Add properties to Record class

secmet/record.py

@@ -2,6 +2,7 @@
 # Licensed under the APL2, see LICENSE for details
 """Secondary Metabolite Record Objects"""
 
+import Bio
 from Bio import SeqIO
 
 
@@ -15,19 +16,28 @@ def __init__(self, seq_record=None):
         :type seq_record:   :class:`Bio.SeqRecord.SeqRecord`
         """
         self._record = seq_record
-
+        self._cluster_cds = {}  #Dictionary to create cluster-cds hierarchy
 
     @classmethod
-    def from_genbank(cls, filename):
-        """Initialise a record from a GenBank file
+    def from_file(cls, filename, filetype):
+
+        """Initialise a record from a file of specified type
 
-        :param string filename:    file name of the GenBank file to read
+        :param string filename:    file name of the file to read
+        :param string filetype:    Type of the inputfile
         """
-        seq_record = SeqIO.read(filename, 'genbank')
+        if filetype in ['gb', 'genbank']:
+            type_of_file = 'genbank'
+        elif filetype in ['fa', 'fas', 'fasta']:
+            type_of_file = 'fasta'
+        elif filetype in ['emb', 'embl']:
+            type_of_file = 'embl'
+        else:
+            return None
+        seq_record = SeqIO.read(filename, type_of_file)
         rec = cls(seq_record=seq_record)
         return rec
 
-
     @property
     def id(self):
         """Pass through to seq_record object if available"""
@@ -36,7 +46,6 @@ def id(self):
         else:
             return "NO_ID_ASSIGNED"
 
-
     @property
     def seq(self):
         """Pass through to seq_record object if available"""
@@ -45,7 +54,6 @@ def seq(self):
         else:
             return None
 
-
     @property
     def annotations(self):
         """Pass through to seq_record object if available"""
@@ -63,10 +71,74 @@ def description(self):
             return ""
 
     @property
-    def clusters(self):
-        """A list of secondary metabolite clusters present in the record"""
-        if self._record is None:
+    def feature_types(self):
+        """Returns a list of all types of features present in the record"""
+        type_features = []
+        for i in self._record.features:
+            if i.type not in type_features:
+                type_features.append(i.type)
+        return type_features
+
+    def _features_by_type(self, f_type):
+        """Returns a list of features of specified f_type in the record
+        param string f_type: Name of the feature
+        """
+        if f_type in self.feature_types:
+            return [i for i in self._record.features if i.type == f_type]
+        else:
             return []
 
-        clusters = [i for i in self._record.features if i.type == 'cluster']
-        return clusters
+    def get_cds_from_gene(self, genes):
+        """Returns a list of CDS features corresponding to a list of gene features
+            :param list genes : List of gene features
+        """
+        cds_list = []
+        cdss = self._features_by_type('CDS')
+        for gene in genes:
+            if not isinstance(gene, Bio.SeqFeature.SeqFeature):
+                return None
+            else:
+                gene_name = gene.qualifiers['gene'][0]
+                for cds in cdss:
+                    if cds.qualifiers['gene'][0] == gene_name:
+                        cds_list.append(cds)
+                        cdss.remove(cds)    #Removing to reduce the number of operations
+        return cds_list
+
+    def get_gene_from_cds(self, cdss):
+        """Returns a list of gene features corresponding to a list of CDS features
+            :param cdss : List of CDS features
+        """
+        gene_list = []
+        genes = self._features_by_type('gene')
+        for cds in cdss:
+            if not isinstance(cds, Bio.SeqFeature.SeqFeature):
+                return None
+            else:
+                cds_name = cds.qualifiers['product'][0]
+                for gene in genes:
+                    if gene.qualifiers['gene'][0].lower() == cds_name.lower():
+                        gene_list.append(gene)
+                        genes.remove(gene)    #Removing to reduce the number of operations
+        return gene_list
+
+    def make_cluster_cds_pair(self, cluster_object, cds_list):
+        """Creates a dictionary of cluster objects with corresponding cds objects
+              :param cluster_object:  A cluster feature object
+              :param cds_list :  list of cds objects corresponding to the cluster object
+        """
+        self._cluster_cds[cluster_object] = cds_list
+
+    def get_cds_from_cluster(self, cluster_object):
+        """Returns the list of CDS feature objects of the given cluster_object
+            :param cluster_object: cluster feature object
+        """
+        return self._cluster_cds[cluster_object]
+
+    def get_cluster_from_cds(self, cds_object):
+        """Returns the cluster feature object of the given cds_object
+          :param CDS object: CDS feature object
+        """
+        for cluster, cds_list in self._cluster_cds.items():
+            if cds_object in cds_list:
+                return cluster

tests/data/sequence.fasta

@@ -0,0 +1,13 @@
+>J04057.1 S.lactis antibiotic nisin (spaN) gene, complete cds
+AGTTGACGAATATTTAATAATTTTATTAATATCTTGATTTTCTAGTTCCTGAATAATATAGAGATAGGTT
+TATTGAGTCTTAGACATACTTGAATGACCTAGTCTTATAACTATACTGACAATAGAAACATTAACAAATC
+TAAAACAGTCTTAATTCTATCTTGAGAAAGTATTGGTAATAATATTATTGTCGATAACGCGAGCATAATA
+AACGGCTCTGATTAAATTCTGAAGTTTGTTAGATACAATGATTTCGTTCGAAGGAACTACAAAATAAATT
+ATAAGGAGGCACTCAAAATGAGTACAAAAGATTTTAACTTGGATTTGGTATCTGTTTCGAAGAAAGATTC
+AGGTGCATCACCACGCATTACAAGTATTTCGCTATGTACACCCGGTTGTAAAACAGGAGCTCTGATGGGT
+TGTAACATGAAAACAGCAACTTGTCATTGTAGTATTCACGTAAGCAAATAACCAAATCAAAGGATAGTAT
+TTTGTTAGTTCAGACATGGATACTATCCTATTTTTATAAGTTATTTAGGGTTGCTAAATAGCTTATAAAA
+ATAAAGAGAGGAAAAAACATGATAAAAAGTTCATTTAAAGCTCAACCGTTTTTAGTAAGAAATACAATTT
+TATCTCCAAACGATAAACGGAGTTTTACTGAATATACTCAAGTCATTGAGACTGTAAGTAAAAATAAAGT
+TTTTTTGGAACAGTTACTACTAGCTAATCCTAAACTCTATGATGTTATGCAGAAATATAATGCTGGT
+

tests/secmet/__init__.py

@@ -0,0 +1 @@
+__version__ = '0.0.1'

tests/secmet/record.py

@@ -0,0 +1,101 @@
+# vim :set et sts=4 sw=4 fileencoding=utf-8 :
+# Licensed under the APL2, see LICENSE for details
+"""Secondary Metabolite Record Objects"""
+
+from Bio import SeqIO
+
+
+class Record(object):
+	"""A record containing secondary metabolite clusters"""
+
+	def __init__(self, seq_record=None):
+		"""Initialise a secondary metabolite record
+
+		:param seq_record:  :class:`Bio.SeqRecord.SeqRecord` to read
+		:type seq_record:   :class:`Bio.SeqRecord.SeqRecord`
+		"""
+		self._record = seq_record
+
+
+	@classmethod
+	def from_genbank(cls, filename):
+		"""Initialise a record from a GenBank file
+
+		:param string filename:    file name of the GenBank file to read
+		"""
+		seq_record = SeqIO.read(filename, 'genbank')
+		rec = cls(seq_record=seq_record)
+		return rec
+
+	@property
+	def id(self):
+		"""Pass through to seq_record object if available"""
+		if self._record is not None:
+		    return self._record.id
+		else:
+		    return "NO_ID_ASSIGNED"
+
+
+	@property
+	def seq(self):
+		"""Pass through to seq_record object if available"""
+		if self._record is not None:
+		    return self._record.seq
+		else:
+		    return None
+
+
+	@property
+	def annotations(self):
+		"""Pass through to seq_record object if available"""
+		if self._record is not None:
+		    return self._record.annotations
+		else:
+		    return {}
+
+	@property
+	def description(self):
+		"""Pass through to seq_record object if available"""
+		if self._record is not None:
+		    return self._record.description
+		else:
+		    return ""
+
+	@property
+	def clusters(self):
+		"""A list of secondary metabolite clusters present in the record"""
+		if self._record is None:
+		    return []
+		clusters = [i for i in self._record.features if i.type == 'cluster']
+		return clusters
+
+	@property
+	def gene(self):
+		"""A list of secondary metabolite clusters present in the record"""
+		if self._record is None:
+			return []
+		gene_list =[i for i in self._record.features if i.type == 'gene']
+		return gene_list
+
+	@property
+	def CDS(self):
+		if self._record is None:
+			return []
+		CDS = [i for i in self._record.features if i.type == 'CDS']
+		return CDS
+
+	def get_cds_from_gene(self,gene):
+		if type(gene) != type(self.gene[0]):
+			return None
+		else:
+			gene_name = gene.qualifiers.__getattribute__.__self__['gene'][0]
+			cds = self.CDS
+			for i in cds:
+				if i.qualifiers.__getattribute__.__self__['gene'][0] == gene_name:
+					return i
+			return None
+
+
+
+
+

tests/test_record.py

@@ -36,3 +36,43 @@ def test_clusters():
     testfile = get_testfile('nisin.gbk')
     rec = Record.from_genbank(testfile)
     assert len(rec.clusters) == 1
+
+def test_gene():
+    testfile = get_testfile('nisin.gbk')
+    rec = Record.from_genbank(testfile)
+    bp_rec = SeqIO.read(testfile, 'genbank')
+    bp_gene = [i for i in bp_rec.features if i.type == 'gene']
+    assert len(bp_cds) == len(rec.gene)
+
+def test_cds():
+    testfile = get_testfile('nisin.gbk')
+    rec = Record.from_genbank(testfile)
+    bp_rec = SeqIO.read(testfile, 'genbank')
+    bp_cds = [i for i in bp_rec.features if i.type == 'CDS']
+    assert len(bp_cds) == len(rec.CDS)
+
+def test_get_cds_from_gene():
+		testfile = get_testfile('nisin.gbk')
+		rec = Record.from_genbank(testfile)
+		bp_rec = SeqIO.read(testfile, 'genbank')
+		bp_gene = [i for i in bp_rec.features if i.type == 'gene']
+		bp_cds = [i for i in bp_rec.features if i.type == 'CDS']
+		#get gene name from bp_gene list
+		bp_gene_name = bp_gene[0].qualifiers.__getattribute__.__self__['gene'][0]
+
+		#get cds name from bp_cds list
+		bp_cds_name = bp_cds[0].qualifiers.__getattribute__.__self__['gene'][0] 
+
+		#compare bp_gene_name and bp_cds_name
+		assert bp_gene_name == bp_cds_name
+
+		#compare bp_cds_name and secmet rec cds name
+		assert bp_cds_name == rec.get_cds_from_gene(bp_gene[0]).qualifiers.__getattribute__.__self__['gene'][0]
+
+
+
+
+
+
+
+