to concatenate in the process input")
- }
-- } else {
+- }
+- else {
- if (readList.size >= 2) {
- def read1 = []
- def read2 = []
-- readList.eachWithIndex{ v, ix -> ( ix & 1 ? read2 : read1 ) << v }
+- readList.eachWithIndex { v, ix -> (ix & 1 ? read2 : read1) << v }
- """
-- cat ${read1.join(' ')} > ${prefix}_1.merged.fastq.gz
-- cat ${read2.join(' ')} > ${prefix}_2.merged.fastq.gz
+- cat ${read1.join(' ')} ${compress} > ${prefix}_1.merged.fastq.gz
+- cat ${read2.join(' ')} ${compress} > ${prefix}_2.merged.fastq.gz
+- """
+- } else {
+- error("Could not find any FASTQ file pairs to concatenate in the process input")
+- }
+- }
++ def read_list_str = reads instanceof List ? reads.join(' ') : reads.toString()
++ def single_end_flag = meta.single_end ? '--single_end' : ''
++
+ """
+ cat_fastq.py \\
+ --prefix ${prefix} \\
+ ${single_end_flag} \\
+ --reads ${read_list_str}
-
-- cat <<-END_VERSIONS > versions.yml
-- "${task.process}":
-- cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//')
-- END_VERSIONS
-- """
-- }
-- }
-+ cat <<-END_VERSIONS > versions.yml
-+ "${task.process}":
-+ python: \$(python --version | sed 's/Python //')
-+ END_VERSIONS
+ """
-
- stub:
- def prefix = task.ext.prefix ?: "${meta.id}"
'modules/nf-core/cat/fastq/tests/tags.yml' is unchanged
'modules/nf-core/cat/fastq/tests/main.nf.test' is unchanged
diff --git a/modules/nf-core/cat/fastq/environment.yml b/modules/nf-core/cat/fastq/environment.yml
index 8c69b121..9b926b1f 100644
--- a/modules/nf-core/cat/fastq/environment.yml
+++ b/modules/nf-core/cat/fastq/environment.yml
@@ -1,7 +1,12 @@
-name: cat_fastq
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
channels:
- conda-forge
- bioconda
- - defaults
dependencies:
- - conda-forge::coreutils=8.30
+ - conda-forge::coreutils=9.5
+ - conda-forge::grep=3.11
+ - conda-forge::gzip=1.13
+ - conda-forge::lbzip2=2.5
+ - conda-forge::sed=4.8
+ - conda-forge::tar=1.34
diff --git a/modules/nf-core/cat/fastq/main.nf b/modules/nf-core/cat/fastq/main.nf
index d93005eb..ea2d64c6 100644
--- a/modules/nf-core/cat/fastq/main.nf
+++ b/modules/nf-core/cat/fastq/main.nf
@@ -1,24 +1,23 @@
process CAT_FASTQ {
- tag "$meta.id"
+ tag "${meta.id}"
label 'process_single'
conda "${moduleDir}/environment.yml"
- container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' :
- 'nf-core/ubuntu:20.04' }"
+ container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container
+ ? 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/52/52ccce28d2ab928ab862e25aae26314d69c8e38bd41ca9431c67ef05221348aa/data'
+ : 'community.wave.seqera.io/library/coreutils_grep_gzip_lbzip2_pruned:838ba80435a629f8'}"
input:
tuple val(meta), path(reads, stageAs: "input*/*")
output:
tuple val(meta), path("*.merged.fastq.gz"), emit: reads
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val("python"), eval("python --version | sed 's/Python //'"), emit: versions_python, topic: versions
when:
task.ext.when == null || task.ext.when
script:
- def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}"
def read_list_str = reads instanceof List ? reads.join(' ') : reads.toString()
def single_end_flag = meta.single_end ? '--single_end' : ''
@@ -28,38 +27,28 @@ process CAT_FASTQ {
--prefix ${prefix} \\
${single_end_flag} \\
--reads ${read_list_str}
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- python: \$(python --version | sed 's/Python //')
- END_VERSIONS
"""
stub:
def prefix = task.ext.prefix ?: "${meta.id}"
- def readList = reads instanceof List ? reads.collect{ it.toString() } : [reads.toString()]
+ def readList = reads instanceof List ? reads.collect { item -> item.toString() } : [reads.toString()]
if (meta.single_end) {
- if (readList.size > 1) {
+ if (readList.size >= 1) {
"""
- touch ${prefix}.merged.fastq.gz
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//')
- END_VERSIONS
+ echo '' | gzip > ${prefix}.merged.fastq.gz
"""
+ } else {
+ error("Could not find any FASTQ files to concatenate in the process input")
}
- } else {
- if (readList.size > 2) {
+ }
+ else {
+ if (readList.size >= 2) {
"""
- touch ${prefix}_1.merged.fastq.gz
- touch ${prefix}_2.merged.fastq.gz
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//')
- END_VERSIONS
+ echo '' | gzip > ${prefix}_1.merged.fastq.gz
+ echo '' | gzip > ${prefix}_2.merged.fastq.gz
"""
+ } else {
+ error("Could not find any FASTQ file pairs to concatenate in the process input")
}
}
}
diff --git a/modules/nf-core/cat/fastq/meta.yml b/modules/nf-core/cat/fastq/meta.yml
index db4ac3c7..6fefd6e0 100644
--- a/modules/nf-core/cat/fastq/meta.yml
+++ b/modules/nf-core/cat/fastq/meta.yml
@@ -1,39 +1,64 @@
name: cat_fastq
-description: Concatenates fastq files
+description: Concatenates fastq files. Supports both compressed (.gz) and uncompressed inputs; uncompressed files are automatically gzip-compressed during concatenation.
keywords:
- cat
- fastq
- concatenate
+ - compress
tools:
- cat:
description: |
The cat utility reads files sequentially, writing them to the standard output.
documentation: https://www.gnu.org/software/coreutils/manual/html_node/cat-invocation.html
licence: ["GPL-3.0-or-later"]
+ identifier: ""
input:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - reads:
- type: file
- description: |
- List of input FastQ files to be concatenated.
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - reads:
+ type: file
+ description: |
+ List of input FastQ files to be concatenated.
+ Accepts both gzip-compressed (.fastq.gz) and uncompressed (.fastq) files.
+ ontologies: []
output:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - reads:
- type: file
- description: Merged fastq file
- pattern: "*.{merged.fastq.gz}"
- - versions:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ reads:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "*.merged.fastq.gz":
+ type: file
+ description: Merged fastq file
+ pattern: "*.{merged.fastq.gz}"
+ ontologies: []
+ versions_cat:
+ - - ${task.process}:
+ type: string
+ description: The process the versions were collected from
+ - cat:
+ type: string
+ description: The tool name
+ - cat --version 2>&1 | head -n 1 | sed 's/^.*coreutils) //; s/ .*\$//':
+ type: eval
+ description: The expression to obtain the version of the tool
+
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The process the versions were collected from
+ - cat:
+ type: string
+ description: The tool name
+ - cat --version 2>&1 | head -n 1 | sed 's/^.*coreutils) //; s/ .*\$//':
+ type: eval
+ description: The expression to obtain the version of the tool
+
authors:
- "@joseespinosa"
- "@drpatelh"
diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test b/modules/nf-core/cat/fastq/tests/main.nf.test
index dab2e14c..21052d90 100644
--- a/modules/nf-core/cat/fastq/tests/main.nf.test
+++ b/modules/nf-core/cat/fastq/tests/main.nf.test
@@ -7,13 +7,11 @@ nextflow_process {
tag "modules_nfcore"
tag "cat"
tag "cat/fastq"
+ tag "gunzip"
test("test_cat_fastq_single_end") {
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -36,9 +34,6 @@ nextflow_process {
test("test_cat_fastq_paired_end") {
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -63,9 +58,6 @@ nextflow_process {
test("test_cat_fastq_single_end_same_name") {
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -88,9 +80,6 @@ nextflow_process {
test("test_cat_fastq_paired_end_same_name") {
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -112,12 +101,202 @@ nextflow_process {
}
}
+ test("test_cat_fastq_single_end_uncompressed") {
+
+ setup {
+ run("GUNZIP") {
+ script "../../../gunzip/main.nf"
+ process {
+ """
+ input[0] = Channel.of(
+ [[ id:'r1' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)],
+ [[ id:'r2' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)]
+ )
+ """
+ }
+ }
+ }
+
+ when {
+ process {
+ """
+ input[0] = GUNZIP.out.gunzip
+ .toSortedList { a, b -> a[0].id <=> b[0].id }
+ .map { items -> [[ id: 'test', single_end: true ], items.collect { it[1] }] }
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_paired_end_uncompressed") {
+
+ setup {
+ run("GUNZIP") {
+ script "../../../gunzip/main.nf"
+ process {
+ """
+ input[0] = Channel.of(
+ [[ id:'a' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)],
+ [[ id:'b' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)],
+ [[ id:'c' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true)],
+ [[ id:'d' ], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true)]
+ )
+ """
+ }
+ }
+ }
+
+ when {
+ process {
+ """
+ input[0] = GUNZIP.out.gunzip
+ .toSortedList { a, b -> a[0].id <=> b[0].id }
+ .map { items -> [[ id: 'test', single_end: false ], items.collect { it[1] }] }
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
test("test_cat_fastq_single_end_single_file") {
when {
- params {
- outdir = "$outputDir"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)]
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_single_end - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)]
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_paired_end - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true)]
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_single_end_same_name - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)]
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_paired_end_same_name - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)]
+ ])
+ """
}
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_single_end_single_file - stub") {
+
+ options "-stub"
+
+ when {
process {
"""
input[0] = Channel.of([
@@ -135,4 +314,92 @@ nextflow_process {
)
}
}
+
+ test("test_cat_fastq_single_end_no_files") {
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ []
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.failed },
+ { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_paired_end_no_files") {
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ []
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.failed },
+ { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_single_end_no_files - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ []
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.failed },
+ { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_paired_end_no_files - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ []
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.failed },
+ { assert snapshot(process.stdout.find { it.contains("-- Check script") }.split(" -- Check script")[0]).match() }
+ )
+ }
+ }
}
diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test.snap b/modules/nf-core/cat/fastq/tests/main.nf.test.snap
index 43dfe28f..6375b2ab 100644
--- a/modules/nf-core/cat/fastq/tests/main.nf.test.snap
+++ b/modules/nf-core/cat/fastq/tests/main.nf.test.snap
@@ -1,4 +1,247 @@
{
+ "test_cat_fastq_paired_end_no_files - stub": {
+ "content": [
+ " Could not find any FASTQ file pairs to concatenate in the process input"
+ ],
+ "meta": {
+ "nf-test": "0.9.2",
+ "nextflow": "24.10.4"
+ },
+ "timestamp": "2025-02-25T17:14:51.248685461"
+ },
+ "test_cat_fastq_single_end_single_file": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec"
+ ]
+ ],
+ "1": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec"
+ ]
+ ],
+ "versions_cat": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T14:31:42.84401526"
+ },
+ "test_cat_fastq_paired_end_same_name": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22",
+ "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22",
+ "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5"
+ ]
+ ]
+ ],
+ "versions_cat": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T14:31:36.820489323"
+ },
+ "test_cat_fastq_paired_end_same_name - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "versions_cat": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T14:32:06.262192935"
+ },
+ "test_cat_fastq_single_end_uncompressed": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da"
+ ]
+ ],
+ "1": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da"
+ ]
+ ],
+ "versions_cat": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-02-09T10:03:24.344628"
+ },
+ "test_cat_fastq_paired_end_uncompressed": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22",
+ "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22",
+ "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5"
+ ]
+ ]
+ ],
+ "versions_cat": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-02-09T10:03:37.568053"
+ },
"test_cat_fastq_single_end": {
"content": [
{
@@ -12,7 +255,11 @@
]
],
"1": [
- "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
],
"reads": [
[
@@ -23,12 +270,20 @@
"test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da"
]
],
- "versions": [
- "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ "versions_cat": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
]
}
],
- "timestamp": "2024-01-17T17:30:39.816981"
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T14:31:18.859169785"
},
"test_cat_fastq_single_end_same_name": {
"content": [
@@ -43,7 +298,11 @@
]
],
"1": [
- "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
],
"reads": [
[
@@ -54,14 +313,22 @@
"test.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22"
]
],
- "versions": [
- "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ "versions_cat": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
]
}
],
- "timestamp": "2024-01-17T17:32:35.229332"
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T14:31:30.942615287"
},
- "test_cat_fastq_single_end_single_file": {
+ "test_cat_fastq_single_end - stub": {
"content": [
{
"0": [
@@ -70,11 +337,15 @@
"id": "test",
"single_end": true
},
- "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec"
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
],
"1": [
- "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
],
"reads": [
[
@@ -82,17 +353,88 @@
"id": "test",
"single_end": true
},
- "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec"
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
],
- "versions": [
- "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ "versions_cat": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
]
}
],
- "timestamp": "2024-01-17T17:34:00.058829"
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T14:31:48.827990633"
},
- "test_cat_fastq_paired_end_same_name": {
+ "test_cat_fastq_paired_end_no_files": {
+ "content": [
+ " Could not find any FASTQ file pairs to concatenate in the process input"
+ ],
+ "meta": {
+ "nf-test": "0.9.2",
+ "nextflow": "24.10.4"
+ },
+ "timestamp": "2025-02-25T17:14:40.806088747"
+ },
+ "test_cat_fastq_single_end_no_files - stub": {
+ "content": [
+ " Could not find any FASTQ files to concatenate in the process input"
+ ],
+ "meta": {
+ "nf-test": "0.9.2",
+ "nextflow": "24.10.4"
+ },
+ "timestamp": "2025-02-25T17:14:45.852365218"
+ },
+ "test_cat_fastq_single_end_same_name - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "1": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "versions_cat": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T14:32:00.586584379"
+ },
+ "test_cat_fastq_paired_end": {
"content": [
{
"0": [
@@ -108,7 +450,11 @@
]
],
"1": [
- "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
],
"reads": [
[
@@ -122,14 +468,32 @@
]
]
],
- "versions": [
- "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ "versions_cat": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
]
}
],
- "timestamp": "2024-01-17T17:33:33.031555"
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T14:31:25.159365603"
},
- "test_cat_fastq_paired_end": {
+ "test_cat_fastq_single_end_no_files": {
+ "content": [
+ " Could not find any FASTQ files to concatenate in the process input"
+ ],
+ "meta": {
+ "nf-test": "0.9.2",
+ "nextflow": "24.10.4"
+ },
+ "timestamp": "2025-02-25T17:14:35.695192409"
+ },
+ "test_cat_fastq_paired_end - stub": {
"content": [
{
"0": [
@@ -139,13 +503,17 @@
"single_end": false
},
[
- "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22",
- "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5"
+ "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
]
],
"1": [
- "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
],
"reads": [
[
@@ -154,16 +522,67 @@
"single_end": false
},
[
- "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22",
- "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5"
+ "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
]
],
- "versions": [
- "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ "versions_cat": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T14:31:54.850702874"
+ },
+ "test_cat_fastq_single_end_single_file - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "1": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "versions_cat": [
+ [
+ "CAT_FASTQ",
+ "cat",
+ "9.5"
+ ]
]
}
],
- "timestamp": "2024-01-17T17:32:02.270935"
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2025-12-10T14:32:11.746498148"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/cat/fastq/tests/tags.yml b/modules/nf-core/cat/fastq/tests/tags.yml
deleted file mode 100644
index 6ac43614..00000000
--- a/modules/nf-core/cat/fastq/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-cat/fastq:
- - modules/nf-core/cat/fastq/**
diff --git a/modules/nf-core/custom/dumpsoftwareversions/environment.yml b/modules/nf-core/custom/dumpsoftwareversions/environment.yml
index b48ced26..c3b3413f 100644
--- a/modules/nf-core/custom/dumpsoftwareversions/environment.yml
+++ b/modules/nf-core/custom/dumpsoftwareversions/environment.yml
@@ -1,7 +1,7 @@
-name: custom_dumpsoftwareversions
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
channels:
- conda-forge
- bioconda
- - defaults
dependencies:
- - bioconda::multiqc=1.20
+ - bioconda::multiqc=1.27
diff --git a/modules/nf-core/custom/dumpsoftwareversions/main.nf b/modules/nf-core/custom/dumpsoftwareversions/main.nf
index 105f9265..874e18cc 100644
--- a/modules/nf-core/custom/dumpsoftwareversions/main.nf
+++ b/modules/nf-core/custom/dumpsoftwareversions/main.nf
@@ -4,8 +4,8 @@ process CUSTOM_DUMPSOFTWAREVERSIONS {
// Requires `pyyaml` which does not have a dedicated container but is in the MultiQC container
conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/multiqc:1.20--pyhdfd78af_0' :
- 'biocontainers/multiqc:1.20--pyhdfd78af_0' }"
+ 'https://depot.galaxyproject.org/singularity/multiqc:1.27--pyhdfd78af_0' :
+ 'biocontainers/multiqc:1.27--pyhdfd78af_0' }"
input:
path versions
@@ -19,6 +19,14 @@ process CUSTOM_DUMPSOFTWAREVERSIONS {
task.ext.when == null || task.ext.when
script:
- def args = task.ext.args ?: ''
+ def deprecation_message = """
+WARNING: This module has been deprecated.
+
+Reason:
+This module is no longer recommended for use, as it is replaced by the function softwareVersionsToYAML
+in the utils_nfcore_pipeline subworkflow that is included in the nf-core template.
+
+"""
+ assert false: deprecation_message
template 'dumpsoftwareversions.py'
}
diff --git a/modules/nf-core/custom/dumpsoftwareversions/meta.yml b/modules/nf-core/custom/dumpsoftwareversions/meta.yml
index 5f15a5fd..b81907e6 100644
--- a/modules/nf-core/custom/dumpsoftwareversions/meta.yml
+++ b/modules/nf-core/custom/dumpsoftwareversions/meta.yml
@@ -1,34 +1,48 @@
# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json
name: custom_dumpsoftwareversions
-description: Custom module used to dump software versions within the nf-core pipeline template
+description: Custom module used to dump software versions within the nf-core pipeline
+ template
keywords:
- custom
- dump
- version
tools:
- custom:
- description: Custom module used to dump software versions within the nf-core pipeline template
+ description: Custom module used to dump software versions within the nf-core pipeline
+ template
homepage: https://github.com/nf-core/tools
documentation: https://github.com/nf-core/tools
licence: ["MIT"]
+ identifier: ""
input:
- versions:
type: file
description: YML file containing software versions
pattern: "*.yml"
+ ontologies:
+ - edam: http://edamontology.org/format_3750 # YAML
output:
- - yml:
- type: file
- description: Standard YML file containing software versions
- pattern: "software_versions.yml"
- - mqc_yml:
- type: file
- description: MultiQC custom content YML file containing software versions
- pattern: "software_versions_mqc.yml"
- - versions:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ yml:
+ - software_versions.yml:
+ type: file
+ description: Standard YML file containing software versions
+ pattern: "software_versions.yml"
+ ontologies:
+ - edam: http://edamontology.org/format_3750 # YAML
+ mqc_yml:
+ - software_versions_mqc.yml:
+ type: file
+ description: MultiQC custom content YML file containing software versions
+ pattern: "software_versions_mqc.yml"
+ ontologies:
+ - edam: http://edamontology.org/format_3750 # YAML
+ versions:
+ - versions.yml:
+ type: file
+ description: File containing software versions
+ pattern: "versions.yml"
+ ontologies:
+ - edam: http://edamontology.org/format_3750 # YAML
authors:
- "@drpatelh"
- "@grst"
diff --git a/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py b/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py
index da033408..aa40e5e3 100755
--- a/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py
+++ b/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py
@@ -3,11 +3,11 @@
"""Provide functions to merge multiple versions.yml files."""
-
-import yaml
import platform
from textwrap import dedent
+import yaml
+
def _make_versions_html(versions):
"""Generate a tabular HTML output of all versions for MultiQC."""
@@ -37,7 +37,7 @@ def _make_versions_html(versions):
dedent(
f"""\\
- | {process if (i == 0) else ''} |
+ {process if (i == 0) else ""} |
{tool} |
{version} |
diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test
index b1e1630b..296c2c90 100644
--- a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test
+++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test
@@ -30,13 +30,7 @@ nextflow_process {
then {
assertAll(
- { assert process.success },
- { assert snapshot(
- process.out.versions,
- file(process.out.mqc_yml[0]).readLines()[0..10],
- file(process.out.yml[0]).readLines()[0..7]
- ).match()
- }
+ { assert process.failed }
)
}
}
diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap
index 5f59a936..74e42fb1 100644
--- a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap
+++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap
@@ -2,7 +2,7 @@
"Should run without failures": {
"content": [
[
- "versions.yml:md5,76d454d92244589d32455833f7c1ba6d"
+ "versions.yml:md5,42bedca466554ea4ad0b586f8a18be28"
],
[
"data: \"