Gene sequence of TRBV31*01 of the mouse_T_beta default model does not match the IMGT gene sequence

[GabevandenHoeven]

Hello again,

I was diving into the source code of the VDJ sequence generation for my research project (I explained more in the issue linked here: #17 ), I wanted to also annotate for each of the generated sequences which segments were used. Since in the source code you used the index of a list of CDR3 + palindromal nt to refer to the segments, I matched the CDR3 sequences back to the gene segments on IMGT, and I found all segments except for TRBV31*01.
Looking deeper into it, I found the sequences were derived from the model_params.txt file. The sequence in this file does not match the sequence found on IMGT. I don't know if there is a reason for this, if so I'd like to know. The IMGT reference I'm talking about is found here:
https://www.imgt.org/ligmdb/view.action?id=IMGT000132

To make it easier I'll include the sequences here as well:
TRBV31*01 olga:
AGACTCCAGGCACAGAGGTAGAAGCCAGAGTGGCTGAGAAGCAGCTTCTCCGTGCTTAGGATGAATTGGTCGTCCTTCGGCCTGGAAGCTGAGAGGTTCAGTTGCACCACCGACTCTACCTGGCCAACAGTAATAGAGTAGAAGAGTTGCTGGAGGGTGCCTCCTGTGGCCTGCCAGTACCAGTAGAGGTTAGGGCTTGATTTCCCCTTTATGGTACACCCCAGAGACAGTGGGCTGCCCACAGCCTTGATCTCGGCAACTGGCCATTGATGGATAGTCTGAGC
TRBV31*01 IMGT:
GCTCAGACTATCCATCAATGGCCAGTTGCCGAGATCAAGGCTGTGGGCAGCCCACTGTCTCTGGGGTGTACCATAAAGGGGAAATCAAGCCCTAACCTCTACTGGTACTGGCAGGCCACAGGAGGCACCCTCCAGCAACTCTTCTACTCTATTACTGTTGGCCAGGTAGAGTCGGTGGTGCAACTGAACCTCTCAGCTTCCAGGCCGAAGGACGACCAATTCATCCTAAGCACGGAGAAGCTGCTTCTCAGCCACTCTGGCTTCTACCTCTGTGCCTGGAGTCT

Kind regards,
Gabe van den Hoeven