To design custom probes for targeted biallelic SNPs
To target biallelic SNPs, bait-design creates two or four probes for each SNP target similar to that described in Haak et al 2015. If the two probe option is chosen (-n 2), the two probes are centred on the SNP, and are identical except for carrying alternate alleles. If the four probe option is chosen (-n 4), two of those probes are again centered on the SNP (each carrying one of alternate alleles), and additionally, one probe ends just before the SNP, and one starts just after.
The output will be in FASTA DNA sequence format for custom myBaits design
1 752565 752566 1_752566 A G
AAACAAAATTGGCAAGTAGAATTTAACTAAATGAAAGAGCTTCTGCACAGCAAGAGAAAC
TGAAAGAGCTTCTGCACAGCAAGAGAAACGTTTGACAGAGAATACAGACAACCTACTGAA
TGAAAGAGCTTCTGCACAGCAAGAGAAACATTTGACAGAGAATACAGACAACCTACTGAA
TTTGACAGAGAATACAGACAACCTACTGAATGAGAGAAACTATTTGCAAACTATGCATCT
- pybedtools
- numpy
- pandas
- argparse
- sys
- os
./bait-design
-h, --help "show this help message and exit"
-snp --selectedSNPs <filename> "Targeted SNP information file"
-fi --fastaFile <filename> "Input fasta file to bedtools"
-o --out <filename> "The name to give to the output file."
-len --ProbeLength <INT> "Length of probes to design [default=60]"
-n --ProbeNumber <INT> "Number of probes. Must be 2 or 4 [default=4].
If n=2 two probes are centred on the SNP will design
If n=4 four probes for each SNP target will design"./bait-design -snp targetedSNPs.txt -fi in.fasta./bait-design -snp targetedSNPs.txt -fi in.fasta -o out.fa./bait-design -snp targetedSNPs.txt -fi in.fasta -o out.fa -len 52./bait-design -snp targetedSNPs.txt -fi in.fasta -o out.fa -len 60 -n 2targetedSNPs.txt is a space-delimited text file that required six fields (without header)
- chr - The number/name of the chromosome
- posStart - The starting position of the SNP.
- posEnd - The ending position of the SNP.
- snpID - unique snp IDs
- allele1 - usually major allele
- allele2 - usually minor allele
example_targetedSNPs.txt
1 752565 752566 1_752566 G A
1 776545 776546 1_776546 G A
1 832917 832918 1_832918 C T
1 842012 842013 1_842013 G T
1 869302 869303 1_869303 T C
1 891020 891021 1_891021 G A
1 893461 893462 1_893462 C T
1 896270 896271 1_896271 C T
1 903425 903426 1_903426 T C
1 949653 949654 1_949654 A G