primetime is a pipeline designed for the analysis of TF prime reporter data. It processes fastq files, counts barcodes, clusters them, annotates them, and performs a differential TF activity analysis. The pipeline compares different conditions of the samples based on the 'condition' field in the configuration file.
To install and run primetime, follow these steps:
-
Clone the repository:
git clone https://github.com/vansteensellab/primetime.git cd primetime -
Make sure you have snakemake installed. If you don't have it, you can install it with conda:
conda install -c bioconda snakemake
We recommend trying to run primetime with our test data to check if everything was installed correctly. This should run without any errors.
snakemake --configfile config.yaml --use-conda --cores 10 --printshellcmdsBefore running the primetime, you need to change the parameters on the config.yaml according to your data. Below, we will use our test data (that is meant to access the changes on TF activity on U2OS cells uppon calcitriol treatment) to guide you through the different sections of the configuration file and how to set them up:
Note: The configuration file is sensitive to the number of spaces before each field. Make sure the format of your file is the same as the examples we provide.
The INPUT_DATA parameter specifies the input data for the pipeline. Each sample should have a unique identifier and include information about whether it is pDNA, the condition, and the paths to the fastq files.
Example:
INPUT_DATA:
U2OS_DMSO_12W:
is_pdna: False
condition: DMSO
fastq:
- test_data/U2OS_DMSO_1.fastq.gz
- test_data/U2OS_DMSO_2.fastq.gz
- test_data/U2OS_DMSO_3.fastq.gz
U2OS_Calcitriol_12W:
is_pdna: False
condition: Calcitriol
fastq:
- test_data/U2OS_calcitriol_1.fastq.gz
- test_data/U2OS_calcitriol_2.fastq.gz
- test_data/U2OS_calcitriol_3.fastq.gz
pDNA:
is_pdna: True
condition: None
fastq:
- test_data/pDNA_1.fastq.gzThe COMPARATIVE_ANALYSIS parameter defines the reference and contrast conditions for the comparative analysis. For our test data, we are comparing the cells treated with calcitriol against the control cells, treated with DMSO.
Example:
COMPARATIVE_ANALYSIS:
REFERENCE_CONDITION: DMSO
CONTRAST_CONDITION: CalcitriolThe OUTPUT_DIRECTORY parameter specifies the directory where the output files will be saved.
Example:
OUTPUT_DIRECTORY: test_data_outputThe PVALUE_THRESHOLD parameter sets the p-value threshold for the differential analysis.
Example:
PVALUE_THRESHOLD: 0.05There are some additional parameters on the config file related to the barcodes used in the analysis
Be aware that changing this parameters will impact the counting of the barcodes in the input reads. Only change this parameters if you know what you are doing.
Example:
BARCODE_LENGTH: 12
BARCODE_DOWNSTREAM_SEQUENCE: CATCGTCGCATCCAAGAGGCTAGCTAACTA
MAX_MISMATCH_DOWNSTREAM_SEQ: 3
BARCODE_ANNOTATION_FILE: misc/bc_annotation_prime.csv
EXPECTED_PDNA_COUNTS: misc/expected_pDNA_counts.txtAfter setting up your configuration file, you can run primetime with snakemake.
snakemake --configfile <your_config.yaml> --use-conda --cores 10 --printshellcmdsprimetime generates several output files during its execution:
Inside the primetime_QC folder, several QC plots will be placed:
barcode_correlations.pdf: correlation of Log2(cDNA/pDNA) for different barcodes of each replicate.replicate_correlations.pdf: correlation of Log2(cDNA/pDNA) -- after averaging the different barcodes -- for each sample.bleedthrough_estimation.pdf: estimation of the ammount of pDNA bleedthough (percentage of cDNA counts coming from pDNA) foeach replicate.distribution_of_BC_counts.pdf: distribution of the counts from all the barcodes of each replicate.expected_vs_observed_pDNA_counts.pdf: correlation of your pDNA counts (observed) with the ones of our lab (expected).read_counts.pdf: total amount of reads coming from each replicate.
primetime_results/primetime_results.txt: Main result file, containing the adjusted p-value and the fold-change values for eacTF, as well as the activity of the TFs for each condition.primetime_results/primetime_volcano.pdf: Volcano plot of the differential activity results.primetime_results/primetime_lollipop.pdf: Lollipop plot showing the activity of each TF for both conditions, highlighting thdifferentially active ones.
primetime also saves some additional files in the tmp_primetime folder, such as the barcode counts, and the results of the barcode clustering.
These files provide a comprehensive overview of the TF activity analysis and can be used for further downstream analysis.
