From 010aec9e047846f453e7b3fccaccd082144e4391 Mon Sep 17 00:00:00 2001 From: mattloose Date: Thu, 14 Jul 2022 17:25:03 +0100 Subject: [PATCH] Update MPV_3000.primer.bed The new primer added at line 1 is missing strand information and so breaks the bed format - here we've added in the strand information on line 1 - but you would now have two primers with the same name and different strands - not sure if that breaks any downstream tools. --- v1.1/MPV_3000.primer.bed | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/v1.1/MPV_3000.primer.bed b/v1.1/MPV_3000.primer.bed index c4693e1..2fdc53e 100644 --- a/v1.1/MPV_3000.primer.bed +++ b/v1.1/MPV_3000.primer.bed @@ -1,4 +1,4 @@ -AY753185.1 0 33 MPV_3000_82_RIGHT 3 AACTCTAGAGGGTAAGAAAAATCAATCGTTTAT +AY753185.1 0 33 MPV_3000_82_RIGHT 3 + AACTCTAGAGGGTAAGAAAAATCAATCGTTTAT AY753185.1 8972 8999 MPV_3000_4_RIGHT 3 - ATTCTATTGATCTAACGCTGTAYGACG AY753185.1 6449 6483 MPV_3000_4_LEFT 2 + GATCTGAGATAAATTATACAATCTTCGCTATCGA AY753185.1 8972 8999 MPV_3000_4_RIGHT 2 - ATTCTATTGATCTAACGCTGTAYGACG